ID: 953282765

View in Genome Browser
Species Human (GRCh38)
Location 3:41574968-41574990
Sequence CAGGGCTGTGGACAGAAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 0, 2: 0, 3: 35, 4: 287}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953282765_953282772 0 Left 953282765 3:41574968-41574990 CCCAGTTTCTGTCCACAGCCCTG 0: 1
1: 0
2: 0
3: 35
4: 287
Right 953282772 3:41574991-41575013 GTTGGATTTAAACCCCTGAAAGG 0: 1
1: 0
2: 2
3: 2
4: 123
953282765_953282774 4 Left 953282765 3:41574968-41574990 CCCAGTTTCTGTCCACAGCCCTG 0: 1
1: 0
2: 0
3: 35
4: 287
Right 953282774 3:41574995-41575017 GATTTAAACCCCTGAAAGGAGGG 0: 1
1: 0
2: 0
3: 15
4: 167
953282765_953282775 5 Left 953282765 3:41574968-41574990 CCCAGTTTCTGTCCACAGCCCTG 0: 1
1: 0
2: 0
3: 35
4: 287
Right 953282775 3:41574996-41575018 ATTTAAACCCCTGAAAGGAGGGG 0: 1
1: 0
2: 0
3: 18
4: 191
953282765_953282773 3 Left 953282765 3:41574968-41574990 CCCAGTTTCTGTCCACAGCCCTG 0: 1
1: 0
2: 0
3: 35
4: 287
Right 953282773 3:41574994-41575016 GGATTTAAACCCCTGAAAGGAGG 0: 1
1: 0
2: 0
3: 12
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953282765 Original CRISPR CAGGGCTGTGGACAGAAACT GGG (reversed) Intronic
900176841 1:1294856-1294878 CAGGGCTCTGGACGGAGTCTGGG - Intronic
900614132 1:3556882-3556904 CAGGGCTGTGGAAAGAACGAAGG + Intronic
900790010 1:4673649-4673671 CGGGGCTGTGGACACAGACGCGG + Intronic
900795140 1:4703285-4703307 CAGGGCTGGGGACTGAGACTGGG + Intronic
901166628 1:7226004-7226026 AGGGGCTGTGGACAGGCACTGGG - Intronic
901205374 1:7491923-7491945 CAGAGCTGTGGACACAGATTCGG - Intronic
904253489 1:29240315-29240337 GAGAGCTGAGGACAGAGACTGGG + Intronic
904284161 1:29443382-29443404 CAGGGACGTGGACAGAAGTTTGG + Intergenic
904684835 1:32252333-32252355 CAGGGAGGTGGAGAGAGACTGGG + Intronic
905768368 1:40621885-40621907 CAGGGCTCTGGTTGGAAACTTGG - Exonic
905891072 1:41518689-41518711 CAGGGCAGTGCACAGCAGCTAGG + Intronic
907770466 1:57457316-57457338 CATGGCAGTGGACAGAAATTGGG + Intronic
908860332 1:68479002-68479024 CAGGAATGTAGACAGAATCTGGG - Intronic
908897719 1:68919146-68919168 CAGGGCTGAGAACACAAATTGGG - Intergenic
910909176 1:92215667-92215689 CAGGGCTGTAGATAGATATTTGG + Intergenic
911336188 1:96583470-96583492 CAGGCCTGTGGACAGCCACTGGG + Intergenic
913260687 1:116995551-116995573 AAGGGCTGAAGACAGAACCTTGG + Intergenic
915063945 1:153209355-153209377 GAGGGCTGGGCACAGAACCTCGG + Intergenic
915792939 1:158695131-158695153 CAGGGCTATGGACAGATACCTGG - Intergenic
916130171 1:161605925-161605947 CAGGGCTGCTGAAAGAAACGCGG - Intronic
917291898 1:173478734-173478756 CAGGGCTGTGCAGAGAACCAGGG + Intronic
918128890 1:181607908-181607930 CAGGGATGTGGACAGGAATATGG + Intronic
919984510 1:202663468-202663490 CGGTGCTGTGGACAGACACAGGG - Intronic
920698186 1:208197836-208197858 CAGTGCTGTGGGCAGCAATTAGG - Intronic
920768333 1:208854927-208854949 CAGGGCTGGAGACAGACACATGG + Intergenic
923121815 1:230999071-230999093 GAGGGCTGAGGACAGAATCCTGG - Intronic
1063126792 10:3142838-3142860 CAGGGCAGTGGGGAGAAACCAGG - Intronic
1063690497 10:8282537-8282559 CAGAGATGGGGACAGGAACTGGG - Intergenic
1064316580 10:14263277-14263299 CAGGCCTCTGCACAGAAACAGGG + Intronic
1064352803 10:14592183-14592205 CAGGGCCCAGCACAGAAACTAGG + Intronic
1064691870 10:17926889-17926911 GAGGGCTTTAGACAGAATCTAGG + Intergenic
1066372949 10:34832760-34832782 GAGGGCAATGGACAGGAACTTGG - Intergenic
1066409353 10:35150970-35150992 GAGACCAGTGGACAGAAACTAGG + Intronic
1067431304 10:46247811-46247833 CTAGGCTGTGGACTGGAACTGGG + Intergenic
1067681588 10:48445242-48445264 AGAGGCTGTGGTCAGAAACTGGG + Intergenic
1068444194 10:57098977-57098999 CAGGGCTGGGGACATCAACCTGG + Intergenic
1069547188 10:69337176-69337198 CAGGGCTGTGGACAGAGAGCTGG - Intronic
1070507524 10:77127376-77127398 CAGGGCAGTGGCTAGAAGCTTGG - Intronic
1072308867 10:94134684-94134706 CAGGTCTGTGGAGAGAAATAAGG + Intronic
1075786090 10:125051183-125051205 CTGGGGTGGGGACATAAACTTGG - Intronic
1077047124 11:551577-551599 CTGGTCTGTGGACAGAGTCTGGG + Intronic
1077141162 11:1025535-1025557 CAGGGCTGAGGGCTGAAGCTCGG + Intronic
1077919817 11:6633629-6633651 CAGGGCTGTTGACAGTAGCCTGG - Exonic
1078099344 11:8320604-8320626 CAGGGCTGGGGACAGAGATGCGG + Intergenic
1078143016 11:8705253-8705275 CATGGCTGTGGAGAGAAATAGGG - Intronic
1078280771 11:9898894-9898916 AGGGGCTAAGGACAGAAACTTGG + Intronic
1079274400 11:19020815-19020837 CAGGGAAGGGGACAAAAACTGGG + Intergenic
1079331288 11:19535136-19535158 CAGGGCTGTGGAGAGTGGCTTGG + Intronic
1080337090 11:31210070-31210092 CATGGATGTGGGGAGAAACTAGG - Intronic
1080405524 11:31975452-31975474 CTGGGCTGGAGACAGAAATTTGG + Intronic
1080447124 11:32347580-32347602 CAGGGCAGTGGTTAGGAACTTGG + Intergenic
1081571531 11:44294342-44294364 CAGGGCTGAGCACAGAGAATCGG - Intronic
1081623691 11:44634356-44634378 CACGGATGTGGACAGAGATTTGG + Intergenic
1081625597 11:44653424-44653446 CAGGGCTGGGGGCAGCAAATGGG + Intergenic
1081906488 11:46673607-46673629 CAGGGCAGTGTAGAGAACCTGGG - Intronic
1082983772 11:59148293-59148315 TAGAGCTGAGGAAAGAAACTTGG - Intronic
1086639883 11:89140679-89140701 CAGAGTTGTGCAGAGAAACTCGG - Intergenic
1086898352 11:92338939-92338961 CATGGCTGAGGTTAGAAACTGGG - Intergenic
1088244421 11:107803151-107803173 CAGGGCTGTGGAAAAAAACATGG + Exonic
1089114252 11:116081417-116081439 CAGGGCTGTGGATGGATATTTGG - Intergenic
1090795909 11:130135530-130135552 CAGGGCAGGGGACAGAAAGCAGG - Intronic
1090866551 11:130705748-130705770 CGGGGCAGTTGGCAGAAACTTGG + Intronic
1094064714 12:26350558-26350580 CAGGGCTCTGGGCAGTGACTTGG + Intronic
1094485768 12:30925422-30925444 CAGGGCTGAAGACAGAATCTAGG - Intergenic
1095494841 12:42773407-42773429 CATGGCCGAGGACAGAACCTTGG + Intergenic
1095495898 12:42783340-42783362 ATGGGCTGAGGAAAGAAACTTGG + Intergenic
1095959278 12:47823991-47824013 CATGGCTGGGGTCAGAAACTTGG - Intronic
1096523474 12:52197211-52197233 CAGGGCTGTGGAGAGAAAAAAGG - Intergenic
1097069274 12:56343088-56343110 CAGGGCAGTTGACAGGTACTTGG - Exonic
1097708047 12:62888371-62888393 CAGGGCTGGGGACACACATTTGG + Intronic
1098074454 12:66713795-66713817 CAGCTCTGTCAACAGAAACTAGG + Intronic
1099508060 12:83503040-83503062 CAGGGCTGTAGACATAAATTAGG + Intergenic
1100709762 12:97243249-97243271 GAGGGCTGAGGACAGAGCCTCGG - Intergenic
1101404108 12:104412943-104412965 CAGGGCTGTGGACTTAAATAGGG + Intergenic
1102015025 12:109642661-109642683 CTGGGCTGGGGATAGAAACGGGG - Intergenic
1102396352 12:112589348-112589370 CAGAGTTGAGGACAGATACTAGG - Intronic
1104361949 12:128141678-128141700 CAGAGCTGTGGGCAGTACCTAGG - Intergenic
1104567110 12:129895072-129895094 CAGGGCTGGGGACAGAGTCCTGG + Intronic
1104763132 12:131309987-131310009 CTGGGCTGCTGACAGAAGCTGGG + Intergenic
1104807461 12:131598786-131598808 CAGGGCTGAGGTCAGAGGCTGGG - Intergenic
1108266843 13:48719203-48719225 GAGGGCTGTGGACAAAATTTTGG + Intergenic
1108642227 13:52393973-52393995 TAGGGCTGGGGGCAGTAACTGGG - Intronic
1110263654 13:73514092-73514114 CAGGGCTGTGGAGAGATGCTAGG - Intergenic
1112356448 13:98677956-98677978 CAGGGCTGGAGACAGAAACCCGG + Intergenic
1112719176 13:102223290-102223312 GAGGGCAATGCACAGAAACTGGG + Intronic
1112726307 13:102308603-102308625 CAGAGCTGGGGCTAGAAACTAGG - Intronic
1113683037 13:112257451-112257473 CTGGGCTCTGGAAAGAAATTTGG + Intergenic
1113778463 13:112962497-112962519 CAGGGATGTGGCCACCAACTGGG - Intronic
1116918248 14:50546197-50546219 GAAGGCTGTGGACAAAAATTTGG - Intronic
1117156839 14:52950684-52950706 CGGGGCTTTCGGCAGAAACTCGG + Intronic
1117348505 14:54857987-54858009 CAGGAATGAGGTCAGAAACTGGG + Intronic
1117471141 14:56046155-56046177 CATGGCTGAGGATAGAACCTCGG - Intergenic
1119379992 14:74222378-74222400 CAGGGCTTTGGCTAGGAACTTGG - Intergenic
1120008065 14:79382439-79382461 TAGGGCTATGTCCAGAAACTAGG + Intronic
1121282530 14:92709624-92709646 CTGGGCTGGGGACAGCACCTGGG + Intronic
1121313656 14:92948675-92948697 CAGGGCTGGGGACAGAGCCCTGG + Intronic
1122640529 14:103156616-103156638 CTGGGCAGGGGACAGAAGCTGGG + Intergenic
1123430185 15:20208316-20208338 CTGAGATGTAGACAGAAACTAGG - Intergenic
1123998559 15:25735317-25735339 CAGTGCTGTGGGCAAAAACATGG - Intronic
1124111663 15:26795760-26795782 CGGGGCTGTGGTCATAAACCTGG + Intronic
1124374727 15:29122755-29122777 TAGCCCTGTGGACAGAAAGTTGG + Exonic
1125519297 15:40339280-40339302 CAGGGCTGTGGACTGGAAAAGGG + Intronic
1125983273 15:44023416-44023438 AGGGGCTGTGGACAGAAAACAGG + Intronic
1126009380 15:44288621-44288643 GAGGGGTGTCGACGGAAACTCGG + Intergenic
1127817198 15:62621495-62621517 CAGGGCTGGGGGCACAAAGTTGG - Intronic
1128373565 15:67059246-67059268 CAGGGCTGTGGGCGGGCACTTGG - Intergenic
1129464689 15:75717263-75717285 CAGGGCAGTGGAAAGAATGTGGG + Intergenic
1129670765 15:77606519-77606541 CAGGGCTGTGGACAGAGCCCAGG + Intergenic
1130948087 15:88564361-88564383 AAGGGCTGTGGAAATAAAATGGG - Intergenic
1132872821 16:2123276-2123298 CAGGGCAGTGGAATGAAGCTGGG + Intronic
1133110188 16:3543435-3543457 CTTGGCTGTGAACAGAACCTTGG - Exonic
1133328960 16:4959268-4959290 CAGGGGTGTGCACAGAGCCTGGG - Exonic
1133996502 16:10752493-10752515 CAGGGGAGAAGACAGAAACTGGG - Intronic
1134551909 16:15142455-15142477 CAGGGCAGTGGAATGAAGCTGGG + Intergenic
1134556387 16:15169163-15169185 TAGAGCTGAGGACAGTAACTGGG - Intergenic
1134916968 16:18080869-18080891 TAGAGCTGAGGACAGTAACTGGG - Intergenic
1135472581 16:22744561-22744583 CAGGGCTGTGGAAATGAAATAGG + Intergenic
1135719957 16:24807888-24807910 CTGGGCTGTGGGCAGAGGCTGGG + Intronic
1136403938 16:30032488-30032510 AAGGGCTGAGGACAGGAGCTAGG - Intronic
1136513610 16:30754492-30754514 CAGGGCTGTGGAGAGGATTTAGG - Intronic
1137259524 16:46813035-46813057 GAGGGCTCTGGACAGAATCCTGG - Intronic
1138236237 16:55385540-55385562 CAGGACTGTGGACAGAGGCAAGG + Intergenic
1139546173 16:67650714-67650736 CAGTGCTGTGGACAGAGGTTGGG + Intronic
1139687868 16:68618310-68618332 CAGAGCTGTGGAAAGAGGCTGGG - Intergenic
1139917620 16:70438378-70438400 CACGGCTGAAGCCAGAAACTTGG - Intronic
1143382558 17:6505547-6505569 CACAGATGTGGACAGAAACAAGG + Intronic
1143518193 17:7430362-7430384 CAGGGCTGGGGGCAGAGGCTGGG - Intergenic
1143632540 17:8147306-8147328 CAGGGCTGTGGAGAGGGCCTGGG + Exonic
1143633350 17:8151095-8151117 CACGGCTGTAGACAAAAACCTGG + Intronic
1143858206 17:9868387-9868409 CAGATCTGTGCACAGAAGCTGGG + Intronic
1147875641 17:43618581-43618603 CAGGGCTTTGGGCAGAAATAGGG + Intergenic
1149458861 17:56811161-56811183 TAGGGCTCTGGATAGAACCTTGG - Intronic
1149511123 17:57242631-57242653 CAGAGCTGTGGCCAGCCACTGGG + Intergenic
1151487049 17:74407615-74407637 CAGGGCTGTGGTCAGGATATGGG + Intergenic
1151890259 17:76947345-76947367 CAGGGCCGTGGCCAGAACCCAGG + Intronic
1152584368 17:81182413-81182435 CAGGCCTGTGGCCAGCCACTGGG - Intergenic
1152738485 17:82008855-82008877 CAGGGCTGGGCACAGCAGCTGGG - Intronic
1155447516 18:25927755-25927777 CAGGGCTGTGGTGAGAAATATGG + Intergenic
1156111519 18:33732896-33732918 AAGGGCTGAGAACAGAAAATTGG - Intronic
1157312681 18:46563823-46563845 CAGGGATGTGGAGAGACACCAGG + Intronic
1157483961 18:48073820-48073842 TAGGGCTTTGTGCAGAAACTCGG - Intronic
1157522729 18:48356498-48356520 CAGGGCAGTGTTCAGGAACTTGG + Intronic
1157574799 18:48736415-48736437 CAGAGCTGTGCATAGAAGCTGGG + Intronic
1158019289 18:52822395-52822417 CTTGGCTGTGGCCTGAAACTAGG - Intronic
1158383244 18:56959271-56959293 CAGGGCTGTGAACAGAAGGGAGG + Intronic
1159936359 18:74371212-74371234 CAAGGCTGCGGTGAGAAACTTGG + Intergenic
1160534207 18:79583750-79583772 CAGGGCTGTGGAGAGCCACAGGG - Intergenic
1160659777 19:292458-292480 CAGGCCTGGGGTCAGAAACAAGG + Intergenic
1160982824 19:1824007-1824029 CAGGGCTGAGGACATAGCCTGGG - Intronic
1161038657 19:2098700-2098722 CAGGTCTGTGGTCAGAGCCTGGG + Intronic
1162479509 19:10920441-10920463 CGGGGCTGTGGACAGCCACACGG - Exonic
1162519844 19:11173356-11173378 TAGGGCTGAGAATAGAAACTGGG + Intronic
1163187496 19:15649309-15649331 CTGGGCCGTGGACACAAAGTTGG + Intronic
1163412230 19:17162375-17162397 CAGGGCGCTGTACAGAGACTTGG - Exonic
1165132604 19:33642049-33642071 CAGGGCTCTGGTGAGACACTAGG - Intronic
1165311876 19:35033418-35033440 CAGGGCAGGGGACAGAATCAGGG + Intronic
1165757778 19:38304357-38304379 CAGGGCTGTGGAGAGAAGTTGGG - Exonic
1166083137 19:40457752-40457774 TAGAGCTGTGGATAGACACTAGG - Intronic
1166327328 19:42059300-42059322 AAGGACTGGGGCCAGAAACTTGG - Intronic
1166751725 19:45167045-45167067 CAGGGCTGGGGACGCAAGCTGGG - Intronic
1167898017 19:52597685-52597707 CAGGGCCTTGAACAGAATCTGGG + Intronic
925878997 2:8335098-8335120 CAGGGCTCTGGACAGAGTTTGGG - Intergenic
926219550 2:10925602-10925624 CAGGGCTGGGGACACACCCTGGG - Intergenic
928185909 2:29110637-29110659 CAGGGCTGGAGATAGAAATTTGG + Intronic
930050440 2:47211558-47211580 CAGGACTGTGGGCAGCAACAAGG + Intergenic
930732556 2:54742336-54742358 CAAGGCTGTGGGCAGTAACATGG - Intronic
933245191 2:79967051-79967073 CAGGGCTGGGGTTATAAACTTGG - Intronic
934765141 2:96876346-96876368 CAGGGCAGTGGGCAGCACCTGGG - Intronic
934856048 2:97731028-97731050 CCGGGCTGTGGAGCGAGACTCGG + Intronic
934919184 2:98328804-98328826 CAGGTTTGTTGACAGAAACTAGG + Intergenic
935800631 2:106691612-106691634 CAGGGGTGTAGACAGAAAAAGGG + Intergenic
935812170 2:106809152-106809174 CTGGGCAGTGCACAGCAACTTGG - Intronic
937104053 2:119293990-119294012 CTGGGCTGTGGACTGAAATCCGG + Intergenic
937290647 2:120779746-120779768 CAGGGCCGGGGTCAGACACTAGG + Intronic
937438795 2:121900057-121900079 CAGGCCTGTGGTCAGAACCCCGG + Intergenic
937443607 2:121937764-121937786 CAAGGCTGGGGACATAACCTGGG + Intergenic
937869086 2:126774935-126774957 CAGGGTTCTGGAGAGAAACTTGG - Intergenic
938781210 2:134586671-134586693 CAGAGCTGTTGACAGAATCCAGG + Intronic
941162603 2:162052760-162052782 GAGAGCTGTGGATAGAACCTCGG + Intronic
944269080 2:197760568-197760590 CAGGGCTGTGTACATGAACATGG - Intronic
945067141 2:205956830-205956852 CCCGGCTGTGTACAGAAGCTGGG + Intergenic
945739186 2:213640545-213640567 CAGGGCTCTGGTCTGATACTGGG + Intronic
946237382 2:218332496-218332518 CAGGGCTGGGGAGAGCCACTAGG + Intronic
946308658 2:218871024-218871046 CAGGGCTGTGGGCAGCCCCTTGG + Exonic
946630274 2:221659504-221659526 TAGGACTGGGGACAGAAAATTGG + Intergenic
947736445 2:232457758-232457780 CAGGGCTGTGGGCTGAAGCCTGG + Intronic
947926315 2:233925501-233925523 GAGGGCTCTGGACAGAAGGTGGG + Intronic
948232995 2:236365578-236365600 CAGTGCTGAGGACAGAGCCTTGG + Intronic
948611538 2:239170743-239170765 CAGGGCCGAGGTCAGAAACAGGG + Intronic
948666112 2:239535821-239535843 CAGAGCTGTGGACAGAAGGTGGG - Intergenic
948973203 2:241445282-241445304 GAGGGCTGTGAGCAGTAACTCGG - Intronic
1168955810 20:1833396-1833418 CTGGGCTGGGGACAGAAACCTGG - Intergenic
1171166436 20:22975851-22975873 GAGGTCTGAGGACAGAAATTTGG + Intergenic
1171211024 20:23316977-23316999 CAGTGCTGTGGACAGGGTCTGGG - Intergenic
1171400471 20:24870044-24870066 CAGGGCTGGGGACAGAGAGGTGG - Intergenic
1172262148 20:33576641-33576663 CTGGGCTGTGCCCAGAAAATTGG - Intronic
1172892729 20:38278407-38278429 CAGGGCTGCGGACTGAAACGGGG - Intronic
1173077438 20:39832909-39832931 CAGAGGTGTGGACTGAAAGTTGG - Intergenic
1174055336 20:47794643-47794665 CTGGGCTGTGGACAGTGTCTGGG + Intergenic
1174078171 20:47952645-47952667 CAGGGCTGGGGACAGCATCCAGG - Intergenic
1174139961 20:48405862-48405884 CAGGGCTGGGGACAGGAACACGG + Intergenic
1174718999 20:52790924-52790946 CAAAGCTGTGGACAGGATCTAGG + Intergenic
1176219310 20:63962549-63962571 CAGGGCTGTGGACAGCGCCGTGG - Intronic
1177602020 21:23327784-23327806 GAGGGATGTGGCAAGAAACTGGG + Intergenic
1179348234 21:40581574-40581596 TGGGGATGGGGACAGAAACTGGG + Intronic
1179654203 21:42835029-42835051 CAGGCCTGTAGACAGAAAGACGG + Intergenic
1181782441 22:25202808-25202830 CAGGGCTGTGGCGAGGGACTGGG - Intronic
1182117513 22:27765701-27765723 TAGTGCTGTGGAGAGAACCTGGG - Intronic
1182354372 22:29715760-29715782 CTGGGCTGGGAGCAGAAACTTGG - Intergenic
1182521876 22:30889408-30889430 CAGGGTGGAGGGCAGAAACTTGG + Intronic
1182592760 22:31394775-31394797 CAGGGATGGTGACAGACACTGGG - Intergenic
1183606326 22:38868574-38868596 AAGGGCTGGGGACAGAGGCTGGG + Intronic
1183653208 22:39170915-39170937 CAGGGCTCTGGACGGGAACTGGG - Intergenic
1184040326 22:41939279-41939301 CAGGGCTGGGGGCGGATACTTGG + Intronic
1184255380 22:43283503-43283525 CAGGGCTGTGGATATCAACTGGG - Intronic
1184261889 22:43322317-43322339 CAGGGCTGCAAACAGAGACTGGG - Intronic
1184508276 22:44917202-44917224 CAGGGCTCTGGACAGACTGTTGG + Intronic
1184688275 22:46106153-46106175 CAGGGCTGTGGGGAGAATCCGGG - Intronic
1184845127 22:47078203-47078225 CAGTGCCGTGGAGAGAAACAGGG + Intronic
1184846794 22:47092646-47092668 CAGGGCTGGGGACAGAACGTGGG + Intronic
1185231808 22:49687952-49687974 CAGGGCTGGGGGCAGCCACTGGG + Intergenic
950704323 3:14770557-14770579 CTGGGCTGGGGACAGGAAGTGGG - Intronic
953282765 3:41574968-41574990 CAGGGCTGTGGACAGAAACTGGG - Intronic
954715365 3:52524156-52524178 CAGGGTTGGGGACAGAGACCAGG - Exonic
960789226 3:121409194-121409216 CTGAGCTGAGGATAGAAACTTGG + Intronic
961674764 3:128557963-128557985 GAGGGCTGGGGACAGATGCTGGG + Intergenic
962165372 3:133041928-133041950 CAGGGCTGTCCACAGAAGATAGG + Intronic
962251861 3:133840591-133840613 TAAGGCTGTGGACAGCACCTAGG + Intronic
962484740 3:135831299-135831321 CTGGGCCGAGGACAGAAAATTGG + Intergenic
963003943 3:140708460-140708482 CATGGCTATGGACAGAAGCGGGG - Intergenic
963976070 3:151481539-151481561 CAGGACTCTGGATAAAAACTTGG + Intergenic
965913897 3:173817123-173817145 CAGAGCTGTGGGCAGAAAAGAGG + Intronic
966322706 3:178718706-178718728 TGGGGCAGTGGAAAGAAACTGGG - Intronic
967279806 3:187810976-187810998 CTGGGCTGTGAAACGAAACTTGG + Intergenic
969366959 4:6701457-6701479 CAGGGCAGTGGAGAAACACTTGG - Intergenic
969842195 4:9890841-9890863 CAGGGCTGTGGCCATAAAGAAGG - Intronic
970084432 4:12330831-12330853 CAGGAATGTGGACAGCAATTTGG - Intergenic
971517824 4:27511000-27511022 CAGCTCTGTGGACAGAAAAGGGG - Intergenic
973548399 4:52005737-52005759 CAGGGCTGTGCACAGGGACTTGG - Intronic
975091130 4:70405513-70405535 AATGGCTGAAGACAGAAACTTGG - Intronic
976933807 4:90603383-90603405 CAGGGCTGAGGACAGGCACAAGG - Intronic
977623137 4:99160156-99160178 GAGGGCTGTGGACAGACTCTAGG - Intergenic
980993150 4:139756412-139756434 CATGGCTGAAGACAGAAAGTTGG + Intronic
981238815 4:142450103-142450125 GAGAGCTGGGGACAGAATCTAGG - Intronic
982405637 4:155016719-155016741 CAGGGATGTGGAGAGAAGATGGG + Intergenic
985440442 4:189979876-189979898 CACAGCTGTGGATAGAAGCTGGG - Intergenic
985484207 5:139830-139852 CAGGGCTGGGGACAAAGACAGGG - Intergenic
985930363 5:3052283-3052305 AAGGGCTGTGGACAGTGGCTTGG + Intergenic
986059492 5:4174592-4174614 CGGGGCTAGGGAGAGAAACTTGG + Intergenic
986280393 5:6317336-6317358 CTGGTCTGTGGAGAGCAACTGGG + Intergenic
986377164 5:7144107-7144129 AAGGGCTGAGGACCAAAACTTGG + Intergenic
988049429 5:26006860-26006882 CAGTGCGGAGGACAGGAACTCGG - Intergenic
988483386 5:31648214-31648236 CAAGGCTATGGACATAAATTTGG - Intronic
988613093 5:32746424-32746446 CAGGGTTCAGGACAGTAACTGGG - Intronic
990169405 5:53030953-53030975 CAGGGCTGTGGCCAGGATCCAGG + Intronic
992398091 5:76386180-76386202 CTGGGCTGTGAAGAAAAACTAGG + Intergenic
992778876 5:80110490-80110512 CAGAGCGGGGGACAGAAGCTGGG + Intergenic
993837859 5:92836746-92836768 CAGTGCTGTGGACAGATAGTAGG + Intergenic
994332779 5:98526844-98526866 AGGGGCTGTGGGCAGAAGCTGGG - Intergenic
997428795 5:133823377-133823399 CAGGGCTGGGGAGAGATTCTGGG - Intergenic
999267932 5:150278967-150278989 CAGGGCTGAGGGCTGAGACTTGG - Intronic
999699746 5:154217641-154217663 CAGGGGTGTGGACAGGAAGAGGG - Intronic
1000129008 5:158276794-158276816 CAGCGTTGAGGACAGAAACTGGG - Intergenic
1001023962 5:168207441-168207463 CACGGCTGTCGAGGGAAACTGGG - Intronic
1001493898 5:172174617-172174639 CAGGGCTGTTGTTACAAACTGGG - Intronic
1003691468 6:8358417-8358439 CAGAGCTGGGGATAGGAACTGGG - Intergenic
1004181628 6:13385472-13385494 TGGGGCTGTGGACAGAAGATAGG + Intronic
1004850600 6:19694806-19694828 AAAGGCTGTAGACAGAAAATAGG + Intergenic
1006739997 6:36301347-36301369 CAGGGCTGTAGGCAGCAGCTAGG - Intronic
1007249677 6:40487312-40487334 CAGGGCTGAGGGCATGAACTTGG - Intronic
1008538129 6:52523104-52523126 CAGGGATTCGGAAAGAAACTAGG - Intronic
1009768280 6:68110410-68110432 CAATGCTGTGGACAGAATTTTGG + Intergenic
1010147692 6:72690479-72690501 TAGGGTTGTGGACAGAAGATTGG + Intronic
1010779989 6:79934125-79934147 CAGGGCTGTGGACACACAGAGGG + Intronic
1011622173 6:89253168-89253190 CAGGTCTGTGGACAAGAGCTCGG - Intergenic
1011640730 6:89413727-89413749 CAGGGGTGTGGACAGAGTTTAGG + Intergenic
1012724330 6:102789735-102789757 CTGGGCTATGAACAGAAATTTGG + Intergenic
1013823450 6:114183045-114183067 CAGGCCTTTGGACTCAAACTGGG + Intronic
1014269029 6:119314980-119315002 CAGAGCTGTAGACAGCAGCTTGG - Intronic
1019260980 7:81874-81896 CTGTGCTGTGGGCAGAAGCTGGG - Intergenic
1019262790 7:91528-91550 CAGGTCTGGGGACAGAACGTCGG + Intergenic
1019702829 7:2482334-2482356 CTGGGCTGGGGACAGAAGCAAGG + Intergenic
1020137529 7:5595115-5595137 GAGGGATGAGGACACAAACTGGG - Intronic
1020285711 7:6678601-6678623 CAGGGCTGAGGATAGAGACAAGG + Intergenic
1021564639 7:22004934-22004956 CAGGGCTGAGGATAGAAAATTGG - Intergenic
1021638453 7:22714476-22714498 CAGAGTTGGGGACATAAACTTGG + Intergenic
1023723584 7:43119564-43119586 CAGGGCTGACGAAATAAACTTGG - Intronic
1028091790 7:86711798-86711820 GAGGACTGAGGACAGAACCTTGG - Intronic
1030101031 7:105945482-105945504 CAAGGCTGTGCAGAGAATCTGGG - Intronic
1034115355 7:148579057-148579079 CAGGGCCATGGACAGAAGCTTGG + Intergenic
1034335280 7:150319031-150319053 CTGGGCTGTAGACAAAAATTTGG + Intronic
1034507151 7:151501892-151501914 CAGTGCTGTGGACAGGAACGTGG + Intronic
1034732157 7:153397374-153397396 CAGGAATGTGGACATGAACTGGG + Intergenic
1034999493 7:155601461-155601483 CAGGGCTGTTGTCTGAATCTAGG + Intergenic
1035548816 8:504129-504151 CAGGGCTGCGGTCAGAACCCAGG - Intronic
1035607741 8:940097-940119 CAGAGCTGTGGAAAGACAGTGGG + Intergenic
1036581581 8:10080443-10080465 CAGTCCTGTGGAAAGAACCTCGG - Intronic
1036584642 8:10112124-10112146 CAGGACTGTGGATAAAAGCTGGG - Intronic
1037185252 8:16055078-16055100 CAGGGTTTTGGATAGAAACTCGG - Intergenic
1038160052 8:25027945-25027967 GAGGGATGTGGGCAGAATCTGGG + Intergenic
1038579727 8:28737515-28737537 CAAGGGTGTGGAGAGAAGCTCGG + Exonic
1039891262 8:41687235-41687257 CCGGGCTCTGGACAGAAATACGG + Intronic
1040355857 8:46617588-46617610 CAGGGCTGTGGACAGCATGCCGG + Intergenic
1040905317 8:52463767-52463789 CTGGGCTGTGGACTGATACTGGG - Intergenic
1047288806 8:123511201-123511223 CAGAGCTGAGGCCAGAACCTTGG - Intronic
1047822177 8:128533047-128533069 CAAGGCTGTGGGGAGAAAATGGG + Intergenic
1048881360 8:138875274-138875296 CAGGGCTGGGAACAGAACCCAGG - Intronic
1048892311 8:138959117-138959139 TAAGGCTGTGGGCAGAAACCAGG - Intergenic
1049593099 8:143471500-143471522 CAGCCCTGTGGCCAGAGACTGGG + Intronic
1053189809 9:36054082-36054104 CAGGGGTGTGGAGAGAGACCAGG + Intronic
1055470085 9:76602421-76602443 CTGGGCTCTGGAGAGACACTGGG - Intergenic
1058163382 9:101594441-101594463 CAGTGCTGTGGTCAGAGACCTGG - Exonic
1058421893 9:104840527-104840549 CAGGGATGGGGACAGAAAGGAGG + Intronic
1061090459 9:128423070-128423092 CAGGGCAGTGGACAGAGCCCTGG - Intronic
1061643025 9:131974619-131974641 CAGAGCTGGGGACAGAAATCAGG + Intronic
1062147343 9:134996979-134997001 CAGGGCTGGAGACAGACACTGGG + Intergenic
1062623575 9:137433361-137433383 GAGGGGTGTGGACAGAGACTGGG - Intronic
1186573635 X:10742286-10742308 CAGGATTGTGGCCAGAAAGTGGG + Intronic
1186920573 X:14274822-14274844 CAGGGCTGGAGAGAGAAACTAGG + Intergenic
1189142979 X:38626147-38626169 GAGGGCTGTGGTCAGAGAGTGGG + Intronic
1198504785 X:137290738-137290760 TAGAGCTGTTGAAAGAAACTGGG + Intergenic
1199238933 X:145524560-145524582 CTAGGCTGGAGACAGAAACTTGG + Intergenic
1199803132 X:151270975-151270997 GAGTGCTGTAGACAGAAAGTGGG - Intergenic