ID: 953282765

View in Genome Browser
Species Human (GRCh38)
Location 3:41574968-41574990
Sequence CAGGGCTGTGGACAGAAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 0, 2: 0, 3: 35, 4: 287}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953282765_953282773 3 Left 953282765 3:41574968-41574990 CCCAGTTTCTGTCCACAGCCCTG 0: 1
1: 0
2: 0
3: 35
4: 287
Right 953282773 3:41574994-41575016 GGATTTAAACCCCTGAAAGGAGG 0: 1
1: 0
2: 0
3: 12
4: 132
953282765_953282774 4 Left 953282765 3:41574968-41574990 CCCAGTTTCTGTCCACAGCCCTG 0: 1
1: 0
2: 0
3: 35
4: 287
Right 953282774 3:41574995-41575017 GATTTAAACCCCTGAAAGGAGGG 0: 1
1: 0
2: 0
3: 15
4: 167
953282765_953282772 0 Left 953282765 3:41574968-41574990 CCCAGTTTCTGTCCACAGCCCTG 0: 1
1: 0
2: 0
3: 35
4: 287
Right 953282772 3:41574991-41575013 GTTGGATTTAAACCCCTGAAAGG 0: 1
1: 0
2: 2
3: 2
4: 123
953282765_953282775 5 Left 953282765 3:41574968-41574990 CCCAGTTTCTGTCCACAGCCCTG 0: 1
1: 0
2: 0
3: 35
4: 287
Right 953282775 3:41574996-41575018 ATTTAAACCCCTGAAAGGAGGGG 0: 1
1: 0
2: 0
3: 18
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953282765 Original CRISPR CAGGGCTGTGGACAGAAACT GGG (reversed) Intronic