ID: 953282917

View in Genome Browser
Species Human (GRCh38)
Location 3:41575952-41575974
Sequence TCCCTTTGGCTCCACTGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 189}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953282917_953282925 6 Left 953282917 3:41575952-41575974 CCCTGGCAGTGGAGCCAAAGGGA 0: 1
1: 0
2: 1
3: 27
4: 189
Right 953282925 3:41575981-41576003 CAGGAGCAGCTCCCTGGGGATGG 0: 1
1: 1
2: 7
3: 73
4: 524
953282917_953282922 1 Left 953282917 3:41575952-41575974 CCCTGGCAGTGGAGCCAAAGGGA 0: 1
1: 0
2: 1
3: 27
4: 189
Right 953282922 3:41575976-41575998 GCTGCCAGGAGCAGCTCCCTGGG 0: 1
1: 1
2: 4
3: 43
4: 322
953282917_953282921 0 Left 953282917 3:41575952-41575974 CCCTGGCAGTGGAGCCAAAGGGA 0: 1
1: 0
2: 1
3: 27
4: 189
Right 953282921 3:41575975-41575997 AGCTGCCAGGAGCAGCTCCCTGG 0: 1
1: 1
2: 8
3: 60
4: 417
953282917_953282923 2 Left 953282917 3:41575952-41575974 CCCTGGCAGTGGAGCCAAAGGGA 0: 1
1: 0
2: 1
3: 27
4: 189
Right 953282923 3:41575977-41575999 CTGCCAGGAGCAGCTCCCTGGGG 0: 1
1: 0
2: 8
3: 55
4: 389

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953282917 Original CRISPR TCCCTTTGGCTCCACTGCCA GGG (reversed) Intronic
900286129 1:1901518-1901540 TCCCTTCGCCTCCCCTGCCAGGG + Intergenic
901843148 1:11966197-11966219 CACCATTGGCTCAACTGCCAGGG - Intronic
902488898 1:16766136-16766158 TGCCTTTCCCTCCACTGCCAGGG - Intronic
902696821 1:18145803-18145825 GCCCTTGGGCTCCCCTGCCAAGG + Intronic
905507273 1:38490001-38490023 TGCCCTTGCCTTCACTGCCAGGG + Intergenic
905890752 1:41516904-41516926 TCTCTTTGGCTTCACAGGCAGGG + Intronic
907440752 1:54476673-54476695 TCCATTTGGTTTCACTGCCCTGG + Intergenic
913416970 1:118619437-118619459 TCCCTATGCTGCCACTGCCAGGG + Intergenic
916174460 1:162025907-162025929 TCTCTTTCTCTCCCCTGCCATGG - Intergenic
920274033 1:204790580-204790602 TCCCTTCATCCCCACTGCCATGG + Intergenic
920660074 1:207908231-207908253 TCCCTTTGGCTCCACCTCCTGGG - Intronic
920693113 1:208161795-208161817 TCCCTTTTTCTCCACAGTCATGG + Intronic
920737555 1:208546921-208546943 GCCCTTTGGCTTCACCACCAAGG - Intergenic
922001033 1:221478475-221478497 TCCCTTTTACCCTACTGCCAGGG + Intergenic
923286039 1:232496675-232496697 TTCCATTGGATCTACTGCCATGG - Intronic
923531539 1:234816388-234816410 TGCCTTTCCCTCCACTGCCAGGG + Intergenic
924528885 1:244876757-244876779 TCCCTCTGGCACCACTGACCTGG - Intergenic
1062815245 10:494698-494720 TCCCCTTGGTTCCCCTGACATGG - Intronic
1063127115 10:3145029-3145051 TCCCAAAGGCTCCACTCCCAGGG + Intronic
1063662304 10:8043245-8043267 CGCCTTTGGCTCTCCTGCCAGGG - Intergenic
1064153651 10:12886011-12886033 TCCCTTAGCTTCCACTCCCATGG + Intergenic
1067238867 10:44473598-44473620 CCCATTTGGCTCCACTCCCTAGG + Intergenic
1069594594 10:69662629-69662651 TCCTTTTGGCTCCATGCCCATGG + Intergenic
1069762393 10:70820879-70820901 TCCCTTTTGCTACTCTGACATGG - Intronic
1070112771 10:73500662-73500684 TCTATTGGGCTCCCCTGCCATGG + Exonic
1070857639 10:79619958-79619980 TTCCATGGGCTCCACTTCCATGG - Intergenic
1070922117 10:80194559-80194581 GCCCCTATGCTCCACTGCCAGGG - Intronic
1071100987 10:82037369-82037391 TGCCTTTGGCCCTAGTGCCATGG - Intronic
1072163318 10:92788239-92788261 TCCTTTTGGCCCCAGTTCCATGG + Intergenic
1073215055 10:101831446-101831468 TACCCTTGGCTCAAGTGCCATGG + Intronic
1073609481 10:104928998-104929020 TACCTCTGGCTGCCCTGCCAAGG - Intronic
1075564875 10:123495866-123495888 TCCATTTGGGACCACAGCCAGGG + Intergenic
1076307204 10:129473875-129473897 TTCCTCTGGCCCCACTGCCCTGG - Intronic
1076424427 10:130357414-130357436 TCCCTTTGGCTCCCCCAGCATGG + Intergenic
1076859359 10:133133361-133133383 TCCCTTCCACTGCACTGCCAGGG + Intergenic
1079003947 11:16779596-16779618 TCCCTATGGCTCCTCAACCACGG + Intronic
1082814518 11:57499447-57499469 TCCGTGAGGCACCACTGCCAAGG + Intronic
1082976903 11:59081551-59081573 ACACTTTGGCTCAGCTGCCATGG + Intergenic
1084351310 11:68601949-68601971 ACCTTCTGGCTGCACTGCCAGGG - Exonic
1084485841 11:69447678-69447700 TCCCTGTGTCCCCACTGCCTGGG + Intergenic
1084609921 11:70195485-70195507 TGCCTTTTGCTCTTCTGCCAAGG - Intergenic
1086419808 11:86627717-86627739 TCCTTAAGGCTCCTCTGCCAAGG + Intronic
1087012825 11:93529686-93529708 TCCCTTTAACTCCAAGGCCAAGG + Intronic
1088139367 11:106596764-106596786 ACCCTTTGGCTGCCCTGCCTTGG + Intergenic
1088360157 11:108981047-108981069 TCCCTGTGGCTCAAATGGCAGGG + Intergenic
1089357975 11:117867911-117867933 TGCCCTTGGCTACACTGCCCGGG - Intronic
1092100893 12:5882993-5883015 TTCCTGTGGCTTCCCTGCCAGGG + Intronic
1095094340 12:38137770-38137792 CCCCATTGGCTCCTCAGCCAAGG - Intergenic
1095155244 12:38845039-38845061 TCCCCATGGCTCTGCTGCCATGG - Intronic
1096696565 12:53352728-53352750 TTCCCTTGGGTCCACTGCCCTGG + Intergenic
1097091780 12:56511156-56511178 TCCCTTTGGCCCCATTGTAAGGG - Intergenic
1097147157 12:56949615-56949637 GCACTGTGCCTCCACTGCCAGGG + Intergenic
1097197944 12:57254582-57254604 TCCTTCTTGCTCCCCTGCCATGG - Exonic
1097516845 12:60617326-60617348 TCCTTTTGGTTCCTCTGACAGGG - Intergenic
1101509251 12:105377947-105377969 TCCCATTGGCTCCATTTCTATGG - Intronic
1101512208 12:105403524-105403546 TCCCTTTCTCCCCACTGCCTGGG + Intergenic
1102356753 12:112243481-112243503 TCCTTTTGGCTGCACAGACAAGG - Exonic
1103536388 12:121636547-121636569 TCCACTTGGCTCCACAGCCCGGG - Intronic
1109518762 13:63481246-63481268 TACCTTGGGCTCCACTTCTAGGG - Intergenic
1110679011 13:78285580-78285602 TCCCTTTGGCTGTTCTGCCAAGG - Intergenic
1111125438 13:83907511-83907533 GCCCTTGGGCTCCCCTGCCAGGG - Intergenic
1112731529 13:102368044-102368066 TCCCTTGGCCTCGACTGCCAAGG + Intronic
1113511040 13:110855051-110855073 TCCCTGGGGCACCACTGCCTTGG + Intergenic
1113560112 13:111272149-111272171 TCCATGTGGATCCCCTGCCAGGG - Intronic
1113842047 13:113365875-113365897 TCCCTTTCCCACCACTGCCGTGG + Intergenic
1115307738 14:31949847-31949869 TCCCTCTGCCTCCACTGAGAGGG + Intronic
1116165637 14:41330989-41331011 TACCTTTGTCTCTGCTGCCAAGG + Intergenic
1117178080 14:53165584-53165606 TCCCTCTGGCTCCACTATCCAGG + Intergenic
1117327241 14:54680880-54680902 TCTCTCTGGCTCCGCTGGCAGGG - Intronic
1117584589 14:57187382-57187404 CCCCTTCCTCTCCACTGCCAGGG - Intergenic
1118905177 14:70018538-70018560 TCCCTTTGGCCCCTCTGGCCAGG + Intronic
1121212157 14:92215358-92215380 TCCCATTTGCTCCTCTGCCAAGG - Intergenic
1123887027 15:24736215-24736237 TCCCTTTGGGTCCCCTGTCTTGG - Intergenic
1124704683 15:31954022-31954044 GCCCTTTGCCTCCACATCCAAGG + Intergenic
1127363021 15:58261575-58261597 TCCCTCTGGCACCACGACCAGGG - Intronic
1128927313 15:71670027-71670049 TCTCTTCAGCTCCACTGCCAAGG + Intronic
1129668953 15:77596389-77596411 TCCCTTAGGCTAGAGTGCCATGG - Intergenic
1129883787 15:79025039-79025061 GCCCTCTGGCTCCTCTGCCCAGG + Intronic
1130784183 15:87077629-87077651 TCTCATTGGCCCCACTTCCAAGG + Intergenic
1131441999 15:92466551-92466573 GCCCTTTGACTCCCCTGCAAAGG - Exonic
1132209105 15:100007374-100007396 TCCCCTTGCCACCACTGCCTTGG - Intronic
1134447109 16:14339000-14339022 TCCCTGTGGCTCCTCTCACAAGG + Intergenic
1135191847 16:20360786-20360808 TCTCTTAGCCTCCAGTGCCATGG + Intronic
1136057567 16:27701728-27701750 TCCCCATGGCTGCACTGCTAAGG - Intronic
1136414849 16:30096596-30096618 TCCCGTTGGCTCCACTGTACCGG + Intronic
1136612832 16:31377684-31377706 TGCCTGTGGGTCCCCTGCCAAGG - Intronic
1137762349 16:50950760-50950782 TCCCTTGTGCTCCAATTCCATGG + Intergenic
1141218323 16:82045552-82045574 TCCTTTTGTCTCCTTTGCCAAGG - Intronic
1142132144 16:88435990-88436012 TGCCTCTGGCTCCAGTGCCAAGG + Exonic
1146143655 17:30390632-30390654 TGCCTTTGCCTTCATTGCCAGGG + Intronic
1146150940 17:30471111-30471133 TCACTTTGGCTCCACCTCAATGG - Intergenic
1146932962 17:36791150-36791172 TCCATCTGGCTGCCCTGCCATGG + Intergenic
1147134362 17:38426719-38426741 TCCCTTTCTCTTGACTGCCAGGG + Intergenic
1150346192 17:64406421-64406443 TTCCTTGGGCTCCTCAGCCATGG + Intronic
1150705688 17:67485114-67485136 ACCCTGTGGCTACACTGCCCAGG - Intronic
1151459038 17:74243874-74243896 TGCCTTTGGATCCATTGCAAGGG + Intronic
1156067790 18:33166005-33166027 TACTTTTGGCACCACTGCCTTGG + Intronic
1158570129 18:58591118-58591140 TCCCTTTGTCTCTGCTGCCCAGG + Intronic
1158653146 18:59305595-59305617 TCCTATAGGCTCCACTTCCATGG - Intronic
1159003880 18:62995821-62995843 TCACTCTTGCTCCACTGCCCTGG - Intergenic
1159082658 18:63752975-63752997 TCCCTTTGGCTCAACTCCCAAGG - Intronic
1165226662 19:34359736-34359758 TCCCTCTGCCTTCACTCCCATGG + Intronic
1167489013 19:49781244-49781266 CCCCTTTGTCCCCACAGCCATGG - Intronic
925125907 2:1455660-1455682 TCCCTTAGGCTTCAAGGCCAAGG + Intronic
929428022 2:41863787-41863809 ACCCTGTTGCTCCACTGCCTGGG + Intergenic
930757471 2:54991628-54991650 TCGGTTTGGATCCACTGACAGGG - Intronic
942144417 2:173012416-173012438 TCCATTTGGCTCCTATGCCATGG + Intronic
942448982 2:176097594-176097616 TCCCTCTGGCTCCGCTGTCAGGG + Intergenic
944538074 2:200730845-200730867 TCCCTGTGGAACCAGTGCCAAGG - Intergenic
944961204 2:204876059-204876081 TACAACTGGCTCCACTGCCATGG - Intronic
945514800 2:210749833-210749855 TTCCTTTCACTCCACTGCCAGGG + Intergenic
946268267 2:218567998-218568020 TACCTTTGGGTGCACTGCCCCGG - Intronic
946411079 2:219515460-219515482 TCCCTCTGGCTTCCCAGCCATGG + Intronic
1169040018 20:2485753-2485775 TCCCTTTGGTTGCTCTGACAAGG + Intronic
1169973580 20:11298094-11298116 TACCTTTAGCTACACTGACAAGG + Intergenic
1170235058 20:14094064-14094086 TCCCTTTGGCTGCAGTGTGAAGG + Intronic
1171112928 20:22500831-22500853 TCCATTTGCCTCCTGTGCCATGG + Intergenic
1172097498 20:32467536-32467558 TCCCTTGGTCCCCTCTGCCATGG - Intronic
1174220568 20:48951358-48951380 TCCCAGGGGCTCCACTGTCAGGG - Exonic
1174719171 20:52792703-52792725 TCCCTCTGTTTCCACTGCCAAGG - Intergenic
1175732607 20:61364288-61364310 TCCCAATGGCTCCACCCCCACGG - Intronic
1176031263 20:63013926-63013948 GGCCTTTTGCACCACTGCCAGGG - Intergenic
1176143289 20:63554306-63554328 TCCCCTTGGCTCCCCTGGCCCGG - Exonic
1176871342 21:14085031-14085053 CCCCATTGGCTCCTCAGCCAAGG + Intergenic
1177559200 21:22728914-22728936 TCCCTGGGGCTCAACTGCCCAGG - Intergenic
1178064503 21:28889094-28889116 TCCCTTTGGCCCCATTGTAATGG + Intergenic
1178304548 21:31480606-31480628 TCCATTTGCAGCCACTGCCAAGG - Intronic
1178959056 21:37047427-37047449 GCCCTTTGTCTTCACTACCAGGG - Intergenic
1179174426 21:38997300-38997322 TCCCTTTTGCTCCAGTTGCAAGG + Intergenic
1179423551 21:41254935-41254957 TCTCTTGGGATCCACTGCAATGG - Intronic
1179605774 21:42514258-42514280 TCCCTCTGCCTCCACTTCCCCGG - Exonic
1179995043 21:44970378-44970400 TCCCTTTGGCCCCATTGACGTGG + Intronic
1183124158 22:35759427-35759449 CCCCTTTGGTTTCACTGCCTGGG - Intronic
1184384708 22:44167496-44167518 CCCCTCTGACTCCACTCCCATGG - Intronic
952744984 3:36768653-36768675 TCCCTTTGGCCCCATTGTAATGG + Intergenic
952771265 3:37003202-37003224 TCCACTTGGCTCCACTGCTGGGG + Intronic
953282917 3:41575952-41575974 TCCCTTTGGCTCCACTGCCAGGG - Intronic
953462742 3:43094659-43094681 TCCCTTTGTCGCCAGTGCCCTGG - Intronic
953955362 3:47227745-47227767 TCCCTTTGGTGCCACCACCAAGG + Intergenic
954862832 3:53704563-53704585 TCACGTTGGCTCAACTGCCAAGG - Intronic
955920336 3:63948168-63948190 TCCACTTCTCTCCACTGCCATGG - Intronic
956986106 3:74702445-74702467 TCCCTTAGGCTGCAGTGCAATGG - Intergenic
959974707 3:112445673-112445695 TCTCTTTGGCCCCACAACCAGGG + Intergenic
960133857 3:114086401-114086423 TCTGATTGGCTGCACTGCCAGGG - Exonic
964219886 3:154331112-154331134 TGACTTTGGCTCTACTCCCACGG - Intergenic
965645004 3:170870791-170870813 TCCCTATGCCTACGCTGCCAAGG - Intergenic
965931662 3:174051216-174051238 TCCCCTTGTCTCCAATTCCAGGG + Intronic
966416878 3:179698223-179698245 TCCCTTTGGCTGCAAGACCATGG - Intronic
967057334 3:185841065-185841087 TCCCTGTGGCTCTAGTGGCAGGG - Intergenic
967425762 3:189325370-189325392 TCCATTTGGCTTCACTGAAAAGG - Intergenic
969076098 4:4578929-4578951 TCTCTTTGTGCCCACTGCCAGGG - Intergenic
973339439 4:48988327-48988349 TCCAGTTGTCTCCACTGACATGG - Intronic
979954913 4:126940532-126940554 TCCATTTTGCTACACTGCCATGG + Intergenic
980902569 4:138918891-138918913 TCTCTTGGGCTTCACTGCCAGGG - Intergenic
981119211 4:141029647-141029669 TCCCTTTGGCTGCTCTGCTGAGG - Intronic
981159710 4:141483467-141483489 TTGCTTTGGATCCACTGCAAGGG + Intergenic
981446541 4:144845777-144845799 TCCCTTTGGCCCCATTGTAACGG - Intergenic
982108038 4:152028453-152028475 ACCCTTTGGCTCCACTGGATTGG - Intergenic
985110620 4:186543308-186543330 TCCCATTGGCTTCAATCCCAGGG - Intronic
987739111 5:21882745-21882767 TCCCTTTGGCTCCATTGTAACGG - Intronic
994804345 5:104424599-104424621 CCCATTTGGCTGCATTGCCAGGG - Intergenic
995251315 5:109996388-109996410 TGCCTTTGGCTTTACTTCCAAGG - Intergenic
995469696 5:112488032-112488054 TCCCTCTGGCTCCAAAGCCTGGG + Intergenic
997223753 5:132193365-132193387 GCCCTTTGGCTCTATTCCCATGG + Intronic
997614473 5:135237079-135237101 GCCCTTTGGGCCCGCTGCCATGG + Intronic
998604603 5:143621058-143621080 TCCCCTTGGCTCCCTTGACAGGG + Intergenic
1000920081 5:167127962-167127984 ACCCTGTGGCCCCACTGCCCAGG + Intergenic
1001679235 5:173544193-173544215 TCCCTTTGCCTCCCCTCCCCTGG + Intergenic
1002110194 5:176903801-176903823 GCACTGTGGTTCCACTGCCATGG + Intergenic
1002571014 5:180139423-180139445 TCCCTCTGTCTCTACTCCCAGGG - Intronic
1003926107 6:10879369-10879391 TCTCTGTGGCTTCATTGCCAGGG - Intronic
1005958776 6:30682349-30682371 TCCCCTGGGCTCCAGTGGCAGGG + Intronic
1006189457 6:32198712-32198734 TGCCTTTGGCTTCAGTGCCCTGG + Exonic
1006804046 6:36777150-36777172 TTTCCTTGGCTCCACTGCCAGGG + Intronic
1007209272 6:40178778-40178800 TCCCTTTTCCTCCACTGCCTTGG + Intergenic
1010366309 6:75055725-75055747 GTCCTTTGACTTCACTGCCAAGG - Intergenic
1013052160 6:106546897-106546919 TCCTTTTGCTTCCTCTGCCAGGG - Intronic
1015565411 6:134564990-134565012 TTCCTTTGCCTCCAAAGCCATGG + Intergenic
1017521691 6:155208427-155208449 CCCCCTTGGCTTCACTGCTATGG + Intronic
1017670663 6:156766677-156766699 TCCCTTTGGCTGCAATGACAAGG - Intergenic
1022335400 7:29417099-29417121 TCCTTCTGGCTCCCCTGCCAGGG + Intronic
1023914833 7:44581314-44581336 TGCCTTCTGCTCCACAGCCAGGG - Intronic
1024194839 7:47048726-47048748 TCCCTTTGGCTTCCTGGCCAGGG + Intergenic
1026827586 7:73594038-73594060 TCCCTTTGGTTCCACATCCAAGG - Intronic
1027126362 7:75559461-75559483 TCCCTTAGTATCCACTGCCCAGG + Intronic
1028484191 7:91340414-91340436 TCCCTTAGGCCTCACTGCTAAGG + Intergenic
1030738528 7:113080408-113080430 TCCATTTGCCTCAACTTCCATGG - Exonic
1032460501 7:132106630-132106652 TCCCTTCGTCTCCACCACCAAGG - Intergenic
1032732931 7:134661947-134661969 TGCCCTTGGATCAACTGCCACGG + Exonic
1035688070 8:1540069-1540091 TGCCTGTGGCGGCACTGCCAGGG - Intronic
1036283240 8:7418998-7419020 TCCCTTTGGCCCCATTGTAATGG - Intergenic
1036338231 8:7892523-7892545 TCCCTTTGGCCCCATTGTAATGG + Intergenic
1038459726 8:27705497-27705519 TCCCTCTGGCTTCACAGCCAAGG - Intergenic
1039079681 8:33722511-33722533 GCCCTTGGGCACCCCTGCCAGGG - Intergenic
1039261919 8:35781142-35781164 TCCCTCTGGCTTCACTGCAAGGG - Intronic
1039490364 8:37942980-37943002 TCCCCTTGGCTCTACTGTCCTGG + Intergenic
1039557079 8:38484315-38484337 TCCCCTCGGCGTCACTGCCAGGG + Intergenic
1045381495 8:101631849-101631871 TCACCCTGTCTCCACTGCCAGGG - Intronic
1046675803 8:117106863-117106885 TCCCTTTGGCATCACTGCAGAGG - Intronic
1048829296 8:138460427-138460449 TCCCTTTATCTTCACTTCCAGGG - Intronic
1050299765 9:4245618-4245640 TCCCTTAGACTCCAATGGCACGG + Intronic
1060210923 9:121709877-121709899 TCTCTTTGTATCCACAGCCAGGG + Intronic
1060243576 9:121925639-121925661 TCCCTTAGGTTCCCATGCCAAGG + Intronic
1060455617 9:123792723-123792745 CCCCCTTGGATCCCCTGCCAGGG - Intronic
1060631279 9:125161373-125161395 ACCCTCAGGCTCCACAGCCATGG + Intronic
1060719201 9:125963624-125963646 TACCTTTCCCTCCACTGACATGG + Intronic
1060819775 9:126654649-126654671 TCCCAGTGACTCCACTGCCGAGG + Intronic
1060896301 9:127219782-127219804 CTCCTTTGCCTGCACTGCCAGGG + Exonic
1060913548 9:127369988-127370010 CACCTTGGGCACCACTGCCACGG - Intronic
1060999842 9:127896896-127896918 TCCCTGTGCCTCCACAGCCACGG + Intronic
1185974528 X:4704684-4704706 TCCCTTTTTCTTTACTGCCAAGG - Intergenic
1189576765 X:42362121-42362143 TCGCTTTGGCACCACTATCAAGG - Intergenic
1192144532 X:68672723-68672745 GCCCCTTGGCTGCCCTGCCATGG - Intronic
1192572068 X:72214166-72214188 TCCTTTTGGCTTCACTTTCAGGG + Intronic
1195277458 X:103296170-103296192 TCCCTGTGGCTCCCCCGCCTTGG + Intergenic
1197691133 X:129502252-129502274 TCCCTGGGGATCCACTCCCATGG - Intronic
1198133899 X:133727599-133727621 TCCTTTTGACTCCTTTGCCATGG + Intronic
1198375503 X:136034854-136034876 TACTTTTGGCTCCATTGTCAGGG + Intronic