ID: 953285157

View in Genome Browser
Species Human (GRCh38)
Location 3:41599411-41599433
Sequence CTAAGATACTCACAGGTTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 631
Summary {0: 1, 1: 0, 2: 8, 3: 79, 4: 543}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953285151_953285157 -7 Left 953285151 3:41599395-41599417 CCCCTTGCCATGTAACCTAAGAT 0: 1
1: 3
2: 37
3: 162
4: 655
Right 953285157 3:41599411-41599433 CTAAGATACTCACAGGTTTCAGG 0: 1
1: 0
2: 8
3: 79
4: 543
953285149_953285157 20 Left 953285149 3:41599368-41599390 CCTTAATTCTATCTGGAACATTA 0: 1
1: 0
2: 17
3: 130
4: 487
Right 953285157 3:41599411-41599433 CTAAGATACTCACAGGTTTCAGG 0: 1
1: 0
2: 8
3: 79
4: 543
953285147_953285157 29 Left 953285147 3:41599359-41599381 CCTGATCAACCTTAATTCTATCT 0: 1
1: 0
2: 0
3: 6
4: 140
Right 953285157 3:41599411-41599433 CTAAGATACTCACAGGTTTCAGG 0: 1
1: 0
2: 8
3: 79
4: 543
953285150_953285157 -6 Left 953285150 3:41599394-41599416 CCCCCTTGCCATGTAACCTAAGA 0: 1
1: 1
2: 28
3: 101
4: 386
Right 953285157 3:41599411-41599433 CTAAGATACTCACAGGTTTCAGG 0: 1
1: 0
2: 8
3: 79
4: 543
953285152_953285157 -8 Left 953285152 3:41599396-41599418 CCCTTGCCATGTAACCTAAGATA 0: 1
1: 22
2: 85
3: 291
4: 620
Right 953285157 3:41599411-41599433 CTAAGATACTCACAGGTTTCAGG 0: 1
1: 0
2: 8
3: 79
4: 543
953285153_953285157 -9 Left 953285153 3:41599397-41599419 CCTTGCCATGTAACCTAAGATAC 0: 1
1: 0
2: 7
3: 42
4: 156
Right 953285157 3:41599411-41599433 CTAAGATACTCACAGGTTTCAGG 0: 1
1: 0
2: 8
3: 79
4: 543

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953285157 Original CRISPR CTAAGATACTCACAGGTTTC AGG Intronic
900011735 1:117655-117677 GTAACATATTCACAGGTTCCAGG - Intergenic
900027840 1:294221-294243 GTAACATATTCACAGGTTCCAGG - Intergenic
900041794 1:473662-473684 GTAACATATTCACAGGTTCCAGG - Intergenic
900063231 1:708640-708662 GTAACATATTCACAGGTTCCAGG - Intergenic
900749955 1:4389306-4389328 CTCAGATGCTCAGAAGTTTCAGG - Intergenic
901152198 1:7111282-7111304 CTAACATAGCCACAGGTTTCGGG + Intronic
903316984 1:22515746-22515768 GTAACATACACACAGGTTTGAGG + Intronic
903489836 1:23719941-23719963 ATAACATATTCACAGGTTCCTGG + Intergenic
903677844 1:25075854-25075876 CTAAGATAGTCATAGGTTCTGGG - Intergenic
903678508 1:25081889-25081911 GTAATGTATTCACAGGTTTCGGG - Intergenic
903701318 1:25250547-25250569 GTAACATATTCACAGGTTCCAGG - Intronic
905048087 1:35024528-35024550 CAAGGATACTTACAGGTTTTGGG - Intronic
905392024 1:37642340-37642362 GTAACATATTCACAGGTTTGGGG + Intergenic
906182210 1:43831706-43831728 TTGAGATACTCCCAGGTCTCAGG - Intronic
906252302 1:44319933-44319955 CTAATATCCTCATAGGTTCCAGG + Intronic
907653022 1:56314034-56314056 GTAACATATTCACAGTTTTCTGG - Intergenic
907762632 1:57376612-57376634 CTAAGATGTTCACAGGTAGCTGG - Intronic
907785888 1:57612319-57612341 GTAACATAATCACAGGTTTTGGG - Intronic
908124503 1:61016782-61016804 GTAACATACTCACAGGTTCCAGG + Intronic
909538282 1:76762719-76762741 CAAACATACTCAGATGTTTCTGG - Intergenic
910205135 1:84742335-84742357 CTAACATAATCACCGGTTCCAGG - Intergenic
910205248 1:84743092-84743114 CTAACATAATCACAGATTTCAGG - Intergenic
910961586 1:92769527-92769549 ATAACATAGTCACAGGTTCCAGG - Intronic
911008632 1:93254746-93254768 CAAAGAAACTAACAGGTTTCTGG - Intronic
911377564 1:97069704-97069726 TTAATATATTCACAGGTTTCAGG + Intergenic
911701034 1:100951826-100951848 GTAATATATTCACAGGTTTCAGG - Intronic
914229841 1:145755643-145755665 CAAAGATACTCTCAAGTTTTGGG - Intronic
915611246 1:156994992-156995014 CAAAGATAATCTCAGATTTCTGG - Intronic
915788945 1:158646936-158646958 GTAAGATATTCACAGTTCTCTGG + Intronic
916744325 1:167672732-167672754 CTAACATATTCACAGGTTCCAGG + Intronic
918370531 1:183856982-183857004 CTAACATATTCCCAGGTTTCAGG - Intronic
919039528 1:192365229-192365251 CTAAGATCCTCACATATTCCAGG - Intronic
919112577 1:193239259-193239281 ATAATATACTCCCAAGTTTCTGG - Intronic
920137633 1:203782708-203782730 GTAACACAGTCACAGGTTTCAGG + Intergenic
920818584 1:209358626-209358648 CTCACATATTCACAGGTTTTAGG + Intergenic
921339165 1:214117327-214117349 CTCACACACTCACAGGCTTCTGG - Intergenic
921493426 1:215807028-215807050 ATAACATAGTCACAGGTTCCAGG - Intronic
921975065 1:221193067-221193089 CTAAGATACTTTCATGTTTCAGG + Intergenic
922260170 1:223933665-223933687 GTAACATATTCACAGGTTCCAGG - Intergenic
923008694 1:230071617-230071639 CCAAGATGCTCACAGATTTTTGG - Intronic
924327688 1:242912071-242912093 ATAACATACTCACAAGTTCCAGG + Intergenic
924341338 1:243036220-243036242 GTAACATATTCACAGGTTCCAGG - Intergenic
924593930 1:245428902-245428924 GTAAGATACTCTCAGGGTTAAGG + Intronic
1063960908 10:11304833-11304855 CTAACATATTTACAGGTTCCAGG + Intronic
1064561118 10:16596202-16596224 GTAACATACTCCCAGGTTTCAGG - Intronic
1064618258 10:17186261-17186283 GTAACATTTTCACAGGTTTCAGG - Intronic
1065037387 10:21653644-21653666 ATAACATATTCACAGGTTTCAGG + Intronic
1066031785 10:31435005-31435027 GTAACATATTCACAGGTTTTAGG - Intronic
1066191561 10:33060843-33060865 GTAACATATTCACAGGTTCCGGG - Intergenic
1066735133 10:38469210-38469232 GTAACATATTCACAGGTTCCAGG + Intergenic
1067235691 10:44447095-44447117 ATAAGATACTTACAGATTTTGGG + Intergenic
1067264092 10:44722086-44722108 ATAACATATACACAGGTTTCAGG + Intergenic
1067688809 10:48487313-48487335 CTAACCTAATCACAGGTTCCAGG - Intronic
1067829948 10:49605828-49605850 CCACCACACTCACAGGTTTCTGG + Intergenic
1067969724 10:50955692-50955714 TTAAGATACTCAGAGATATCAGG - Intergenic
1068485664 10:57655320-57655342 GTAATATAGTCACAGGTTTTAGG - Intergenic
1069492183 10:68870501-68870523 GTAACATATTCACAGGTTCCAGG - Intronic
1070633274 10:78103805-78103827 GTAACATATCCACAGGTTTCTGG - Intergenic
1070678030 10:78427620-78427642 CTTAGATAATCACAGGATTGGGG + Intergenic
1070708283 10:78657502-78657524 GTAACAAACTCACAAGTTTCAGG + Intergenic
1071370740 10:84949022-84949044 GTAACATACTCACAGATTCCTGG + Intergenic
1071668732 10:87587182-87587204 CTAAAGTATTCACAGCTTTCAGG - Intergenic
1072044116 10:91637643-91637665 CTGAGATACCTACATGTTTCAGG - Intergenic
1072294820 10:93998783-93998805 GTAACATATTCACAGGTTCCAGG - Intronic
1073298472 10:102455884-102455906 ATAACATATTCGCAGGTTTCCGG - Intergenic
1074513670 10:114143274-114143296 CTAGTATTCTAACAGGTTTCAGG + Intronic
1074709787 10:116167707-116167729 CTTAGATACTCTCAAGTTGCAGG + Intronic
1074851839 10:117445323-117445345 GTAATATATTCACAGGTTCCGGG + Intergenic
1075245455 10:120818293-120818315 GTAACATATTCACAGGTTCCAGG - Intergenic
1075280670 10:121135627-121135649 GTAAGATATTCACAGGCTCCAGG + Intergenic
1075283131 10:121158423-121158445 CTAACATATTCACAGGTTGTGGG + Intergenic
1075576203 10:123579451-123579473 GTAACATATTCACAGGTTTCTGG + Intergenic
1075682961 10:124345505-124345527 GTAAGGTATTCACAGGTTCCGGG + Intergenic
1076709402 10:132323565-132323587 CTAACATAGACACAGGTTTTGGG - Intronic
1076968068 11:109891-109913 GTAACATATTCACAGGTTCCAGG - Intergenic
1077628535 11:3794922-3794944 CTAAGAAACTCAGAGATTTAAGG - Intronic
1078453885 11:11460200-11460222 GTAACATATTCACAGGTTCCAGG + Intronic
1078508845 11:11970524-11970546 ATAACATACCCACAGGTTCCGGG - Intronic
1079509234 11:21191120-21191142 CTAATATATTAACAGGTTTTAGG - Intronic
1079528925 11:21425370-21425392 GTAATATAGTCACAGGTTTGAGG - Intronic
1080791026 11:35522771-35522793 CTATGATACACAGAGGTTTAAGG - Intronic
1080799232 11:35594097-35594119 ATAACATATTCACAGGTTCCAGG + Intergenic
1081244147 11:40743576-40743598 CTAACATATTCACAGGTTCTGGG + Intronic
1082023765 11:47556298-47556320 CTCAGCTACTCACAAGGTTCTGG - Intronic
1082077775 11:47987660-47987682 CTAAGATATTCACCACTTTCAGG - Intronic
1083373248 11:62198683-62198705 CCATGATACTCACAGGACTCCGG + Intergenic
1083838122 11:65285983-65286005 GTAAAATATTCACAGGTTCCAGG - Intronic
1084905965 11:72347721-72347743 CTAACATATTCACAGGTTCCAGG - Intronic
1085145030 11:74187791-74187813 ATAACATATTCACAGGTTCCAGG - Intronic
1086021411 11:82234655-82234677 CTAACATTTTCACAGGTTCCAGG + Intergenic
1086191738 11:84087526-84087548 GTAACATATTCACAGGTTCCAGG - Intronic
1086594463 11:88554392-88554414 ATAACATAGTCACAGGTTCCAGG + Intronic
1087488543 11:98791223-98791245 CAAACATACTCATAGATTTCTGG - Intergenic
1087710082 11:101538518-101538540 GTAACATACTTACAGGTTCCAGG - Intronic
1088147714 11:106702841-106702863 CTAACATATTCACATTTTTCAGG - Intronic
1088332651 11:108669645-108669667 CTAACATATTCACAGGTTCCAGG - Intronic
1088572538 11:111237026-111237048 CTAACATATTTACAGGTTCCAGG + Intergenic
1089941678 11:122424467-122424489 ATAAGATACTCAGTGGATTCAGG + Intergenic
1093211699 12:16316088-16316110 CTAATATGTTCACAGGTTTTGGG - Intergenic
1093485826 12:19651321-19651343 GTAACGTATTCACAGGTTTCTGG - Intronic
1094043356 12:26141059-26141081 GTAATATATTCACAGGTTCCAGG - Intronic
1095786836 12:46119266-46119288 CTGATATAATCACAGGTTTTAGG + Intergenic
1097823340 12:64149645-64149667 CTAAGATTCTTACAGGGTGCAGG - Exonic
1097848175 12:64387220-64387242 GTAACATATTCACAGGTTCCAGG + Intronic
1098030637 12:66249908-66249930 GTAACATATTCACAGGTTTCTGG + Exonic
1098144033 12:67480423-67480445 GTAATGTATTCACAGGTTTCAGG + Intergenic
1098320356 12:69237833-69237855 GTAACATATTCACAGATTTCAGG + Intergenic
1098549085 12:71743085-71743107 TTAACATATTCACAGGTTCCAGG + Intergenic
1098611110 12:72459333-72459355 CTAATATAGTCACAGGTTCCAGG + Intronic
1098675106 12:73280039-73280061 ATAATATAGTCACAGGATTCAGG + Intergenic
1098911575 12:76214525-76214547 CAAACATATTTACAGGTTTCAGG + Intergenic
1099957068 12:89361184-89361206 GTAACATATTCACAGGTTCCAGG + Intergenic
1101316111 12:103630483-103630505 CTAACATATTCATAGGTTCCAGG - Intronic
1102359549 12:112272605-112272627 CTAAGCTACTCACACAATTCTGG - Intronic
1102386779 12:112516681-112516703 GTAACATATTCACAGGTTCCAGG + Intergenic
1102495472 12:113316280-113316302 GTAACATACTCCCAGGTTCCAGG + Intronic
1102762783 12:115403451-115403473 ATAACACAGTCACAGGTTTCGGG + Intergenic
1102814230 12:115850102-115850124 CTAATATAGTCACAGATTACAGG + Intergenic
1102852531 12:116262427-116262449 CTAAATTTCTCACAGCTTTCTGG + Intronic
1103027692 12:117587182-117587204 ATAACATACTCCCAGGTTCCAGG - Intronic
1103137827 12:118523041-118523063 GTAACATATTCACAGGTTTAAGG - Intergenic
1104166869 12:126240101-126240123 CTAACATACTCACAGGTTCTGGG + Intergenic
1104354720 12:128075347-128075369 TTAACATACTCACAGGTTTCAGG - Intergenic
1106043168 13:26113176-26113198 CAAAGATATTCTCAGGTGTCAGG + Intergenic
1106122194 13:26869770-26869792 CTAACATACTCACAGGTTCTGGG + Intergenic
1106563850 13:30869024-30869046 CTAGGATGATCCCAGGTTTCTGG + Intergenic
1106764515 13:32900458-32900480 CTAACATATTCACAGGTTCTGGG + Intergenic
1107240498 13:38228516-38228538 CCTAGATAATCACAGGTTGCAGG + Intergenic
1107827065 13:44338199-44338221 ATAACATATTCACAGGTTCCAGG - Intergenic
1109823486 13:67687747-67687769 GTAACATATTCACAGGTTTAGGG + Intergenic
1109973446 13:69800315-69800337 ATAACATATTCACAGGTTCCAGG + Intronic
1110802914 13:79721197-79721219 ATAATATAATCACAGATTTCGGG - Intergenic
1111139210 13:84092020-84092042 CTAATATATTCACAGGTGTTTGG - Intergenic
1111948715 13:94692577-94692599 GTAACATATTCACAAGTTTCAGG - Intergenic
1112191388 13:97181279-97181301 ATAATATATTCACAGGTTCCTGG + Intergenic
1112809215 13:103198222-103198244 CTAACACATTCACAGGTTCCAGG + Intergenic
1114673207 14:24424484-24424506 ATAACATATTCACAGGTTCCAGG - Intergenic
1114713050 14:24797661-24797683 GTAACATATTCACAGGTTCCAGG + Intergenic
1115836682 14:37413616-37413638 CTAACATATTCACAGGTTCTGGG + Intronic
1115886905 14:37982185-37982207 CTAAAATATTCACAGGTCCCAGG - Intronic
1116655898 14:47653595-47653617 CTAACATATTCACAGTTTCCGGG - Intronic
1117291771 14:54341511-54341533 GTAATATAGTCACAGGTTACAGG - Intergenic
1117814127 14:59579955-59579977 CTAATATATTCACAAGTCTCAGG - Intergenic
1117838829 14:59836202-59836224 GTAACATATTCACAGGTTCCAGG + Intronic
1118009257 14:61592603-61592625 GTAACATATTCACAGGTTTTGGG + Intronic
1118193297 14:63600784-63600806 CTAACATATTCACAGATTCCAGG - Intronic
1118255843 14:64205168-64205190 CTAACATATTCACAGATTCCAGG + Intronic
1118270902 14:64341192-64341214 CTAATATACTCATAGGTTCCAGG - Intergenic
1118427403 14:65681313-65681335 CTATGTTATTCAAAGGTTTCTGG + Intronic
1118481466 14:66171328-66171350 GTAACATGTTCACAGGTTTCTGG + Intergenic
1118576317 14:67244809-67244831 CAAACATATTCACAGGTTCCAGG - Intronic
1119867728 14:77988073-77988095 GTAACATATTCACAGGTTCCAGG - Intergenic
1120224455 14:81774911-81774933 CTAAGACTCTCAGAGGTTTCAGG - Intergenic
1120227476 14:81807667-81807689 GTAACATATTCACAGGCTTCAGG + Intergenic
1120471339 14:84928789-84928811 GGAACATAGTCACAGGTTTCAGG + Intergenic
1120503554 14:85326260-85326282 GTAACATATTCACAGGTTTCAGG - Intergenic
1121275322 14:92663529-92663551 ATAAGAAACCCACTGGTTTCTGG - Intronic
1121846825 14:97179531-97179553 GTAACATAGTCACAGGTTTGAGG + Intergenic
1124123166 15:26909810-26909832 GTAGCATACTCACAGGTTTGGGG + Intronic
1124694760 15:31854732-31854754 GTAACATATTCACAGGTTTGGGG + Intronic
1124826406 15:33100354-33100376 CAAATACACTCAAAGGTTTCTGG + Intronic
1125425291 15:39542717-39542739 CTAACATATTCATAGATTTCAGG + Intergenic
1125445771 15:39754328-39754350 CTAAGATACTCCCAGATTCCTGG + Intronic
1126886881 15:53160189-53160211 CTAAGAAACTCAGAAATTTCAGG - Intergenic
1126974745 15:54163061-54163083 GTAACATATTCACAGGTTCCAGG - Intronic
1127929234 15:63580600-63580622 TTAAGATTCTCAAAGATTTCAGG - Intronic
1127989945 15:64106529-64106551 CTAACATACTCACTGGTTGCAGG - Intronic
1128041646 15:64579956-64579978 GTAACATATTCACAGGTTCCAGG - Intronic
1129072248 15:72961238-72961260 TTAATATATTCACAGGTTCCAGG + Intergenic
1129223308 15:74148126-74148148 CTAACATATTCTCAGGTTTGGGG + Intergenic
1130219431 15:82006674-82006696 GTAATATATTCACAGGTTTAGGG - Intergenic
1130337406 15:82968445-82968467 CTAAAACATTCACAGGTTTAAGG + Intronic
1130680336 15:85990862-85990884 GAAAGATATTCAAAGGTTTCAGG + Intergenic
1131688187 15:94793869-94793891 CTCAGAAACCCACTGGTTTCCGG + Intergenic
1131707281 15:95011519-95011541 CTAACATATTCACTGGTTCCAGG - Intergenic
1132319271 15:100913647-100913669 CCAACATATTCACAGGTTTGGGG + Intronic
1133431608 16:5742001-5742023 CTAAAATTCTCCCAGGTCTCAGG - Intergenic
1133498394 16:6342001-6342023 ATAAAATACTTACAGGTTCCAGG + Intronic
1133843039 16:9427839-9427861 GTCATATATTCACAGGTTTCAGG - Intergenic
1133904822 16:10012582-10012604 GTAACATATTCACAGGTTCCAGG - Intronic
1133912248 16:10076877-10076899 GTAACATGCTCACAGGTTCCAGG - Intronic
1134760634 16:16711360-16711382 CTAACATATTCATAGGTTCCAGG + Intergenic
1134788785 16:16969644-16969666 GTAATATATTCACAGGTTGCAGG - Intergenic
1134985425 16:18647813-18647835 CTAACATATTCATAGGTTCCAGG - Intergenic
1135198388 16:20414209-20414231 ATAACATACTCACAGGTTTCAGG - Intronic
1135408266 16:22213952-22213974 GTAACATATTCACAGGTTCCAGG + Intronic
1136530765 16:30867398-30867420 CTAAGACATTCACATGTTCCAGG - Intronic
1137735004 16:50717240-50717262 CTAAGAGTGTCACAGCTTTCTGG + Intronic
1139301267 16:65947335-65947357 CCAAGATAATCTCAGTTTTCAGG - Intergenic
1140772424 16:78217099-78217121 CTACCATATTCACGGGTTTCAGG + Intronic
1140986869 16:80166194-80166216 GTAACACACTCACAGGTTCCAGG - Intergenic
1141097245 16:81171584-81171606 GTAACATATTCACAGGTTTCAGG - Intergenic
1141244604 16:82294204-82294226 GTAACATACTCACTGGTTCCAGG - Intergenic
1141277010 16:82597474-82597496 ATAACATATTCACAGGTTTTGGG - Intergenic
1141921679 16:87139700-87139722 GTAACATAGTCACAGGTTCCAGG - Intronic
1142327116 16:89422796-89422818 CTAAGAGAATCACAAGTTTCAGG + Intronic
1142334963 16:89482512-89482534 CTAAGGCATTCACAGGTTCCAGG - Intronic
1142452613 16:90189254-90189276 GTAACATATTCACAGGTTCCAGG + Intergenic
1143997677 17:11021884-11021906 CTAACATGCTAACAGGATTCTGG + Intergenic
1144316517 17:14067551-14067573 ATAACACCCTCACAGGTTTCAGG + Intergenic
1145889602 17:28405572-28405594 CTAAGATTCTCTGAGGTTTAGGG - Intronic
1145984048 17:29032472-29032494 CTAAGCTTGTCGCAGGTTTCAGG - Intronic
1146110583 17:30085422-30085444 CTGACATACTCACAGATTCCAGG - Intronic
1146963482 17:37004806-37004828 CTAAAAGACCCACAGGTTACTGG + Intronic
1147544703 17:41392274-41392296 CTAACATATTCCCAGGTTCCAGG + Intronic
1149186325 17:54001937-54001959 GTAATATCCTCACAGATTTCAGG + Intergenic
1151005827 17:70435026-70435048 GTAGTATACTCACAGGTTTCAGG + Intergenic
1151378185 17:73706016-73706038 CAATGATGCTCACAGGTTTGGGG + Intergenic
1152323681 17:79623376-79623398 CTAAGATAGTCACAGGTTCCAGG - Intergenic
1152425748 17:80217725-80217747 CTAACATACCCACTGGTATCAGG - Intronic
1153232675 18:2954948-2954970 TTCAGATACACACAAGTTTCAGG + Intronic
1153940509 18:9972746-9972768 CTAACGTATTCACAGGTTCCGGG - Intergenic
1154335090 18:13458612-13458634 GTAACATATTCACAGGTTCCAGG - Intronic
1155364835 18:25039494-25039516 TTAACATATTCACAGGTTCCAGG + Intergenic
1156256228 18:35399372-35399394 ATAACATAGTCACAGGTTTCAGG - Intergenic
1157101992 18:44739256-44739278 CTAATATATTCACAGGTTCCAGG + Intronic
1157651986 18:49342420-49342442 TTATGTTACTCACAGGTTCCAGG + Intronic
1157900781 18:51514686-51514708 TTAACATATTCACAGGTTCCGGG - Intergenic
1158870790 18:61685707-61685729 GCAATATACTCAAAGGTTTCGGG + Intergenic
1159404479 18:67982400-67982422 CCAATATACTTACAAGTTTCTGG - Intergenic
1159618325 18:70608259-70608281 GTAACATATTCACAGGTTTCAGG - Intergenic
1160644876 19:179504-179526 GTAACATATTCACAGGTTCCAGG - Intergenic
1161874088 19:6894172-6894194 ATAACATATTCACAGGTTCCAGG + Intronic
1162356480 19:10188580-10188602 GTAATATATTCACAGGTTCCAGG - Intronic
1165162129 19:33822821-33822843 CTAAGATACTCACAGATCCCAGG + Intergenic
1166636826 19:44458203-44458225 CCCAGAAACTCACAGGTCTCGGG - Intergenic
1167215126 19:48159496-48159518 CTAACATATTCCCAGGTTCCAGG - Intronic
1167717361 19:51152373-51152395 GTAACAGATTCACAGGTTTCAGG + Intronic
1202648898 1_KI270706v1_random:163224-163246 CCCAGAGACTCACAGGTCTCAGG - Intergenic
1202649362 1_KI270706v1_random:166365-166387 CCCAGAGACTCACAGGTCTCGGG + Intergenic
925435438 2:3833295-3833317 CTAACATAGTCACAGGTTCTGGG + Intronic
926190839 2:10726460-10726482 GTCAGAGGCTCACAGGTTTCTGG - Intronic
926574398 2:14564216-14564238 ATAACATATTCACAGGTTCCGGG - Intergenic
926845074 2:17127820-17127842 GTAATACATTCACAGGTTTCAGG - Intergenic
927818187 2:26239372-26239394 CTAACATATTCACAGGTTCTGGG - Intronic
928772797 2:34721984-34722006 CTTTGTTCCTCACAGGTTTCTGG + Intergenic
930936145 2:56954376-56954398 ATAACATACTCACAGGTTCTAGG + Intergenic
931375590 2:61704902-61704924 GTAACATATTCACAGATTTCAGG + Intergenic
931451517 2:62370961-62370983 GTAACATATTCACAGGTTTGGGG - Intergenic
931708337 2:64966524-64966546 CTAACATAGTCACAGGTTCTTGG + Intergenic
931807527 2:65822168-65822190 ATAACATATTCACAGGTTCCAGG - Intergenic
932131616 2:69192623-69192645 GTAACATATTCACAGGTTCCCGG + Intronic
932440130 2:71729546-71729568 CTGATAAACTCACAGGGTTCTGG + Intergenic
933101160 2:78259480-78259502 GTAACATATTCACAGGTTTGAGG + Intergenic
933627046 2:84612833-84612855 CTAACATATCCACAGGTTTGGGG + Intronic
934508343 2:94915552-94915574 GTAACATATTCACAGGTTTCAGG - Intergenic
935291968 2:101618630-101618652 TCAAGATACTCCTAGGTTTCTGG + Intergenic
935621829 2:105136677-105136699 GTAACATATTCACAGGTTCCCGG - Intergenic
935679647 2:105624865-105624887 GGAACATACTCACAGGTTTTGGG + Intergenic
935961290 2:108428152-108428174 GTAATATATTCACAGGTTCCAGG + Intergenic
936135334 2:109888202-109888224 GTAACATATTCACAGGTTTTGGG - Intergenic
936209363 2:110483283-110483305 GTAACATATTCACAGGTTTTGGG + Intergenic
936428549 2:112438522-112438544 GTAACATATTCACAGGTTTTGGG + Intergenic
936677219 2:114729383-114729405 CGAAGAGGCTCAGAGGTTTCAGG - Intronic
937426749 2:121806340-121806362 CTAACATACTCACAGGTTCCAGG - Intergenic
937431504 2:121842579-121842601 GTAACATATTCACAGGTTCCGGG - Intergenic
937570984 2:123361076-123361098 CTAGCATATTCACAGGTTCCAGG + Intergenic
937600112 2:123721375-123721397 GTAACATATTCACAGGTTTCTGG + Intergenic
937840335 2:126518695-126518717 TTATGAGACGCACAGGTTTCTGG - Intergenic
937981160 2:127616608-127616630 CTAAGATTCCCACCGGTATCTGG - Intronic
938541636 2:132288107-132288129 CCCAGAGACTCACAGGTCTCGGG - Intergenic
938801795 2:134770656-134770678 GTAACATATTCACAAGTTTCAGG + Intergenic
939096635 2:137839969-137839991 ATAAGATATTCACAGGTCCCAGG + Intergenic
939462457 2:142514296-142514318 GTAACATACTCACAGGTTCTGGG + Intergenic
939718424 2:145615587-145615609 GTAAGATATTTACAGGTTCCAGG - Intergenic
940073102 2:149711432-149711454 TGAAGATTCTCACAGGGTTCTGG - Intergenic
940868926 2:158843675-158843697 GTAACATAGTCACAGATTTCAGG + Intronic
941114077 2:161451559-161451581 GAAACATATTCACAGGTTTCAGG - Intronic
941314618 2:163976977-163976999 GTAATATATTCACAGGTTCCGGG - Intergenic
941341455 2:164310142-164310164 CTAAGATATTCACAAGTTCCAGG + Intergenic
941830264 2:169950289-169950311 CAAAGAGACACACAGGTTTAAGG - Intronic
941857876 2:170248839-170248861 CTAACATATTCACAGGTTCTGGG + Intronic
942279626 2:174347054-174347076 GTAACATATTCACAGGTTCCAGG - Intergenic
942542357 2:177027931-177027953 ATAATATATTCACAGGTTTAGGG - Intergenic
943187737 2:184634362-184634384 GTAATAAATTCACAGGTTTCAGG - Intronic
943197921 2:184779442-184779464 CTAACATATTCACAGGTTCTGGG - Intronic
943520416 2:188942855-188942877 CTAATATATTCACAGCTTCCAGG + Intergenic
943538728 2:189184765-189184787 GTAACATACTCACAGGTTCTAGG + Intergenic
943779796 2:191810553-191810575 GTAATATATTCACAGGTTCCAGG + Intergenic
943918253 2:193666288-193666310 CTAACATATTAACAGGTTTTGGG + Intergenic
943996177 2:194768940-194768962 CTAACATATTCACAGGTTCTGGG - Intergenic
944156141 2:196609648-196609670 ATAACATATTCACAGGTTTCAGG + Intergenic
944445864 2:199787515-199787537 CTAACATATTCACAGGTTCTCGG + Intronic
944763927 2:202845208-202845230 GTAACATATTCATAGGTTTCAGG + Intronic
945082615 2:206101209-206101231 GTAACATATTCACAGGTTTAGGG + Intergenic
945217144 2:207445701-207445723 GTAACATACTCACAGGTTCCAGG + Intergenic
945932324 2:215867263-215867285 ATAACATATTCACAGGTTCCAGG + Intergenic
946134660 2:217635970-217635992 CCAACATAGTCACAGGTTCCAGG + Intronic
946136050 2:217648026-217648048 CTAACATAATCACAGGTTCCAGG - Intronic
946470220 2:219952953-219952975 GTAACATATTCACAGGTTTTAGG + Intergenic
946543433 2:220711105-220711127 ATAACATATTCACAGGTTCCAGG - Intergenic
946895804 2:224322228-224322250 CTGATATATTCACAGGTTGCAGG - Intergenic
946906477 2:224421777-224421799 TGAAAATACTCACAGGTATCTGG + Intergenic
947258119 2:228189058-228189080 GTAACATATTCACAGGTTTTGGG + Intergenic
947591223 2:231387212-231387234 CTAACATAGTCCCAGGTTCCAGG + Intergenic
947810691 2:233002093-233002115 CTAAAATAGTCACAGGATTTGGG + Intronic
947954809 2:234179491-234179513 ATAACATATTCACAGGTTCCAGG + Intergenic
948351213 2:237342741-237342763 CTAAGAAACTCACGTGGTTCTGG + Intronic
949084052 2:242133911-242133933 GTAACATATTCACAGGTTCCAGG + Intergenic
1169416805 20:5424154-5424176 ATAACATACTCACAGGTTCCAGG + Intergenic
1169756211 20:9046041-9046063 ATAACATATTCACAGGTTCCAGG - Intergenic
1171869716 20:30515205-30515227 CCCAGAGACTCACAGGTCTCGGG - Intergenic
1171870503 20:30520983-30521005 CCCAGAGACTCACAGGTCTCGGG - Intergenic
1173327233 20:42045165-42045187 CTAACATATTCACAGGTTCCAGG + Intergenic
1173390709 20:42629976-42629998 GTAACATATTCACAGGTCTCAGG - Intronic
1173488054 20:43456151-43456173 GTAACATCTTCACAGGTTTCAGG + Intergenic
1175136004 20:56824690-56824712 CTAGAATACTCTCAGGTTTCTGG + Intergenic
1175244128 20:57571309-57571331 TTCATATACTCACAGGATTCTGG - Intergenic
1175615490 20:60394608-60394630 CTAATATACTCACAGGTTCCAGG + Intergenic
1176031222 20:63013360-63013382 TTAAGATACACAAAGGATTCAGG - Intergenic
1176280638 20:64306397-64306419 GTAACATATTCACAGGTTCCAGG + Intergenic
1176602459 21:8806181-8806203 CCCAGAGACTCACAGGTCTCGGG - Intergenic
1176602918 21:8809318-8809340 CCCAGAGACTCACAGGTCTCGGG + Intergenic
1176908180 21:14529901-14529923 CTAAAATAATCACAGATTTTGGG + Intronic
1177353380 21:19974787-19974809 GTAAGAAACTCAGTGGTTTCAGG - Intergenic
1177771055 21:25516279-25516301 ATAACATATTCACAGGTTGCAGG + Intergenic
1177802173 21:25838839-25838861 CTAACATAGTCACAGGTTCTGGG + Intergenic
1178002968 21:28183927-28183949 GTAACATATTCACCGGTTTCTGG + Intergenic
1178246871 21:30961425-30961447 CTGAGATACTCACAGGCCACAGG - Intergenic
1178637197 21:34314567-34314589 GTAACACACTCACAGGTTCCAGG - Intergenic
1179140047 21:38717381-38717403 CTAACATAGTCACAGATTCCGGG - Intergenic
1179240059 21:39581987-39582009 CTAACATAGTCACAGGTTCCAGG - Intronic
1179394143 21:41022695-41022717 GTAACATATTCACAGGTTCCAGG - Intergenic
1179461995 21:41542375-41542397 GGAACATACTCACAGGTTTTGGG - Intergenic
1180344744 22:11697734-11697756 CCCAGAGACTCACAGGTCTCGGG - Intergenic
1180345204 22:11700875-11700897 CCCAGAGACTCACAGGTCTCGGG + Intergenic
1180352567 22:11816728-11816750 CCCAGAGACTCACAGGTCTCGGG - Intergenic
1180352985 22:11819117-11819139 CCCAGAGACTCACAGGTTTCGGG + Intergenic
1180385259 22:12173240-12173262 CCCAGAGACTCACAGGTCTCGGG - Intergenic
1180385688 22:12175629-12175651 CCCAGAGACTCACAGGTCTCGGG + Intergenic
1182968175 22:34543709-34543731 CTAATATAGTAACAGGTTTTTGG + Intergenic
1184576893 22:45376547-45376569 CCAACATATTCACAGGTTTCTGG + Intronic
949438595 3:4056152-4056174 CTAACATATTCACAGGTTTCTGG + Intronic
950528471 3:13538851-13538873 CAAACACACACACAGGTTTCTGG - Intergenic
951051278 3:18096816-18096838 CTAACATATTCACGGGTTTCAGG + Intronic
951605756 3:24433224-24433246 ATAACATATTCACAGGTTCCAGG - Intronic
951840475 3:27028397-27028419 GTAACATGTTCACAGGTTTCAGG - Intergenic
951994138 3:28707992-28708014 CTAACATACTCACAGGTTCTGGG + Intergenic
952086590 3:29829339-29829361 CTAAGAAACTCACTTGTTGCTGG - Intronic
952127974 3:30324432-30324454 CTAAGATTCTCAGAGGTAGCAGG + Intergenic
952762673 3:36928812-36928834 TTAAAATACTAACATGTTTCTGG + Intronic
953064092 3:39453547-39453569 GTAACATACTCACAGGTTCCAGG - Intergenic
953285157 3:41599411-41599433 CTAAGATACTCACAGGTTTCAGG + Intronic
953592014 3:44267054-44267076 CTAATAAACACAGAGGTTTCGGG - Exonic
953729055 3:45429622-45429644 CTAACATATTCACAGGTTCAAGG + Intronic
954732025 3:52672369-52672391 ACAATATATTCACAGGTTTCAGG + Intronic
954968752 3:54634289-54634311 CTCAGATACTCACATCTCTCAGG + Intronic
955105738 3:55895987-55896009 CTGTGAAACTCACAGGTTCCTGG - Intronic
955514047 3:59709137-59709159 GTAACATATTCACAGGTTCCAGG - Intergenic
955842689 3:63129030-63129052 GTAACATAATCACAGGTTTTAGG - Intergenic
955971228 3:64440546-64440568 CTAACATAAACCCAGGTTTCCGG - Intronic
956282673 3:67574292-67574314 ATAACATATTCACAGGTTCCAGG + Intronic
956380564 3:68660510-68660532 ATAACATATTTACAGGTTTCAGG - Intergenic
956515858 3:70047043-70047065 GTCACATACTCACAGGTTCCAGG + Intergenic
956561433 3:70580593-70580615 GTAACATATTCACAGTTTTCAGG - Intergenic
956715582 3:72076940-72076962 GTAATATATTCACAGGTTCCAGG + Intergenic
957813501 3:85259265-85259287 CTAAAATATTCATAAGTTTCAGG - Intronic
958610874 3:96424508-96424530 GTAGCATATTCACAGGTTTCAGG + Intergenic
958739804 3:98055755-98055777 CTAACATATTCACAGGTTCTGGG + Intergenic
960364872 3:116759010-116759032 CAATGATACTCACATTTTTCTGG + Intronic
960371617 3:116847600-116847622 ATAAGATATTCACAGGTTCCAGG + Intronic
960726893 3:120679503-120679525 AGATAATACTCACAGGTTTCAGG - Intronic
960757154 3:121027784-121027806 ATAACATATTCAAAGGTTTCAGG + Intronic
963008316 3:140747060-140747082 ATAATATATTCAAAGGTTTCAGG + Intergenic
963438574 3:145306270-145306292 GTAACATATTCATAGGTTTCTGG + Intergenic
963580098 3:147115400-147115422 TTAACATATTTACAGGTTTCAGG - Intergenic
963665604 3:148181481-148181503 CTAACATATTCACAGCTTCCAGG + Intergenic
964862674 3:161219906-161219928 GTAATATATTCACAGATTTCAGG - Intronic
966018540 3:175176502-175176524 GTAATATATTCACAGGTTACAGG - Intronic
967103089 3:186233069-186233091 CTAACATACTCACAGGCTCTGGG - Intronic
969847912 4:9934083-9934105 CTAACATATTCACAGGTTCTGGG + Intronic
970002301 4:11375984-11376006 TTAACATATTCACAGGTTCCAGG - Intergenic
970573057 4:17401460-17401482 CTAAGAGATTCACACCTTTCGGG + Intergenic
970734295 4:19148154-19148176 GTAACATATTCACAGGTTTTGGG + Intergenic
970781272 4:19740969-19740991 CTCTGATAACCACAGGTTTCAGG + Intergenic
971088515 4:23310491-23310513 CTGAAATACTCACAAGTTTCTGG - Intergenic
971778256 4:30995974-30995996 CTAATGTATTCACAGGTTCCTGG + Intronic
971813661 4:31460620-31460642 GTAACATATTCACAGGTTTGGGG - Intergenic
972464651 4:39343401-39343423 CTAATATAGTCACAGGTTCTAGG + Intronic
972842543 4:42948644-42948666 TTAACATATTCACAGGTTCCAGG - Intronic
973375109 4:49281042-49281064 CCCAGAGACTCACAGGTCTCGGG - Intergenic
973376008 4:49287064-49287086 CCCAGAGACTCACAGGTCTCGGG - Intergenic
973377853 4:49299382-49299404 CCCAGAGACTCACAGGTCTCGGG - Intergenic
973378797 4:49305662-49305684 CCCAGAGACTCACAGGTCTCGGG - Intergenic
973379421 4:49309992-49310014 CCCAGAGACTCACAGGTCTCGGG + Intergenic
973380294 4:49315988-49316010 CCCAGAGACTCACAGGTCTCGGG + Intergenic
973382302 4:49329199-49329221 CCCAGAGACTCACAGGTCTCGGG + Intergenic
973385841 4:49513811-49513833 CCCAGAGACTCACAGGTCTCGGG + Intergenic
974374384 4:61057783-61057805 ATAACATATTCACAGGTTCCAGG - Intergenic
974578267 4:63758227-63758249 CTCAGAATCTCACAGTTTTCTGG - Intergenic
974594710 4:64000327-64000349 CAACCATACTCAAAGGTTTCAGG + Intergenic
975435681 4:74348595-74348617 CTGGGATAGTCACAGGTCTCAGG - Intergenic
975517848 4:75266872-75266894 GTAAGATACTAACAAGTTTCAGG - Intergenic
975525007 4:75339392-75339414 ATAACATACTCACAGTTTCCAGG + Intergenic
975634998 4:76439396-76439418 CTGACATATTCACAGGTTTCAGG + Intronic
976010562 4:80482972-80482994 GTAACATAATCACAGGTTCCAGG - Intronic
976141785 4:82000582-82000604 CTAACATATTCACAGGTTCCAGG + Intronic
977407441 4:96617898-96617920 CTCAGAGACTCACAAATTTCAGG - Intergenic
977533144 4:98224296-98224318 CTAACATATTTACAGGTTTTTGG - Intergenic
979079318 4:116313543-116313565 ATAATATATTCACAGTTTTCAGG - Intergenic
979261489 4:118652150-118652172 GTAACATATTCACAGGTTCCAGG + Intergenic
979944098 4:126804255-126804277 CTAAGATCCTCACATTTTCCTGG - Intergenic
980263198 4:130481285-130481307 ATAACATATTCACAGGTTCCAGG - Intergenic
980276676 4:130661252-130661274 TCAACATATTCACAGGTTTCAGG + Intergenic
980403987 4:132332302-132332324 ATAACGTATTCACAGGTTTCAGG - Intergenic
980656036 4:135787487-135787509 CTAATATAGTGACAGGATTCAGG - Intergenic
980841528 4:138266906-138266928 GTAACATGCTCACAGGTTTGAGG + Intergenic
981402417 4:144328976-144328998 GTAACATAGTCACAGGTTCCAGG - Intergenic
981722456 4:147815389-147815411 ATAACATATTCACAGGTTCCAGG - Intronic
982587799 4:157264597-157264619 CTAGCATATTCACAGGTTTTGGG + Intronic
982593322 4:157345068-157345090 CTAAGATATTTTCAGATTTCAGG + Intronic
983150348 4:164271184-164271206 GTAACATATTCACAGGTTCCAGG - Intronic
983705433 4:170652928-170652950 GTAACATATTCACAGGTTCCAGG - Intergenic
983793598 4:171829830-171829852 AGATAATACTCACAGGTTTCAGG - Intronic
983908793 4:173213336-173213358 CTAACAAACTCTCAGGTTTATGG - Intronic
984138192 4:175968303-175968325 CTAAGATATTTACAGTTTTGTGG - Intronic
984155443 4:176190915-176190937 GTATCATATTCACAGGTTTCAGG + Intronic
986342554 5:6803321-6803343 CTAATATTCTCACGTGTTTCAGG - Intergenic
987242039 5:16010010-16010032 GTGACATACTCACAGGTTTCAGG - Intergenic
987717224 5:21587345-21587367 TTAACATATTAACAGGTTTCAGG + Intergenic
987781392 5:22440864-22440886 ATAAAATAGTCACAGGTTACAGG + Intronic
987807966 5:22794727-22794749 ATAATATATTCACAGGTTTCAGG - Intronic
988091472 5:26545680-26545702 GTGACATACTCACAGGTTCCAGG + Intergenic
988105090 5:26734861-26734883 TTAATATACTCACAGTTTTGAGG - Intergenic
988133889 5:27143223-27143245 GTAACATACTCACAGATTCCAGG - Intergenic
989328617 5:40228943-40228965 GCAACATATTCACAGGTTTCTGG + Intergenic
990047950 5:51457683-51457705 CTAACATATTCACAGGTTCCAGG - Intergenic
990148649 5:52790768-52790790 ATAACATATTCACAGGTTCCAGG + Intronic
990568876 5:57057476-57057498 ATAACATATTCACAGGTTCCAGG - Intergenic
991064305 5:62409630-62409652 GTAACATATTCACAGGTTTTGGG + Intronic
991259946 5:64656024-64656046 CTAACATTGTCACAGGTTCCAGG + Intergenic
991404251 5:66286243-66286265 ATAACATATTCACAGGTCTCCGG + Intergenic
992205613 5:74427763-74427785 ATAAAATATTCACAGGTTTCAGG + Intergenic
992324788 5:75650142-75650164 ATAACATATTCACAGGTTCCGGG - Intronic
992655120 5:78901256-78901278 ATAACATATTCACAGGTTCCAGG + Intronic
993013564 5:82510642-82510664 CTCACATACTCACAGGTTCTGGG + Intergenic
993083994 5:83340326-83340348 CTAACATATTCTCAGGTTCCAGG - Intronic
993131907 5:83908797-83908819 CTAATACATTCACAGTTTTCAGG - Intergenic
993342486 5:86741538-86741560 CTAACATATTCACAGGTTCTGGG - Intergenic
994446752 5:99884842-99884864 TGGAGATACTCACAGATTTCAGG - Intergenic
995572590 5:113495970-113495992 ATAATATACTCACAGGTTCCAGG + Intergenic
995856724 5:116600599-116600621 GTAACATATTCACAAGTTTCGGG + Intergenic
996624826 5:125557845-125557867 ATAACATATTCACAGGTTTGGGG + Intergenic
997610743 5:135213836-135213858 CAAAGTTGCTCACAGGTCTCAGG - Intronic
998878664 5:146625721-146625743 GTAAGATATTCCCAGGTTCCGGG - Intronic
1000355079 5:160386563-160386585 GTAACATATGCACAGGTTTCAGG + Intergenic
1000895249 5:166847426-166847448 CTAACATACTCACAAGTTCTGGG - Intergenic
1001244161 5:170093313-170093335 CTAACATATTCACAGGCTCCAGG - Intergenic
1001657029 5:173358987-173359009 GTAACATAGTCACAGGTTGCAGG + Intergenic
1002072858 5:176690755-176690777 CTGACATAGTCACAGGTTCCAGG + Intergenic
1002086627 5:176780006-176780028 CCAACATATTCACAGGTTCCAGG - Intergenic
1002732049 5:181345267-181345289 GTAACATATTCACAGGTTCCAGG + Intergenic
1002752482 6:128838-128860 GTAACATATTCACAGGTTCCAGG - Intergenic
1003032428 6:2613569-2613591 ATAAAATATTCACAGGTCTCAGG + Intergenic
1004080230 6:12385413-12385435 ATAACATACTTACAAGTTTCAGG - Intergenic
1004213557 6:13678772-13678794 TTATTATACTCACAGGTCTCAGG - Intronic
1004268823 6:14175631-14175653 GAAAGATATTCACAGGTTGCAGG - Intergenic
1004789741 6:19011654-19011676 GTAACATATCCACAGGTTTCAGG + Intergenic
1004985434 6:21077390-21077412 GTAACATATTCACAAGTTTCGGG - Intronic
1004998337 6:21215835-21215857 CTAACATATTCACAGGTTCTAGG - Intronic
1005250325 6:23938210-23938232 CTAACGTATTCACAGGTTCCAGG + Intergenic
1005377613 6:25199975-25199997 ATAATATATTCACAGGTTTCAGG - Intergenic
1005604823 6:27465948-27465970 GTAACAAATTCACAGGTTTCAGG - Intronic
1005615859 6:27572678-27572700 GTAACGTATTCACAGGTTTCTGG - Intergenic
1006583353 6:35089245-35089267 CTGAGCAACTCAAAGGTTTCCGG + Exonic
1007010741 6:38415178-38415200 CTAATATACTCACAGATTTTGGG - Intronic
1008008048 6:46433374-46433396 GTAATGTATTCACAGGTTTCAGG - Intronic
1008132402 6:47733811-47733833 CTAACATAATCTCAGGTTTCAGG - Intergenic
1008169473 6:48184972-48184994 TTATGATCTTCACAGGTTTCAGG + Intergenic
1008437115 6:51489113-51489135 CTAACATATTCACAGGTTCCAGG - Intergenic
1008547097 6:52592714-52592736 GTAACATAGTCACAGGTTCCAGG + Intergenic
1008818840 6:55606717-55606739 ATAACATATTCACAGGTTTTGGG - Intergenic
1010802898 6:80198854-80198876 ATAAATTACTCACAGATTTCTGG + Intronic
1011010790 6:82701765-82701787 GTAACATATTCACAGGTTCCAGG + Intergenic
1011701733 6:89961487-89961509 CTAGGAAAATCACTGGTTTCTGG - Intronic
1012121148 6:95367979-95368001 ATAATATATTCACAGGTTCCAGG - Intergenic
1012136661 6:95566068-95566090 GTAACATAGTCACAGGTTTTGGG - Intergenic
1012173420 6:96048264-96048286 GTAACATATTCACAGCTTTCAGG + Intronic
1012280148 6:97318776-97318798 ATCAGATATTTACAGGTTTCAGG + Intergenic
1012342542 6:98144426-98144448 TTATCATATTCACAGGTTTCAGG + Intergenic
1012630566 6:101461662-101461684 GTAACATATTCACAGGTTCCAGG + Intronic
1013871808 6:114772349-114772371 GTAACATAGTCACAGGTTCCAGG + Intergenic
1013945550 6:115718061-115718083 ATAACATATTCACAGGTTCCAGG - Intergenic
1014051888 6:116964425-116964447 ATAAGATATTCACAGGTTCCAGG + Intergenic
1014172461 6:118293538-118293560 GTAATATATTCACAGGTTTAAGG + Intronic
1014187872 6:118456481-118456503 TTAATGTACTCACAGGTTTCAGG - Intergenic
1014212411 6:118720707-118720729 CAAACATATTCACAGGTTTTGGG - Intergenic
1015147286 6:130001211-130001233 CTCAGTTGCTCACAGGTTCCCGG - Intergenic
1016164528 6:140923829-140923851 GTAAGATATTTACAGGTTTGAGG + Intergenic
1016341292 6:143064125-143064147 CTAATGTATTCACAGGTTCCTGG - Intronic
1016393470 6:143598120-143598142 GTAACATATTCACAGGTTTAAGG - Intronic
1016504166 6:144759517-144759539 CTAACATTTTCACAGGTTCCAGG - Intronic
1016698529 6:147027337-147027359 CACATATACACACAGGTTTCTGG - Intergenic
1018517788 6:164605991-164606013 GTAACATATTCACAGGCTTCAGG - Intergenic
1019236301 6:170617580-170617602 GTAACATATTCACAGGTTCCAGG + Intergenic
1019927098 7:4200440-4200462 CTAAGTTATTCCCAGATTTCTGG - Intronic
1020999801 7:15314704-15314726 GTAATATACTCACAGGTTCCAGG - Intronic
1022188640 7:27995532-27995554 CTTGCATACTCACAGATTTCAGG + Intronic
1022726935 7:32989790-32989812 GTAACATACTCACAGGTTCTGGG - Intronic
1022825755 7:34011701-34011723 CTAAGATGGGTACAGGTTTCTGG - Intronic
1023282671 7:38587560-38587582 CTAAGATATTCACAGGGGGCTGG + Intronic
1023356675 7:39374429-39374451 GTGAGATACTGACAGCTTTCTGG + Intronic
1023546684 7:41325118-41325140 GTAACATATTCACAGGTTCCGGG + Intergenic
1024907117 7:54398223-54398245 CTAACATACTCAAACATTTCAGG + Intergenic
1025046648 7:55697846-55697868 GTAACATACTCACAGGTTCTGGG + Intergenic
1025067982 7:55874321-55874343 ATAAGATACTTACAGGTTCTAGG - Intergenic
1026372817 7:69718693-69718715 GTAACATATTCACAGGTTCCAGG + Intronic
1027593312 7:80141125-80141147 GTGACATATTCACAGGTTTCAGG + Intronic
1027848957 7:83424643-83424665 GTAACATATTCACAGGTTCCAGG - Intronic
1028073498 7:86481414-86481436 GTAACATAGTCACAGGTTTCAGG + Intergenic
1028399283 7:90407307-90407329 CTTTGCTAATCACAGGTTTCTGG + Intronic
1030164167 7:106536235-106536257 ATAACATATTCACAGGTTCCAGG - Intergenic
1030632016 7:111906602-111906624 GTAACATACTCATAGGTTCCAGG - Intronic
1030866809 7:114710277-114710299 CTAACGTATTCACAGGTTCCTGG + Intergenic
1030895297 7:115052415-115052437 CTAATATATTCACAGGTTTGAGG - Intergenic
1031689343 7:124767204-124767226 GTAACATACTCACAGGTATTAGG - Intergenic
1032168394 7:129563770-129563792 CTAACAAATTCACAGGGTTCTGG + Intergenic
1032716803 7:134515728-134515750 CTAATATATTCACAGGTGCCAGG + Intergenic
1033814753 7:145058059-145058081 GTAAAATATTCACAGGTTTTGGG + Intergenic
1034845082 7:154437088-154437110 CTAACATAGTCACAGGTACCAGG - Intronic
1035484838 7:159214850-159214872 GTAAGATACTCACAGTGATCAGG + Intergenic
1035511471 8:189017-189039 GTAACATATTCACAGGTTCCAGG - Intergenic
1035980964 8:4371301-4371323 CCAAGATACTCACAGACTACTGG + Intronic
1036965063 8:13288579-13288601 GTAAGATACTCAAGAGTTTCTGG - Intronic
1037032295 8:14123771-14123793 GTGACATATTCACAGGTTTCAGG - Intronic
1037177867 8:15967871-15967893 GTAATATACTCACAGGTTCTGGG + Intergenic
1037218792 8:16490673-16490695 CTAACATATTCACAGGTTTGGGG - Intronic
1037574101 8:20184701-20184723 GCAACATACTCACAGGTTCCAGG + Intergenic
1038647178 8:29371571-29371593 CTGGGTAACTCACAGGTTTCTGG + Intergenic
1039046426 8:33454521-33454543 GTAACATATTCACAGGTTTCAGG + Intronic
1039232673 8:35465695-35465717 CTAACATATTCACAGGTTTCAGG - Intronic
1040098741 8:43477363-43477385 CTAAGATCTTCTCATGTTTCAGG - Intergenic
1040398011 8:47018164-47018186 ATAATATATTCACAGGTTCCAGG - Intergenic
1041734197 8:61092823-61092845 ATAACATATTCACAGTTTTCAGG + Intronic
1041860367 8:62506188-62506210 ATAATATATTTACAGGTTTCAGG + Intronic
1042413450 8:68491757-68491779 GGAACATATTCACAGGTTTCGGG + Intronic
1042841374 8:73127176-73127198 ATAACATACTCACAGGTTCCAGG + Intergenic
1043761189 8:84070208-84070230 ATAACATATTCACAGGTATCTGG - Intergenic
1044361539 8:91290708-91290730 ATAACATACTCACAGGTTCTGGG + Intronic
1044475538 8:92621037-92621059 GTAATATATTCACAGGTTCCAGG - Intergenic
1044753390 8:95437497-95437519 GTAAGATATTCACAGGTTCCAGG - Intergenic
1045391210 8:101716678-101716700 TTAACGTATTCACAGGTTTCAGG - Intronic
1045400426 8:101811132-101811154 ATAACATACTCACAGGTTCCAGG - Intronic
1045460856 8:102424611-102424633 CAAAGATACCTACAGATTTCTGG + Intergenic
1046236958 8:111436704-111436726 GTAACATATTCACAGGTTCCGGG + Intergenic
1046291536 8:112168307-112168329 CTAACGTATTCACAGGTTTCAGG + Intergenic
1047215683 8:122874203-122874225 ATAAAATATTCACAGGTTCCAGG + Intronic
1047329384 8:123872610-123872632 GTAAGATAATAACAGGATTCTGG + Intronic
1047365212 8:124205069-124205091 CTAAGATAGTCACAGCTTCTGGG - Intergenic
1047690585 8:127349615-127349637 CTAACATATTTACAGGTTCCAGG + Intergenic
1048218015 8:132514428-132514450 CTAATATATTCACAGTCTTCTGG + Intergenic
1048284363 8:133130327-133130349 GTAACACAGTCACAGGTTTCAGG - Intronic
1050209361 9:3235886-3235908 TTAATATATTCACAGGTTCCAGG + Intronic
1050306096 9:4307572-4307594 CTAACATATTCATAGGTTCCAGG - Intronic
1051685300 9:19652308-19652330 CAAACATATTCACAGGTTTCTGG - Intronic
1052149793 9:25101821-25101843 CTTACATATTCACAGGTTTGGGG + Intergenic
1052509414 9:29396349-29396371 CTAACATAGTCACAGATTCCAGG + Intergenic
1052643982 9:31208291-31208313 CTACGATATTCACAGGTATTAGG + Intergenic
1052684979 9:31744201-31744223 GTTATATATTCACAGGTTTCTGG + Intergenic
1052832570 9:33228274-33228296 GTAACATATTCACAGGTTTGGGG + Intronic
1054754248 9:68941227-68941249 GTAACATATTCACAGGTTACAGG - Intronic
1054960325 9:70961003-70961025 ATAACATATTCCCAGGTTTCAGG - Intronic
1055567987 9:77588192-77588214 GTAACATATTCACAGTTTTCAGG + Intronic
1055817154 9:80220152-80220174 GTAAAATATTCACAGGTTTGGGG + Intergenic
1055889836 9:81111688-81111710 GTAACATATTCACAGGTTTGGGG + Intergenic
1056056504 9:82829284-82829306 ATAAGATACTAAAAGGTTACAGG + Intergenic
1056849982 9:90074545-90074567 TATAGATGCTCACAGGTTTCAGG + Intergenic
1057362551 9:94388178-94388200 CCATGATACTCACATGTATCTGG - Intronic
1057660785 9:96999915-96999937 CCATGATACTCACATGTATCTGG + Intronic
1057738606 9:97690949-97690971 ATAATATATTCACAGGTTCCAGG + Intronic
1057865380 9:98676008-98676030 GTAACATATCCACAGGTTTCTGG - Intronic
1058154544 9:101500554-101500576 GTAACATATTCACAGGTTTCAGG + Intronic
1058255039 9:102751296-102751318 GTAACATATTCACAGGTTCCAGG - Intergenic
1058562609 9:106245841-106245863 CTAACATATTCACAGGTTCTGGG + Intergenic
1058577108 9:106415570-106415592 GTAACATATTCACAGGTTCCAGG - Intergenic
1058671077 9:107360825-107360847 CTAACAGATTCACAGGTTCCAGG + Intergenic
1059082785 9:111267447-111267469 CAAAGATACTTGAAGGTTTCTGG - Intergenic
1059977378 9:119731880-119731902 GTAACATATTCACAGGTTCCAGG - Intergenic
1059990252 9:119858517-119858539 CAAAATTACTTACAGGTTTCTGG + Intergenic
1060051435 9:120381252-120381274 GTAACATATTCACAGGTTCCGGG + Intergenic
1060921398 9:127423020-127423042 CTAACATATTCAGAGGTTCCGGG - Intergenic
1061627268 9:131848459-131848481 CTAATATACTCCCAGGTTCCGGG - Intergenic
1062756450 9:138297602-138297624 GTAACATATTCACAGGTTCCAGG + Intergenic
1203698825 Un_GL000214v1:119291-119313 CCCAGAGACTCACAGGTCTCGGG - Intergenic
1203699783 Un_GL000214v1:125589-125611 CCCAGAGACTCACAGGTCTCGGG - Intergenic
1203700681 Un_GL000214v1:131581-131603 CCCAGAGACTCACAGGTCTCGGG - Intergenic
1203479517 Un_GL000224v1:179-201 CCCAGAGACTCACAGGTCTCGGG - Intergenic
1203480483 Un_GL000224v1:6475-6497 CCCAGAGACTCACAGGTCTCGGG - Intergenic
1203481450 Un_GL000224v1:12803-12825 CCCAGAGACTCACAGGTCTCGGG - Intergenic
1203482414 Un_GL000224v1:19112-19134 CCCAGAGACTCACAGGTCTCGGG - Intergenic
1203549003 Un_KI270743v1:152976-152998 CCCAGAGACTCACAGGTCTCGGG - Intergenic
1203549447 Un_KI270743v1:155573-155595 CCCAGAGACTCACAGGTCTCGGG + Intergenic
1203550405 Un_KI270743v1:161885-161907 CCCAGAGACTCACAGGTCTCGGG + Intergenic
1203568551 Un_KI270744v1:111303-111325 CCCAGAGACTCACAGGTCTCGGG - Intergenic
1203569122 Un_KI270744v1:115537-115559 CCCAGAGACTCACAGGTCTCGGG - Intergenic
1203570071 Un_KI270744v1:121826-121848 CCCAGAGACTCACAGGTCTCGGG - Intergenic
1186002314 X:5026541-5026563 GTAACATAGTCACAGGTTCCAGG - Intergenic
1186216413 X:7305912-7305934 GTAACATATTCACAGGTTACAGG + Intronic
1186526056 X:10249394-10249416 GTAACATATTCACAGGTTCCAGG - Intergenic
1186528338 X:10270156-10270178 GTAACATACTCACAGGTTTCAGG - Intergenic
1186622861 X:11259906-11259928 ATAACATACTCACAGGTTCCTGG - Intronic
1186676017 X:11818242-11818264 CTAACATATTCCCAGGTTCCAGG - Intergenic
1186918746 X:14253335-14253357 CTAATATATTTATAGGTTTCAGG - Intergenic
1187116073 X:16352585-16352607 CCCAGATACTCCCAGATTTCTGG + Intergenic
1188117993 X:26268506-26268528 CTAACATACTCACCGGTTCTGGG + Intergenic
1188359871 X:29240095-29240117 CTAAAATATTCACAGGTTCTGGG + Intronic
1188510258 X:30928181-30928203 ATAAAATATTCACAGGTTTCAGG + Intronic
1188584168 X:31752195-31752217 GTAACATATTCACAGGTTCCTGG + Intronic
1188929370 X:36087561-36087583 TTAAGATGCTCACAGATTTGTGG - Intronic
1189912910 X:45828990-45829012 ATAACATGCTCACAGGTTCCAGG + Intergenic
1190144629 X:47879186-47879208 ATAATATATTCACAGGTTCCAGG + Intronic
1191899458 X:66025727-66025749 CTAACATACTGACAGGTTCCAGG - Intronic
1192280960 X:69684897-69684919 CTAAGATTCTCTCAGCATTCTGG - Intronic
1192846882 X:74915511-74915533 CTAACATATTCACAGGTTCTAGG - Intronic
1194128200 X:90045962-90045984 CTAAAATATTCACAGTTTGCTGG - Intergenic
1194391702 X:93325975-93325997 GTAATATATTCACAGGTTCCAGG + Intergenic
1195246635 X:103001255-103001277 GTAACACAATCACAGGTTTCAGG + Intergenic
1195494179 X:105510544-105510566 GTGATATACTCACAGGTTCCAGG - Intronic
1195647373 X:107247472-107247494 CTAAGACACTGACATGTTCCAGG + Intergenic
1196531474 X:116792029-116792051 TTAACATATTCACAGGTTCCTGG + Intergenic
1196596399 X:117550791-117550813 CTAACATATTCACAGGTTCCAGG - Intergenic
1196745646 X:119069801-119069823 CTAACAGACCCACAGGGTTCTGG + Intergenic
1196790274 X:119458346-119458368 GTAACATACTCACAGGTTCTGGG - Intergenic
1197610960 X:128637637-128637659 GTAACATATTCACAGGTTCCAGG + Intergenic
1197895756 X:131312618-131312640 GTAACACATTCACAGGTTTCAGG + Intronic
1198587342 X:138137247-138137269 CTAACATAGTCACAAGTTTCAGG + Intergenic
1198874519 X:141208877-141208899 GTAATATATTCACAGGTTGCAGG - Intergenic
1199611023 X:149613735-149613757 ATAACATATTCACAGGTTTCAGG + Intronic
1199764404 X:150930440-150930462 GTCACATATTCACAGGTTTCAGG + Intergenic
1199785439 X:151101079-151101101 CTAACATATTCATAGGTTCCAGG - Intergenic
1201225101 Y:11810984-11811006 ATAACATACTCACAAGTTCCAGG + Intergenic