ID: 953302102

View in Genome Browser
Species Human (GRCh38)
Location 3:41787515-41787537
Sequence CTGAATTGGCAGGGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 346
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 318}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953302102 Original CRISPR CTGAATTGGCAGGGGGAAGA AGG (reversed) Intronic
902112494 1:14094097-14094119 CTGACTTGCCTTGGGGAAGAGGG + Intergenic
902535808 1:17118858-17118880 CTGAACTGGGAGTGGGAAGCAGG + Intronic
902898157 1:19493924-19493946 CTGATTTGGCATAGGGTAGAAGG - Intergenic
907728032 1:57038606-57038628 CTGAATTGGAAGCTGGAAGAAGG - Intronic
908529558 1:65021369-65021391 CAGAAGTGGGAGGTGGAAGAAGG - Intergenic
909214703 1:72871615-72871637 CAGAATAGGCAGAGAGAAGATGG - Intergenic
909842195 1:80341891-80341913 TTGACTAGGCAGGGGGAAGTGGG - Intergenic
911040146 1:93584802-93584824 CTGAATTGGAAAGGGACAGAAGG - Intronic
912337220 1:108874514-108874536 AGAAATTGGCAGGGGCAAGATGG + Intronic
912910638 1:113756099-113756121 TTAAATTGGCTAGGGGAAGAAGG + Intronic
913524236 1:119675950-119675972 ATGAATTGGCATTGGGAAGAAGG + Intronic
914385490 1:147165776-147165798 CAGAATTGTCAGGGGGCAGGGGG + Intronic
915518703 1:156429041-156429063 CTGCATGGGCTGGGGGAAGGAGG + Intronic
916880540 1:169016095-169016117 CTGGTTTAGCAGGGAGAAGACGG - Intergenic
917019269 1:170568867-170568889 CTAGATTGGTAGGGGCAAGATGG + Intergenic
918093728 1:181317971-181317993 GTGAAATTGAAGGGGGAAGAAGG - Intergenic
918106417 1:181419208-181419230 CTGGCTGGGCAGGGGGAAGAGGG - Intronic
918670104 1:187204207-187204229 CTGAATTGGGAGGAGGAGAATGG - Intergenic
919421482 1:197374996-197375018 CTGAAATGGTAGGTGAAAGAGGG - Intronic
919814894 1:201431108-201431130 CAGAAATGTCAGGGGGAAGCAGG + Intergenic
920362159 1:205426557-205426579 CTGGATTGGCAGGAAGCAGAAGG + Intronic
920838753 1:209536145-209536167 CAGAATTGCCAGGAGGCAGAGGG + Intergenic
920939210 1:210465321-210465343 CTGAAATGGCAGGGGGACTAAGG - Intronic
921466904 1:215499221-215499243 CTGAATGGGAAGAGGAAAGAGGG + Intergenic
1065864941 10:29906406-29906428 CTGACTTGCCTTGGGGAAGAGGG + Intergenic
1067840954 10:49679206-49679228 CAGAAGGGGCCGGGGGAAGAAGG + Intergenic
1069034300 10:63630810-63630832 AGGACTTGGTAGGGGGAAGAGGG - Intergenic
1069109320 10:64425754-64425776 ATGCATGGGCAGTGGGAAGATGG + Intergenic
1070287255 10:75093005-75093027 TTGAGTTGTCAGGTGGAAGAGGG + Intergenic
1072294414 10:93995145-93995167 CTGACTTGGGAGGTGGAAGCAGG + Intronic
1072913923 10:99525807-99525829 GTGGATGGGCATGGGGAAGAAGG - Intergenic
1072923438 10:99595894-99595916 CTGAAGGGGTAGGGGGAAGCAGG + Intergenic
1073750233 10:106517516-106517538 CTGAATTTCAAGGGGGAATATGG - Intergenic
1074082945 10:110182231-110182253 CTGTCTGGGCAGGAGGAAGAAGG - Intergenic
1074512051 10:114122407-114122429 CTGAAGTGGTATGGGGAAAATGG + Exonic
1075070298 10:119315872-119315894 ATGAATTTGGAGGGGGAGGAAGG - Intronic
1075403763 10:122180266-122180288 CTGAGGTGGGAGGGGGAAGGAGG - Intronic
1075580903 10:123617606-123617628 CTGAAGTGGCAGGGTGAGCAAGG + Intergenic
1076718182 10:132378430-132378452 CTGAAGTCTCAGGGAGAAGAGGG - Exonic
1077332156 11:1988496-1988518 CTGCATTGGGAGGGTGAGGAGGG + Intergenic
1079997942 11:27316153-27316175 CTGAAGGGGCTGGGGAAAGAAGG - Intergenic
1080038859 11:27738015-27738037 CTGAATTCTCAGGGGCAAGTTGG + Intergenic
1081694121 11:45097836-45097858 CTGCAGTGGCAGGAGGAAGTGGG + Intronic
1083322790 11:61857548-61857570 CTGGCTTGGCATGGGGAGGAGGG + Intronic
1084318944 11:68362809-68362831 ATGAAGTGGCACAGGGAAGATGG - Intronic
1085186229 11:74578365-74578387 CTGAAGAGGAAGGTGGAAGAAGG + Intronic
1085408385 11:76277469-76277491 CTGCATAGGCAGGGGCTAGATGG + Intergenic
1085751612 11:79167233-79167255 CTGAGTTCACAGTGGGAAGAAGG + Intronic
1086269286 11:85041038-85041060 GGGAATAGGCAGGGGGAACAGGG + Intronic
1087226466 11:95606385-95606407 CTTTATTGGCAGTGTGAAGACGG - Intergenic
1087802609 11:102520105-102520127 CTGCGTTGGCATGGGGAAAAGGG + Intergenic
1088550309 11:111005996-111006018 GGGAATTGGCAGGTAGAAGACGG - Intergenic
1089668253 11:120033906-120033928 CTGGAATGAGAGGGGGAAGATGG + Intergenic
1089801918 11:121038704-121038726 CTGAATTTGCAGGGGGTCGGGGG - Intronic
1090683151 11:129083557-129083579 GGGACTTGGCAGGGGGATGATGG + Intronic
1090696915 11:129254510-129254532 GTGAAATGGAAGGGGAAAGAAGG + Intronic
1090924621 11:131238584-131238606 CTGAATTGGGGGTGGGAAGGAGG + Intergenic
1202815137 11_KI270721v1_random:43672-43694 CTGCATTGGGAGGGTGAGGAGGG + Intergenic
1092169382 12:6363711-6363733 CTGAAGGGGCGAGGGGAAGAGGG + Intronic
1092218095 12:6696274-6696296 AGGATTTGGCTGGGGGAAGACGG - Intronic
1092286580 12:7132145-7132167 CTGAATTGGCTGGTGGTTGAAGG + Intronic
1093230064 12:16533042-16533064 TTAAAGTGGCAGGAGGAAGAGGG - Intronic
1094078160 12:26501287-26501309 TTGAATTGCCAGGGGTAAAAAGG + Intronic
1094498981 12:31006606-31006628 CTGATTTTGCAGGAGGGAGAAGG + Intergenic
1095214684 12:39534193-39534215 CTGGACTGGCAGGGGCATGATGG - Intergenic
1095494852 12:42773441-42773463 TTGAGAGGGCAGGGGGAAGAAGG + Intergenic
1097237931 12:57552374-57552396 CTGAATTGGCAGGGGGCCTGGGG - Intronic
1099618911 12:84976007-84976029 CTTCACTGGCAGAGGGAAGAGGG - Intergenic
1100201062 12:92298293-92298315 CTGCATTCTCAGAGGGAAGAGGG + Intergenic
1100992439 12:100266149-100266171 CTAGATTTGCAGGGGGAAGTGGG + Intronic
1101575315 12:105991842-105991864 CTGAACAGGGAGTGGGAAGATGG - Intergenic
1102025271 12:109711133-109711155 CTGAGGGGGCAGGGGGCAGAGGG - Intergenic
1102371091 12:112382571-112382593 CTGAATGGCCAGGGGGAGAAGGG - Intergenic
1102963192 12:117107012-117107034 CGGAACTTGCAGGGGGCAGATGG + Intergenic
1103443656 12:120980462-120980484 CTGACTTGGCAGGAAGAGGAGGG + Intronic
1104026743 12:125033004-125033026 CGGGATTGGCAGCGGGCAGAAGG - Intergenic
1106033020 13:26019542-26019564 CTTAATTGGCAGTGGGAAAGTGG + Intronic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1110458078 13:75712250-75712272 CTGAAGTGGCAGGTGGAGCAGGG + Intronic
1110731716 13:78886229-78886251 CTGACTTGGGAGGTTGAAGAAGG - Intergenic
1112483779 13:99801256-99801278 AAGAATAGGCAGGGGGAAAAGGG - Intronic
1112619482 13:101039981-101040003 CTGAAGTGGCAGGGGGGTGGTGG + Intergenic
1112801122 13:103110661-103110683 CTGAATTGTCAGGGGGACCCAGG + Intergenic
1113087746 13:106585679-106585701 CTGAAGTGGCTGGGGGATTAGGG - Intergenic
1114616485 14:24071454-24071476 ATGGATTGGGAGGGAGAAGAGGG - Intronic
1114661001 14:24344816-24344838 CTGAGTCGGCAGGGGGTGGAAGG - Intergenic
1115984932 14:39095183-39095205 GTGGATTGGCTGGGGGGAGAGGG + Intronic
1117867624 14:60165748-60165770 CTGAATAGGAATGGAGAAGAGGG - Intronic
1121058698 14:90883386-90883408 CAGATTTGGCAGGCAGAAGAAGG - Intronic
1122531911 14:102434226-102434248 CTGAATTAGAAGGTGGAAGCAGG + Exonic
1122580895 14:102770986-102771008 CTGAATAAGCACGGGGAAGGTGG + Intergenic
1126536493 15:49771317-49771339 CTGAATTCTCTGGGGGATGATGG + Intergenic
1126896174 15:53259064-53259086 CTGAAGAGGCAGGAAGAAGAAGG + Intergenic
1127642744 15:60931045-60931067 TTTAAATGGCAGGGGGAAGAGGG + Intronic
1128246470 15:66136012-66136034 CTGAAGTGCAAGGGTGAAGAGGG - Intronic
1128329420 15:66745938-66745960 CTGAACTGGCTGTGGGAAGTGGG - Intronic
1128638343 15:69317478-69317500 GTGAACTGGCAGAGGGAAGAAGG - Intronic
1129454096 15:75667347-75667369 CAGAACTTGCAGGGGGGAGAGGG - Intergenic
1130880896 15:88055050-88055072 ATGAACTGGCAGAGGGAAGGGGG + Intronic
1130967903 15:88710669-88710691 CTAAATTGGCTTGGGGAGGAGGG + Intergenic
1131403268 15:92143583-92143605 CTTTAGTGTCAGGGGGAAGATGG + Intronic
1132075713 15:98818194-98818216 ATGAATTGGCAGGGTGGAGGTGG + Intronic
1132227626 15:100154769-100154791 GTGAATTTGCTGGGGGATGAGGG - Intronic
1133119834 16:3599216-3599238 CTGAGATGGCAGAGGGCAGAGGG - Intronic
1133629281 16:7603911-7603933 CAGAATGGACAGGGGGAAGGAGG + Intronic
1136002662 16:27306761-27306783 CTGATTTGCCAGAGGTAAGAGGG + Intergenic
1136129369 16:28210343-28210365 CTAACTTGGCAGGGGTAAAATGG + Intronic
1136367165 16:29814177-29814199 GTGAAGGGGCAGGGGGAGGAGGG - Intronic
1139007657 16:62593220-62593242 CTAAATCTGCAGGGTGAAGATGG - Intergenic
1139320377 16:66109573-66109595 CTGATCTTGCAGGAGGAAGAGGG - Intergenic
1143114470 17:4574873-4574895 GTGAGTAGGCAGGGGGAAGTGGG - Intergenic
1143628144 17:8122482-8122504 GGAAAGTGGCAGGGGGAAGAAGG + Intronic
1144620246 17:16814362-16814384 CAGCATGGGCATGGGGAAGAGGG - Intergenic
1144783939 17:17821603-17821625 CTCAGTTTACAGGGGGAAGAGGG + Intronic
1146097983 17:29951030-29951052 CTGCTTTGGGTGGGGGAAGAGGG - Intronic
1147455974 17:40538396-40538418 CTGAAATGTTTGGGGGAAGAAGG + Intergenic
1147571628 17:41575241-41575263 CAGCATGGGCATGGGGAAGAGGG - Intergenic
1148215041 17:45829775-45829797 CTGGAATGGCAGGGAGTAGAAGG + Intronic
1148477822 17:47940961-47940983 CTGAATGGGAAGGGGGAAGAAGG - Intergenic
1148638476 17:49167266-49167288 CTGCATGGCCAGGAGGAAGAGGG + Intronic
1150041167 17:61863167-61863189 CTCAACTGGCTGGGGGAGGAGGG - Intronic
1150586416 17:66522427-66522449 GAGAATAGGCAGGGGGAAGAGGG + Intronic
1150998314 17:70344894-70344916 TTGAAGAGGCAGAGGGAAGAGGG - Intergenic
1151801536 17:76382514-76382536 CTGAGTTGGCAAGGGGAGGCGGG - Intronic
1153515523 18:5897050-5897072 ATGAATAGGTAGGGGGAAGGCGG - Intergenic
1154311522 18:13270430-13270452 CTGAATTGGCCGGGTCGAGAGGG + Intronic
1154937217 18:21073348-21073370 CTGATATGGCAGGGGGAGCAGGG + Intronic
1154940501 18:21108644-21108666 CTTTATTGGCAGGGAAAAGATGG - Intronic
1155026941 18:21949615-21949637 GTGAATAGACAGGGAGAAGATGG + Intergenic
1156010773 18:32495082-32495104 GGAAATTGGGAGGGGGAAGAGGG - Intergenic
1156269391 18:35517085-35517107 CTGGAGTTGCAGGAGGAAGATGG - Intergenic
1156518999 18:37705710-37705732 CTTAATTGGCAGGAGGTAGTTGG - Intergenic
1157689475 18:49669223-49669245 CTGAATTAGCAGTGGTGAGAAGG + Intergenic
1157772107 18:50358322-50358344 GTGAACAGGCAGGGAGAAGATGG - Intergenic
1158476450 18:57784210-57784232 TGGAATTTGCAGGGGGAAGCCGG + Intronic
1159125128 18:64214892-64214914 CTGAATTGACAGGTAGAGGAAGG + Intergenic
1160191878 18:76721506-76721528 CAGTAGGGGCAGGGGGAAGATGG + Intergenic
1160396038 18:78572836-78572858 CTGACTTTGGAGGTGGAAGAGGG + Intergenic
1161915788 19:7226874-7226896 CAAAATTGGCAGGAGGAGGAGGG - Intronic
1162884861 19:13689403-13689425 GTTATTGGGCAGGGGGAAGAGGG - Intergenic
1166942631 19:46375957-46375979 GTGAAATGGCAGGGGGACCATGG - Intronic
925619244 2:5774684-5774706 CTCAGGTGGGAGGGGGAAGAAGG + Intergenic
926206633 2:10838500-10838522 CTGATTGGGCAGCTGGAAGAGGG + Intergenic
927016588 2:18969709-18969731 TTGAATTGGGAGGGAGAAGAAGG + Intergenic
927665986 2:25033235-25033257 CTGCATTGGCAAGGGGGAAATGG - Intergenic
929947103 2:46379985-46380007 CTCAATGTGCAGGGTGAAGAGGG + Intronic
930354905 2:50305847-50305869 GAGAATTGGCAGGGAAAAGAAGG - Intronic
930622168 2:53655033-53655055 CTCAATTGGTAGGGAAAAGATGG + Intronic
931186153 2:59953299-59953321 ATGAACTGTCTGGGGGAAGAAGG + Intergenic
932437408 2:71710739-71710761 CTGAAAAGGCAGGGAGGAGAAGG - Intergenic
934712754 2:96526641-96526663 CTGAATTGCCAGGGTGGAGTGGG - Intergenic
936944179 2:117915665-117915687 CTGAATTGCCTCTGGGAAGAGGG - Exonic
937098005 2:119248222-119248244 CTGAGTTGCCAGAGGGAGGAAGG - Intronic
937460571 2:122082195-122082217 CAGAATTGTCAGGAGGGAGAAGG - Intergenic
938973796 2:136456502-136456524 CAGAATGGGAAGGGGGAAAAGGG + Intergenic
939049745 2:137293759-137293781 CTAAATTGGCAGCAGTAAGAAGG - Intronic
939113863 2:138038786-138038808 CAGAATTAGAAGGGGGAAGTGGG - Intergenic
939289884 2:140180368-140180390 GTGAATTGTCATGGGGAAAAAGG + Intergenic
939692543 2:145283009-145283031 CTGAATGGGCAGTTGGAGGATGG + Intergenic
939857953 2:147383139-147383161 CTGAAATGGGAGAGGGAAGAAGG - Intergenic
940029607 2:149247684-149247706 GGGAAAGGGCAGGGGGAAGAAGG - Intergenic
940375120 2:152948994-152949016 CTGATTTGACAGGAGGCAGATGG + Intergenic
940986847 2:160059396-160059418 CTGGATTGGCCAGAGGAAGAGGG + Intronic
941584764 2:167343828-167343850 CTGTATTAGAAGGGGAAAGATGG + Intergenic
945188388 2:207163072-207163094 CGGTTTTGGGAGGGGGAAGAAGG + Intronic
946099106 2:217303513-217303535 CTGAATTTGCATTGGGAAGCAGG + Intronic
946498941 2:220225173-220225195 CTGAAATGGCAGTGGGAGGTTGG - Intergenic
946548877 2:220778144-220778166 CAGAAATGGCTGGGGAAAGAGGG + Intergenic
947120468 2:226808924-226808946 CTGAACAGGAATGGGGAAGATGG + Intergenic
948049583 2:234969459-234969481 ATGAATGGGCAGGAGGAACAAGG - Intronic
948080978 2:235204932-235204954 GTGAATTGGGATGAGGAAGAAGG - Intergenic
948094316 2:235321427-235321449 CTGAAATGGCAAGGGGAAAAGGG - Intergenic
948217219 2:236240629-236240651 TTGAGTGGGCAGGGGGAGGAGGG + Intronic
948806381 2:240455086-240455108 CAGGATCGGGAGGGGGAAGATGG + Intronic
1168889041 20:1281941-1281963 CTGCATTGCCATGGGGCAGAGGG + Intronic
1168969976 20:1924377-1924399 CTGAATCAGCAGCTGGAAGAAGG - Intronic
1171207185 20:23290302-23290324 TGGAATTGGCAAGGGGATGAGGG - Intergenic
1172808053 20:37627324-37627346 CAGAAAAGGCAGGGGGGAGAGGG - Intergenic
1175346675 20:58284042-58284064 TTGAATTGGTAGGGAGAAGATGG - Intergenic
1176968925 21:15243619-15243641 CTGAATTTGAAGTGGGAAGAAGG + Intergenic
1177168175 21:17626428-17626450 CAGAATTAGAAGGGGGTAGATGG + Intergenic
1178213927 21:30571893-30571915 CAGAATTAGCAGGGGGACAAAGG + Intergenic
1178815055 21:35921803-35921825 CTGAGTTGGCACGGGGTGGAGGG - Intronic
1179146854 21:38775520-38775542 CTGTATTGGAATGGGGATGAGGG + Intergenic
1179182359 21:39056677-39056699 CTGAATGGTCAGGGGTGAGATGG - Intergenic
1180693677 22:17738578-17738600 CTGAATGGACAGGAGGAAGGGGG + Intronic
1181468330 22:23122717-23122739 GTGGATGGGCAGTGGGAAGATGG + Intronic
1181646459 22:24233839-24233861 GTGAACTGCCATGGGGAAGATGG - Intronic
1181660453 22:24343320-24343342 CTTAATGGGCATGGGGATGAGGG - Intronic
1181665944 22:24397168-24397190 CTGTTTTGGCAGAGGGAAAATGG - Intronic
1182526676 22:30924767-30924789 ATGACTTGGAAGGAGGAAGATGG - Intergenic
1184965071 22:47965635-47965657 GTGAATAGGGAAGGGGAAGAGGG + Intergenic
1185161078 22:49230252-49230274 CTGAGTGGGCAGGGGGACGCTGG - Intergenic
950086689 3:10263877-10263899 GTGACATGGCAAGGGGAAGAGGG - Intronic
951340835 3:21484696-21484718 CTGAAGTGTCAGGGAGGAGAGGG + Intronic
951706320 3:25547426-25547448 CAGTAGTGGAAGGGGGAAGATGG - Intronic
952883544 3:37999450-37999472 CTGGGTTAGCTGGGGGAAGATGG + Intronic
953269223 3:41424086-41424108 CAGCACTGGCAGGGGAAAGATGG - Intronic
953302102 3:41787515-41787537 CTGAATTGGCAGGGGGAAGAAGG - Intronic
953348576 3:42197130-42197152 CTGGATTGCCAGAGGGGAGAGGG + Intronic
953715193 3:45311522-45311544 CTGGAGAGGCAGGGGGCAGAAGG + Intergenic
955125087 3:56103255-56103277 TTCAATTGGCAGGGTGAAGTGGG + Intronic
955694304 3:61620388-61620410 TTGAATTTGCAGAGGGAAAATGG + Intronic
956220899 3:66902057-66902079 CTTTATTAGCAGGGGGAAAATGG + Intergenic
956818204 3:72928358-72928380 CTGAACTGGAAGGGGGAAGGAGG - Intronic
957179731 3:76861060-76861082 CTGATGTTGCAGAGGGAAGAGGG - Intronic
958865548 3:99497572-99497594 GTGATTTTTCAGGGGGAAGAAGG + Intergenic
959324112 3:104914188-104914210 CTGAATAAGCAGAGGCAAGAAGG + Intergenic
959526811 3:107386775-107386797 CTGAGGTGGAAGGAGGAAGAAGG - Intergenic
960359686 3:116696886-116696908 CTAAACTAGCAGGGAGAAGATGG - Intronic
960432928 3:117591778-117591800 CTGAAGTGGATGGGGGAAAAGGG - Intergenic
961524971 3:127490828-127490850 CTGGATGGGCTGGGGAAAGATGG - Intergenic
962555934 3:136551437-136551459 TTTTTTTGGCAGGGGGAAGAGGG + Intronic
963275300 3:143324144-143324166 CTCTATTGGGAGGGGGTAGAGGG + Intronic
963452740 3:145505502-145505524 CTGAGTTGGCTGGGGAAAGTGGG - Intergenic
966974238 3:185070794-185070816 CTGAATTGGCAGGGCTGACACGG + Intergenic
968468620 4:765850-765872 CAGAAGTTGCTGGGGGAAGACGG - Intronic
968720249 4:2197231-2197253 CTGAAGGGGCAGGTGGAAGCAGG + Intronic
968914442 4:3491156-3491178 ATGAATGAGCAGGAGGAAGAAGG - Intronic
969199345 4:5590197-5590219 CTGAACTGTCAGGGACAAGAAGG + Intronic
969411465 4:7031228-7031250 CTGAACAGGCAGGTGGGAGAGGG - Exonic
971607518 4:28676931-28676953 CTGAACTGCCTTGGGGAAGAAGG + Intergenic
971859681 4:32087868-32087890 TAGAATTGTCAGGGGGAACAGGG - Intergenic
973272571 4:48276543-48276565 CTGTCTTGGCAGGGGAAGGAGGG - Intergenic
973638612 4:52882260-52882282 CAGAATTGTCGTGGGGAAGAGGG + Intronic
975278050 4:72525872-72525894 CTGAACTGGCGGGGGAGAGAGGG + Intronic
975698498 4:77038842-77038864 ATGAATTGGCAGGGTGGACAGGG - Intronic
978737422 4:112099747-112099769 TTGAATTGGCAAGAGGAGGAGGG + Intergenic
978740862 4:112136378-112136400 CTCATTTGGCAGAAGGAAGAAGG + Intergenic
978747891 4:112214747-112214769 ATAAATTGGCAGGAGAAAGAGGG + Intergenic
979754296 4:124321554-124321576 CTCCATAGGCAGTGGGAAGAAGG - Intergenic
979969513 4:127116459-127116481 TTGAATTGGCAGTGGAAAGGAGG - Intergenic
980070684 4:128240550-128240572 CTGACTTGGCTGGAGGATGAAGG - Intergenic
980512477 4:133812375-133812397 CTGCACTGGCTGGGGGAAGTGGG - Intergenic
981309748 4:143285642-143285664 CTGTATGGGGTGGGGGAAGAGGG - Intergenic
982800124 4:159695827-159695849 ATGAAATTCCAGGGGGAAGAAGG + Intergenic
983822400 4:172212065-172212087 CTGAAGTGGGTGGGGGAAGAAGG - Intronic
985487126 5:158192-158214 CAGGATGGGCAGGGGGAGGAGGG - Intronic
985487145 5:158233-158255 CAGGATGGGCAGGGGGAGGAGGG - Intronic
985606552 5:861212-861234 CTGAATTGGGAGGCAGAGGAGGG - Intronic
985780018 5:1865646-1865668 CTGAATTTCCAGGAGGCAGACGG - Intergenic
985836979 5:2278770-2278792 CTGAAGCGTCAGGGGGTAGACGG - Intergenic
987524561 5:19030781-19030803 CTGAGTTGTGAGGAGGAAGAAGG - Intergenic
987961470 5:24814585-24814607 CTGAATTTGGATGAGGAAGAGGG + Intergenic
991256966 5:64624477-64624499 CTGAATTGGGGATGGGAAGAGGG - Intergenic
994133211 5:96255111-96255133 GGGGGTTGGCAGGGGGAAGAAGG + Intergenic
995408535 5:111829336-111829358 AAGAATTGGCAGGGGGAGGCTGG + Intronic
997356845 5:133267859-133267881 CTGGCTTGGCTGGGGCAAGAAGG + Intronic
998214537 5:140227307-140227329 TTGCATGGGCAGGGGGGAGAGGG + Intronic
998367154 5:141638941-141638963 CAGCATTGGCTGAGGGAAGAAGG - Exonic
999380510 5:151117930-151117952 CAGTATTGGCAGGGGGAGGTGGG + Intronic
1002469311 5:179426031-179426053 CTGGATAGGCAATGGGAAGATGG - Intergenic
1003087703 6:3074179-3074201 CTGAGTGGGCAGGGGCATGAAGG - Intronic
1003651424 6:7964200-7964222 CTGAATTGCCTGGTGGTAGATGG - Intronic
1004199778 6:13536859-13536881 CTGAATTGACAGGAGGCTGATGG - Intergenic
1004620413 6:17326153-17326175 TTGAAGGGGCAGGGGGAAGTCGG + Intergenic
1004989440 6:21120321-21120343 CTGAATTTGCTGTGGGATGATGG - Intronic
1005356109 6:24984972-24984994 TTGATTTGGCAGGTGGCAGAGGG - Intronic
1005943381 6:30578096-30578118 CCGAAAAGGCAGGCGGAAGAAGG + Exonic
1006051673 6:31350145-31350167 CTGAATTCCAAGAGGGAAGAGGG + Intronic
1006296916 6:33173829-33173851 CTGAGTGGGCAGGGGGCAGTTGG + Intronic
1006984923 6:38169759-38169781 CTGAATGGGCGGGGGGGAGGGGG - Exonic
1007082301 6:39116424-39116446 CTGGATTGGAAGGAGGGAGAGGG + Intergenic
1007414202 6:41682712-41682734 CTGCCTTGGCCGGGGGATGAAGG - Intergenic
1007608312 6:43132103-43132125 CTGCATTGGCCAGGGGCAGAGGG + Exonic
1007610750 6:43147334-43147356 CTGAGGTGGCAGGGGGTAGCAGG - Intronic
1008005133 6:46402435-46402457 CTGACTTGCCTTGGGGAAGAGGG - Intronic
1008252378 6:49255981-49256003 CTGAATTGGAAAGTGGGAGAAGG - Intergenic
1008627137 6:53327727-53327749 ATGAATTGGAAGGGTGAAGAGGG - Intronic
1011002979 6:82611889-82611911 ATGAACTGGCATGTGGAAGAAGG - Intergenic
1011833679 6:91404231-91404253 CTCCACAGGCAGGGGGAAGAAGG + Intergenic
1012167305 6:95973387-95973409 ATGAGTTGCCAGAGGGAAGAAGG + Intergenic
1012475169 6:99608899-99608921 CTGAATTGGCGGTGGGGAGTGGG - Intronic
1012750842 6:103161504-103161526 GTTAATTGGGAGGGAGAAGAAGG + Intergenic
1013004078 6:106054425-106054447 CTGAATTGGGCAGGGGCAGATGG + Intergenic
1018981860 6:168607426-168607448 CTGAATTGGCAGTGGGAACCAGG - Intronic
1019844358 7:3482278-3482300 CGGAATTGGCAGGGTGAAAAAGG + Intronic
1019960181 7:4452467-4452489 CAGAATTGACAGGGGGTAGATGG - Intergenic
1020699666 7:11464068-11464090 GTGAATAGGAAGGGGGTAGAAGG - Intronic
1021190453 7:17613677-17613699 CTGAATATGCAGGCTGAAGAAGG - Intergenic
1021432840 7:20580908-20580930 TTGAATTGGCAAGGAGAATACGG + Intergenic
1021897199 7:25248578-25248600 CTGATTTGTCAGGGTGGAGATGG - Intergenic
1022258646 7:28683348-28683370 CTGATTTGGAAGGGGCAGGAGGG + Intronic
1022739386 7:33107012-33107034 CTGGTTTGGGAGGGGGAAGAGGG + Intronic
1023213165 7:37830295-37830317 CTGCAATGGCAGAGGGTAGAAGG + Intronic
1024210478 7:47199015-47199037 CTCACATGGCAGGGGGAAGGCGG + Intergenic
1026913207 7:74104789-74104811 CTGCATTGGCAGGAGGGAGCTGG - Intronic
1027184891 7:75965155-75965177 CTGACTTGGAAGCAGGAAGATGG + Intronic
1028450586 7:90977758-90977780 CAGAATAGCCAGGGGGAAGGAGG + Intronic
1029547543 7:101218240-101218262 CTGACTTGGGAAGGGGAAGGGGG - Intronic
1030164094 7:106535605-106535627 CTGAGTTGGCAAGGCTAAGAGGG + Intergenic
1030750781 7:113229153-113229175 CTGAATCTGCAGGCTGAAGATGG - Intergenic
1031024451 7:116664839-116664861 CTGTATTTGCAAGGGGAGGAAGG - Intergenic
1033030998 7:137826701-137826723 GTGATCTGGCAGGGGGAAGGGGG + Intronic
1033101349 7:138475325-138475347 AAGTATTGGCAGGGGGAAGGAGG + Intronic
1034271196 7:149804117-149804139 CAGAATTGGGAGGAGGAAGGGGG - Intergenic
1034868134 7:154658095-154658117 CTGCAATGGCAGGTGCAAGACGG + Intronic
1035050416 7:155995598-155995620 CTGAATGGGCACACGGAAGATGG - Intergenic
1036108960 8:5876655-5876677 ATGAATTAACACGGGGAAGAGGG - Intergenic
1036429194 8:8674289-8674311 CTGACTTGGCAGGTTGGAGATGG - Intergenic
1037774145 8:21821757-21821779 CAAAATTGGCAGGGGAAAGCTGG + Intergenic
1039575453 8:38620176-38620198 CTGAATGGGCAGAGGGAAAAAGG - Intergenic
1039842067 8:41301100-41301122 ATGCAGTGGCAGGGGGACGAGGG + Intronic
1040741225 8:50578860-50578882 CTTAATTAGCAGTGTGAAGATGG + Intronic
1040859698 8:51986296-51986318 CTGGATTGTCAGGGACAAGATGG - Intergenic
1041346804 8:56907445-56907467 CAGAGTTGGCAGGAGGGAGAGGG - Intergenic
1041726625 8:61023860-61023882 CTGAAGTCGCAGGGAGAAGCCGG + Intergenic
1041858865 8:62488323-62488345 CAGAATTAGCAGAGGAAAGAAGG - Intronic
1043973441 8:86558589-86558611 CTGAATTGACTGGGCAAAGATGG - Exonic
1044752082 8:95426100-95426122 CTGAATTGGCTGGAGGAAGCAGG + Intergenic
1044817183 8:96125204-96125226 CTGAAAAGGGAGGTGGAAGAGGG + Intergenic
1045417321 8:101980215-101980237 TTGAGTGGGCAGGGAGAAGATGG - Intronic
1045489077 8:102655718-102655740 CTGAATGGGGAGGGGGCAGACGG - Exonic
1045733856 8:105272525-105272547 CTGAATTGGGGGTGAGAAGAAGG + Intronic
1046665975 8:117003344-117003366 ATGAATTGGCAGGGGCATGTTGG + Intronic
1046809580 8:118517844-118517866 CAGAATGGGCTGGGGGAGGAGGG + Intronic
1046892894 8:119442417-119442439 CTGAATTGGGGGTGGGAAGATGG + Intergenic
1047530575 8:125670497-125670519 CTGCATAGGCAGTGAGAAGATGG + Intergenic
1048280866 8:133104753-133104775 TGGAATAGGCTGGGGGAAGAGGG + Intronic
1048292817 8:133193358-133193380 CTGCAGTGGAAGGAGGAAGATGG + Intronic
1048298337 8:133232922-133232944 CTGAATTGGGGGGGGGAAATGGG + Intergenic
1049547041 8:143237463-143237485 CTGAATGGGCAGTGAGAAGTGGG + Intergenic
1050212527 9:3278172-3278194 CTTCAGTGGCATGGGGAAGAAGG + Intronic
1051853268 9:21533731-21533753 GTGAATTGGCAGGGTGTTGACGG + Intergenic
1054730879 9:68701983-68702005 CTGAATTGGAAGGTTCAAGAAGG - Intergenic
1054754566 9:68944710-68944732 CTGTAATGGCAGGAAGAAGAGGG - Intronic
1055995057 9:82148322-82148344 GTGGATTGGCAGCAGGAAGAAGG - Intergenic
1056994686 9:91445148-91445170 CTGACTTGGCTCTGGGAAGAAGG + Intergenic
1057117486 9:92539624-92539646 CTAGATTGGTAGGAGGAAGATGG + Intronic
1058239633 9:102540747-102540769 CTCAATTGCCAGGGGCAAGGTGG + Intergenic
1058959341 9:109978158-109978180 CTGAGGTGGCAGAGGGGAGATGG + Intronic
1060660480 9:125402402-125402424 CTCAGTTGCCAGGGGGAGGATGG + Intergenic
1060921313 9:127422494-127422516 CTGAGGTGGCAGAAGGAAGATGG - Intergenic
1061077008 9:128347917-128347939 CTGAAAGGGGAGAGGGAAGAAGG + Intronic
1062402891 9:136380209-136380231 CTGCACTGGCAGGGGGAACAAGG - Intronic
1185795469 X:2960843-2960865 CTGATTTGGAAGGGGGAAGCGGG + Intronic
1186705259 X:12133946-12133968 GCGAATTTGCAGGGGCAAGAAGG - Intergenic
1189237367 X:39497638-39497660 GAGAATTGGCTGGGGGAAGAAGG + Intergenic
1190026467 X:46928210-46928232 CAGGATTGGCAGGGCAAAGAGGG - Intronic
1190537488 X:51443929-51443951 CTGACATGGCTGGGCGAAGATGG + Intergenic
1191055119 X:56232914-56232936 CTGAATTGGTAGAGGTAAAAGGG + Intronic
1196284533 X:113863922-113863944 CAGCACTGGCAGGGGAAAGATGG + Intergenic
1197251511 X:124220808-124220830 GGGAAAGGGCAGGGGGAAGATGG - Intronic
1197730412 X:129804903-129804925 TTGAAATGGAAGGGGGAAGGAGG + Exonic
1198102217 X:133432075-133432097 ATGTATTGACAGGGAGAAGAAGG + Intergenic
1201575057 Y:15454639-15454661 CTCACTGGGCAGGGGGAAGGTGG + Intergenic