ID: 953311436

View in Genome Browser
Species Human (GRCh38)
Location 3:41883942-41883964
Sequence CTCCATTTACAGACGGGCCA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 3, 3: 4, 4: 114}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953311436_953311442 8 Left 953311436 3:41883942-41883964 CCTTGGCCCGTCTGTAAATGGAG 0: 1
1: 0
2: 3
3: 4
4: 114
Right 953311442 3:41883973-41883995 GGCTCTGAAAAGAAGAGTCGGGG 0: 1
1: 0
2: 3
3: 17
4: 133
953311436_953311441 7 Left 953311436 3:41883942-41883964 CCTTGGCCCGTCTGTAAATGGAG 0: 1
1: 0
2: 3
3: 4
4: 114
Right 953311441 3:41883972-41883994 AGGCTCTGAAAAGAAGAGTCGGG 0: 1
1: 3
2: 1
3: 19
4: 268
953311436_953311443 15 Left 953311436 3:41883942-41883964 CCTTGGCCCGTCTGTAAATGGAG 0: 1
1: 0
2: 3
3: 4
4: 114
Right 953311443 3:41883980-41884002 AAAAGAAGAGTCGGGGACCGAGG 0: 1
1: 0
2: 0
3: 20
4: 188
953311436_953311440 6 Left 953311436 3:41883942-41883964 CCTTGGCCCGTCTGTAAATGGAG 0: 1
1: 0
2: 3
3: 4
4: 114
Right 953311440 3:41883971-41883993 CAGGCTCTGAAAAGAAGAGTCGG 0: 1
1: 0
2: 5
3: 24
4: 314

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953311436 Original CRISPR CTCCATTTACAGACGGGCCA AGG (reversed) Exonic
903122668 1:21226367-21226389 CTCCTTTTACAGACAAGACATGG + Intronic
904475646 1:30763084-30763106 CTGCATTTACAGAAGGTCGAAGG - Intergenic
904547460 1:31286842-31286864 CTCTAGTTAGAGATGGGCCAAGG - Intronic
912591599 1:110826297-110826319 CTCAATTTACAAATGGGCAAGGG + Intergenic
912736402 1:112153013-112153035 CTCCAGATACAGAGGGGACAGGG + Intergenic
913075746 1:115338929-115338951 CTACAGTTTCAGAGGGGCCAAGG - Intergenic
916314862 1:163437960-163437982 CTCGGTTTACAGACGGGGAATGG - Intergenic
916341814 1:163745133-163745155 CAGCATTTACAGACTGGCCCTGG - Intergenic
916371383 1:164099337-164099359 CTCTATTTAAAGATGGGCAAAGG - Intergenic
919318767 1:196007199-196007221 ATTCATTTACAGACCGGGCATGG + Intergenic
919493779 1:198238330-198238352 CTCCTTTTTCAGAGGGGCAAGGG + Intronic
921512980 1:216054796-216054818 GTCCAATTACAGACAGGCCAAGG - Intronic
922825661 1:228516372-228516394 CTCCATTTAAAAATGGGCAAAGG - Intergenic
924503583 1:244659548-244659570 CTCCATCTTCAGACCGGCAATGG + Intronic
924951017 1:248883421-248883443 CTCCATTTAAAAATGGGCAAAGG - Intergenic
1067539057 10:47138400-47138422 CTCCTCTTCCAGAAGGGCCAAGG - Intergenic
1070015356 10:72523826-72523848 ATATACTTACAGACGGGCCAAGG - Intronic
1070919526 10:80175426-80175448 CTCCATCCACAGCCAGGCCAGGG + Intronic
1083641744 11:64149400-64149422 CTCCATTTGCACCAGGGCCAGGG - Intronic
1084065663 11:66702646-66702668 CTTTATTTACAGACCGGGCATGG + Intronic
1084439809 11:69166370-69166392 CTCCACATGCAGACCGGCCATGG - Intergenic
1088587097 11:111368920-111368942 CTCCGATGACAGATGGGCCATGG - Intronic
1088598625 11:111457307-111457329 CCCCATCTCCAGAGGGGCCAAGG - Intronic
1088619944 11:111671555-111671577 CTCCAATCACAGCCAGGCCAAGG - Intronic
1088819404 11:113444632-113444654 CACCATTTATAGATGGCCCATGG - Intronic
1090618444 11:128539364-128539386 CCCAATTTAAAAACGGGCCAAGG + Intronic
1099745194 12:86692962-86692984 CTCTAGTTACAGAAGGTCCATGG - Intronic
1103321453 12:120094918-120094940 CTCCATGAACAGGTGGGCCAGGG - Intergenic
1107359616 13:39603781-39603803 CTGCCTTTCCAGACGAGCCAGGG + Intergenic
1119567423 14:75640660-75640682 CAGCATTTACAGAAGGGGCAAGG - Intronic
1123114817 14:105889924-105889946 CACCACTTACACACAGGCCAGGG - Intergenic
1123121279 14:105918201-105918223 GACCACTTACACACGGGCCAGGG - Intronic
1123399400 15:19969466-19969488 GGCCATTGACAGAGGGGCCATGG + Intergenic
1124487067 15:30127673-30127695 CTCCGTTTACAGATGGGCCAAGG + Intergenic
1124542152 15:30596648-30596670 CTCCGTTTACAGATGGGCCAAGG + Intergenic
1124756458 15:32410650-32410672 CTCCGTTTACAGATGGGCCAAGG - Intergenic
1127530136 15:59835593-59835615 CTCCATCTACAGAATGACCAGGG + Intergenic
1133273739 16:4624750-4624772 CTCCATTTCCCGACGTGCCCCGG + Intronic
1135940816 16:26820117-26820139 CTCCTTTTACAGATGGGGAAAGG - Intergenic
1139176277 16:64692219-64692241 ATGCATTTAAAGAAGGGCCATGG - Intergenic
1140484136 16:75280678-75280700 CTCATTTTATAGACAGGCCAGGG + Intergenic
1141937259 16:87249163-87249185 CTCCATTTGCAGAAAGGGCATGG - Intronic
1142024763 16:87806539-87806561 CTCCCTTTGCAGCCGGGGCACGG + Intergenic
1142034740 16:87856014-87856036 TCCCACTTACAGACAGGCCAAGG - Intronic
1142629776 17:1217257-1217279 ATCCAATTACAGACGCGTCACGG - Intronic
1142892729 17:2955448-2955470 CTCAATTTAAAAACGGGCAAAGG - Intronic
1145915580 17:28571851-28571873 CTCCATTTTCAGATGAGCCTCGG - Exonic
1148071936 17:44913785-44913807 CTCCAGATCCAGACGGGCCAGGG + Exonic
1149591146 17:57830853-57830875 CTCCATTTTCAGATGGGAAAAGG - Intergenic
1150337800 17:64343097-64343119 CTCCTTTTACAGATGGGGAAAGG + Intronic
1153929974 18:9869773-9869795 CTCCTTTTACAGAAGGAGCATGG + Intergenic
1153989318 18:10381915-10381937 CACCATTCACAGGCTGGCCATGG + Intergenic
1158324045 18:56295009-56295031 TTCCCTTTGCTGACGGGCCAAGG + Intergenic
1163819988 19:19490935-19490957 CTCCATTTGCTGACGGCACAAGG - Intronic
1164823458 19:31267371-31267393 CTCCATGTTCAAATGGGCCATGG + Intergenic
1165600028 19:37046717-37046739 ATACATTTACATACAGGCCAAGG + Intronic
1166939295 19:46353132-46353154 CTCATTTTACAGACAAGCCATGG - Intronic
929533292 2:42765254-42765276 CTCCATATGCAGACAGGCCTGGG + Intergenic
932103874 2:68925585-68925607 CTCCACTTACTCATGGGCCAGGG + Intergenic
932235043 2:70114184-70114206 CCCCCTCTACAGAAGGGCCAGGG - Intergenic
933822041 2:86121992-86122014 CTCAACTTACAGGCGGGCCCCGG - Intronic
934593190 2:95577459-95577481 CTCCAGGTACAGACTGACCATGG + Intergenic
1172060108 20:32181650-32181672 CTCCATTTTAAGAGGAGCCATGG + Intergenic
1173104460 20:40120110-40120132 CCCATTTTACAGACGGGTCAGGG + Intergenic
1173225469 20:41160051-41160073 CTCCATCTACAGTCAGGCCTGGG - Intronic
1175983662 20:62753762-62753784 CTCCATTGGAAGCCGGGCCATGG + Intronic
1175989135 20:62778859-62778881 CTCCATTTACAGATGGGGAGAGG + Intergenic
1178633310 21:34281133-34281155 CCCCATGTGGAGACGGGCCAAGG - Intergenic
1182849135 22:33456796-33456818 CTACATTTACAGAAGGGCACTGG - Intronic
1183698141 22:39434770-39434792 CTCCCATCACAGAGGGGCCAGGG + Intronic
1184925815 22:47636532-47636554 CTCAATTTACAGAGGACCCAAGG + Intergenic
949393314 3:3587369-3587391 CTCCATTTGCAGAAGGGGAATGG - Intergenic
949837743 3:8287423-8287445 CTTCATTTACATACTGTCCATGG - Intergenic
952305005 3:32137867-32137889 GATCATTTACAGAGGGGCCATGG + Intronic
953311436 3:41883942-41883964 CTCCATTTACAGACGGGCCAAGG - Exonic
953415188 3:42711727-42711749 CTCATTTTACGGATGGGCCAGGG + Intronic
954062987 3:48084485-48084507 CTGCATTTAAAGACTGGCCTAGG + Intronic
959806525 3:110561588-110561610 CTCCATTTACTTAAGGGCTAGGG + Intergenic
959946768 3:112133418-112133440 CTGAAATTACAGATGGGCCATGG + Intergenic
964991074 3:162813473-162813495 GTCCAATTTCAGACCGGCCACGG + Intergenic
966846933 3:184138028-184138050 CTCCATTTTCAGAAGACCCAGGG + Exonic
968911197 4:3477755-3477777 CTCCAATCCCAGAGGGGCCAAGG - Intronic
969454088 4:7291321-7291343 CTGCAGGTGCAGACGGGCCACGG + Intronic
970504373 4:16712224-16712246 CTCAATTTACAAATGGGCAAAGG + Intronic
974969745 4:68808942-68808964 CTCCATTAAAAAATGGGCCAGGG + Intergenic
975699973 4:77055204-77055226 CTCCATTTCCAGACTAACCATGG + Exonic
976232069 4:82854856-82854878 CTGCATTTACATACGTGGCAGGG - Intronic
987017976 5:13839349-13839371 CTCCACTTACAGACAGGTGATGG - Exonic
987253220 5:16121633-16121655 TTCTAATTACAGAAGGGCCAAGG + Intronic
994309131 5:98246137-98246159 CTCCATCTACAGATGACCCAAGG + Intergenic
998478576 5:142442351-142442373 TTCCATTTAAAGACGAGCTAGGG + Intergenic
1000003488 5:157162434-157162456 ATCCATTTAAAGAGGAGCCAGGG - Exonic
1016294915 6:142563971-142563993 CTCCATTCAAAAACTGGCCAAGG + Intergenic
1018918677 6:168155275-168155297 CTCCATCTTCTGATGGGCCATGG - Intergenic
1021346311 7:19532957-19532979 CTCCATTTAAAAATGGGCAAAGG + Intergenic
1024308228 7:47945945-47945967 CTCCACTCACAGAGGCGCCAAGG + Intronic
1030412169 7:109194562-109194584 CTCAATTTAAAAATGGGCCAAGG - Intergenic
1032546679 7:132749552-132749574 ATCAATTTGCAGATGGGCCAAGG - Intergenic
1032896498 7:136256860-136256882 CTCCATCTACAGAGGAACCAGGG - Intergenic
1036391277 8:8326467-8326489 CCACATTTATAGAAGGGCCAGGG + Intronic
1038162958 8:25057620-25057642 CTCCATTTAAAAATGGGCCAAGG - Intergenic
1041586736 8:59529330-59529352 CTCCATTTACTGACAGCACAAGG - Intergenic
1044925825 8:97208075-97208097 CTCCATTTCCAGTGGGGCCAAGG - Intergenic
1047435168 8:124830008-124830030 CTCCCTTTACAGACAGGCAGTGG - Intergenic
1051867028 9:21695042-21695064 CTCCATTTACAGCCTCCCCATGG + Intergenic
1052581829 9:30366747-30366769 CTCCATTAAAAGATGGGCAAAGG - Intergenic
1056429335 9:86511767-86511789 CTCCATTTACAAATGGGAGATGG + Intergenic
1057269679 9:93643818-93643840 GGCCATTTACAGAGGGCCCACGG - Intronic
1058240755 9:102555205-102555227 CTCCATTTACAGTAGGCACAAGG + Intergenic
1058395663 9:104551103-104551125 CTCCATTCACAGAACTGCCAGGG + Intergenic
1059438760 9:114291008-114291030 CTCCATTTTCACACAGGCCCTGG - Intronic
1060731588 9:126040259-126040281 TCCCATTTACAGACGGGGAAAGG + Intergenic
1061959959 9:133982882-133982904 CTCCGTTTACAGACCACCCAGGG + Intronic
1187146776 X:16644426-16644448 CTCAATTTACAGGCTGGGCATGG - Intronic
1187578189 X:20580084-20580106 CACCATGTACAGATTGGCCAAGG - Intergenic
1192085056 X:68087753-68087775 CTCCATTTACACTCTGGCTAAGG + Intronic
1195781492 X:108470470-108470492 CTCCATTTAAAAATGGGCAAAGG - Intronic
1199888665 X:152051074-152051096 CTCCATTTACAAATGGTCAATGG - Intergenic
1201397934 Y:13569297-13569319 CTCCATTAAAACACGGGCAAAGG - Intergenic
1202251531 Y:22878346-22878368 CTCCATGTACACAGGGCCCAAGG + Intergenic
1202404519 Y:24512095-24512117 CTCCATGTACACAGGGCCCAAGG + Intergenic
1202466260 Y:25157987-25158009 CTCCATGTACACAGGGCCCAAGG - Intergenic