ID: 953311440

View in Genome Browser
Species Human (GRCh38)
Location 3:41883971-41883993
Sequence CAGGCTCTGAAAAGAAGAGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 344
Summary {0: 1, 1: 0, 2: 5, 3: 24, 4: 314}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953311436_953311440 6 Left 953311436 3:41883942-41883964 CCTTGGCCCGTCTGTAAATGGAG 0: 1
1: 0
2: 3
3: 4
4: 114
Right 953311440 3:41883971-41883993 CAGGCTCTGAAAAGAAGAGTCGG 0: 1
1: 0
2: 5
3: 24
4: 314
953311437_953311440 0 Left 953311437 3:41883948-41883970 CCCGTCTGTAAATGGAGAGAAAA 0: 1
1: 1
2: 9
3: 52
4: 471
Right 953311440 3:41883971-41883993 CAGGCTCTGAAAAGAAGAGTCGG 0: 1
1: 0
2: 5
3: 24
4: 314
953311432_953311440 30 Left 953311432 3:41883918-41883940 CCAGTAAACCAATTACGTGAGCA 0: 1
1: 0
2: 0
3: 3
4: 42
Right 953311440 3:41883971-41883993 CAGGCTCTGAAAAGAAGAGTCGG 0: 1
1: 0
2: 5
3: 24
4: 314
953311434_953311440 22 Left 953311434 3:41883926-41883948 CCAATTACGTGAGCAACCTTGGC 0: 1
1: 0
2: 0
3: 7
4: 41
Right 953311440 3:41883971-41883993 CAGGCTCTGAAAAGAAGAGTCGG 0: 1
1: 0
2: 5
3: 24
4: 314
953311438_953311440 -1 Left 953311438 3:41883949-41883971 CCGTCTGTAAATGGAGAGAAAAC 0: 1
1: 5
2: 6
3: 35
4: 399
Right 953311440 3:41883971-41883993 CAGGCTCTGAAAAGAAGAGTCGG 0: 1
1: 0
2: 5
3: 24
4: 314

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953311440 Original CRISPR CAGGCTCTGAAAAGAAGAGT CGG Intronic
900282624 1:1880913-1880935 CAGGCTACGAAGACAAGAGTGGG + Intronic
900706844 1:4086263-4086285 GAGGCTCTGAAGAGGAAAGTGGG + Intergenic
900866167 1:5270090-5270112 CAGGCTCTGAAAGATAGAGCTGG - Intergenic
903417628 1:23194871-23194893 CAGGCTCTAAAACGATCAGTGGG - Intergenic
903764533 1:25725656-25725678 CAGGCACTGAAAAGTTGAGGTGG - Intronic
904698622 1:32345089-32345111 CTGGGTTTTAAAAGAAGAGTAGG - Intergenic
905715332 1:40144685-40144707 TAGGCACTGAAAAATAGAGTGGG + Intergenic
906296641 1:44652772-44652794 CAGGTTTGGAAGAGAAGAGTGGG + Intronic
907598880 1:55746737-55746759 CAGGCTCAGAAGAAAAGAGCTGG - Intergenic
910940288 1:92525794-92525816 CAGGCTCTCATTAGAACAGTAGG + Intronic
911767570 1:101697034-101697056 CAGGCAAAGAAAAGAAGATTTGG + Intergenic
911903450 1:103533836-103533858 CAGGCTCTGAAAAAAAAAAAAGG + Exonic
912813942 1:112814196-112814218 CAGGCACTGTAAACAAGAGCAGG - Intergenic
912923238 1:113889554-113889576 CAGGCCATGAAAAGATGAGGAGG + Intergenic
915087651 1:153399006-153399028 CAGGTTCTAAAAAGCAGAGGTGG - Intergenic
915215675 1:154339230-154339252 CAGGGTGTGAAGAGGAGAGTTGG + Intronic
915370720 1:155347740-155347762 CAGTCTCTGAAAAGGAGAATGGG - Exonic
915532204 1:156509165-156509187 CAGGCCCAGAAAAGAAAAGAAGG - Intergenic
915555560 1:156658966-156658988 CAGGCTCTGAGGAGAGGAGAAGG + Intronic
915748621 1:158183762-158183784 CAGGCACTGAAAACAAGATGGGG + Intronic
917182158 1:172310578-172310600 CAGGCTCTTCAAAGAAGGGAGGG + Intronic
917390448 1:174530470-174530492 CAGGCTCTGAAACTAACAGAGGG - Intronic
917448997 1:175130896-175130918 CTGGCTCAGAAAACAAGACTTGG - Intronic
917711292 1:177688053-177688075 CAGGCTAAGAAAATTAGAGTGGG + Intergenic
917741347 1:177964500-177964522 CAGGCCCTGATGAGAAGGGTTGG + Intronic
919812743 1:201419454-201419476 CAGGCTGTGAAATGAAGGATGGG + Intronic
920524931 1:206659496-206659518 CAGGCCCTGTAAAGAAGAGCTGG - Intronic
923041118 1:230320459-230320481 CAGGCTCTGGAAAAAAAAGATGG - Intergenic
923075666 1:230606640-230606662 CCGGCGGTGTAAAGAAGAGTAGG - Intergenic
1063532005 10:6842335-6842357 CAGGTTCTAAAAACAAGACTCGG + Intergenic
1063714867 10:8516682-8516704 GAGACTCTGAAGAGGAGAGTAGG + Intergenic
1068563165 10:58540313-58540335 AAGGCTATGAAACTAAGAGTTGG + Intronic
1071287470 10:84162234-84162256 CAGGCCATGATAAGAAGAGGAGG + Intergenic
1071462810 10:85914479-85914501 CAGGCTCTGAAAACAGGAGGCGG + Intronic
1072008808 10:91285780-91285802 CAGGCTCTGTAGAGAGGAGCAGG - Intergenic
1073640640 10:105249372-105249394 TAGGCTCTCTAAAGAGGAGTTGG + Intronic
1074229136 10:111516433-111516455 CAGACTCTGAAACTAAGATTTGG + Intergenic
1074710958 10:116177151-116177173 CAGGCTCTGATAAGAAATGCAGG + Intronic
1074829639 10:117240025-117240047 CAGTCTCTTAGCAGAAGAGTGGG - Intergenic
1075197667 10:120375175-120375197 AAGAATCTGGAAAGAAGAGTTGG + Intergenic
1075983857 10:126766584-126766606 ACGGCTCTGAAAAGAGTAGTGGG - Intergenic
1077515897 11:3001931-3001953 CAAGTTCTGAATAGAAGAGAAGG + Intronic
1078669083 11:13349018-13349040 CTGGCTCTGAAAGGAAGAAAAGG - Intronic
1078897620 11:15611414-15611436 CAGGATCTGAACAGAAGTGCTGG - Intergenic
1079931827 11:26572996-26573018 TAAGCTCTGAAAGGAAGTGTAGG - Intronic
1080024655 11:27600773-27600795 CAGGCTCTGAACCCAACAGTTGG + Intergenic
1081047473 11:38294808-38294830 GAGGTCCTGAAAAGAAGTGTAGG + Intergenic
1082010727 11:47448280-47448302 CTGGGTCTGAAAAGAAGCTTTGG - Intronic
1082632963 11:55562277-55562299 CAGGTTTTCAGAAGAAGAGTAGG - Intergenic
1082638417 11:55625179-55625201 CAAGTTGTGTAAAGAAGAGTTGG - Intergenic
1082707445 11:56509709-56509731 GAGGCTCTGATACAAAGAGTAGG - Intergenic
1082740995 11:56911069-56911091 CAGGCCCTGAGGAGAAGAGCGGG - Intergenic
1082797883 11:57391176-57391198 ATGGCTATGAAAAGAAGAGCTGG + Intronic
1084585577 11:70059848-70059870 CAGGTTTTCAGAAGAAGAGTAGG + Intergenic
1084978962 11:72818478-72818500 CAAGCTCAGAAAAGAAGGCTCGG - Intronic
1085310019 11:75510663-75510685 GAGGCTCTGCGAAGAAGAGATGG - Intronic
1085453642 11:76654012-76654034 CTGGCTCTGCAAGGAAGGGTAGG - Intergenic
1085485415 11:76859685-76859707 CTGGATTTTAAAAGAAGAGTGGG + Intergenic
1085682721 11:78593330-78593352 CAGGCTTTGTTAAGAAGAGCTGG + Intergenic
1085804923 11:79626784-79626806 CAGGCCCTAAAAAGAAGAAAAGG - Intergenic
1086042488 11:82495722-82495744 CAGCCTCTGCACAGAATAGTGGG + Intergenic
1087312773 11:96568980-96569002 TAGGTTCTGAAAGGAACAGTAGG + Intergenic
1088050572 11:105509501-105509523 CAGGGTAGGAAAAGAAGGGTGGG - Intergenic
1088977697 11:114830424-114830446 CAGGCTATGAGAAGAGGAGATGG + Intergenic
1089397308 11:118144905-118144927 CAGGCTCTGAAAAGAATACTGGG + Intronic
1089875626 11:121718835-121718857 CTGGCTATTGAAAGAAGAGTGGG - Intergenic
1090583327 11:128183460-128183482 CAGTCTGTCAATAGAAGAGTAGG - Intergenic
1091180692 11:133601727-133601749 CTGGCTTTTAAAGGAAGAGTAGG + Intergenic
1094425002 12:30308180-30308202 CAGGCTATGACAGGAAGTGTGGG - Intergenic
1096073989 12:48790403-48790425 CAGGCAAGGAAAAGAAGAGTTGG + Intergenic
1096582629 12:52597994-52598016 CAGGGTCTGGAAAGAACAGGGGG - Intronic
1097659166 12:62409191-62409213 CAGGCTCCCAAAAGTAGAGCTGG - Intronic
1097801635 12:63920853-63920875 AAGACCTTGAAAAGAAGAGTAGG + Intronic
1099452358 12:82822899-82822921 CAGGCTGTGAAGAGATGAGGAGG - Intronic
1100657361 12:96661152-96661174 CAACCTCTGCAAAGAAGAGAGGG - Intronic
1100814902 12:98377220-98377242 CATGTTCTGAAGAGAAGAATTGG - Intergenic
1102656724 12:114488215-114488237 CATGCTGTGAAAAGAACACTTGG + Intergenic
1103172449 12:118833334-118833356 CAGACTCTGAAACAAAGATTTGG - Intergenic
1103825374 12:123733604-123733626 CAGACTCTGAAAAGGACACTTGG + Intronic
1104321504 12:127755833-127755855 CAGCCTCTGAAAAAAAAAATGGG + Intergenic
1104748160 12:131222835-131222857 CAGGTTCTGACAACAGGAGTGGG + Intergenic
1105501581 13:20977454-20977476 CAGGTGCTGAAAAGGAGAGTGGG + Intronic
1109561631 13:64057187-64057209 CAGGCCCAGAAAACAAGAGAAGG - Intergenic
1110297010 13:73879251-73879273 CAGTCTGTGAAAAGAAGAACCGG - Intronic
1110408096 13:75173490-75173512 CAGGCTTTGAAAAGACTGGTTGG + Intergenic
1111134292 13:84020240-84020262 CAGGCTGTGGAAAAAATAGTAGG + Intergenic
1112265397 13:97919177-97919199 CAGGCTCTGAAAAAAAAAATGGG + Intergenic
1115339134 14:32273280-32273302 GAGGCTCTGAAGAGAACAGCTGG + Intergenic
1115909140 14:38236137-38236159 CAAGTTCTAAAAAGAAAAGTGGG + Intergenic
1117302139 14:54440754-54440776 CAAGTGCTGAAAAGTAGAGTTGG + Intronic
1117850641 14:59965353-59965375 AAGGCTCTGAAGAGAAGCTTGGG - Intronic
1118040038 14:61906530-61906552 CAGGCCATGAAAATAAGAGAAGG - Intergenic
1119122721 14:72094422-72094444 TTGTCTCTGAAAAGAAAAGTGGG - Intronic
1119762179 14:77159365-77159387 CAGGGTCAGAAAAGGAGATTTGG - Intronic
1120335038 14:83143884-83143906 CAGGCTCTTAAAAAAAGTCTTGG + Intergenic
1120860989 14:89254801-89254823 CTGGGTCTGAAAAGGTGAGTAGG - Intronic
1121629135 14:95409854-95409876 GAGGCTTTGAAAAGGAAAGTGGG - Intronic
1122722126 14:103728079-103728101 CCGCCTCTGAAAAGAAGGGAAGG - Intronic
1123900714 15:24873745-24873767 CAGACCATAAAAAGAAGAGTTGG - Intronic
1124642126 15:31402266-31402288 CAGCCTCTGAAAGGAAGATGAGG + Intronic
1124689280 15:31808431-31808453 CAGGCTCTGGAAAGAGGAGAAGG + Intronic
1124992815 15:34692664-34692686 CAGGCGCTGAAAAGAAAGGTAGG - Intergenic
1127300534 15:57648880-57648902 CTGCCTCTGAGAAGAAGAGAGGG - Intronic
1128093159 15:64932782-64932804 CTGGCTTTGAAAAGAAAAGTAGG + Intronic
1128758680 15:70199972-70199994 AAGGCTCTGAAACCAAGAGAAGG + Intergenic
1129140421 15:73592911-73592933 CCAGCTCTTAAAAAAAGAGTGGG - Intronic
1131315351 15:91331243-91331265 CAGGCTCTGAAAATTCAAGTAGG - Intergenic
1132021212 15:98364180-98364202 CAAGCTCTCAAAGGAAGAGGCGG - Intergenic
1132207755 15:99998191-99998213 CAGGCTCTGGAAAGCAGGGAGGG - Intronic
1133916705 16:10115563-10115585 TGGGCTCTGATAAGTAGAGTGGG - Intronic
1134139856 16:11708855-11708877 CTGACTTTGGAAAGAAGAGTGGG - Intronic
1134247865 16:12553343-12553365 CAAGCTCTGAGAAGACGAGCTGG - Intronic
1135065544 16:19306629-19306651 CCAGCTCTGAAAAGAAGAAAAGG - Intronic
1135107970 16:19667431-19667453 CAGGCTTAGAAAATAAGTGTTGG + Intronic
1137275945 16:46933536-46933558 CAGTCTCTTAAAAAAAAAGTGGG + Intergenic
1138271934 16:55701846-55701868 CAGTCTCTGAAAGGAAGAGAAGG - Exonic
1139838385 16:69858649-69858671 AAGGATTTGAAAAGAACAGTCGG - Intronic
1141641269 16:85342956-85342978 CAGGCTCTGAAGATAGGAGGGGG + Intergenic
1143123154 17:4622208-4622230 CAGGGACTAACAAGAAGAGTGGG - Intergenic
1143617905 17:8064425-8064447 CCGGCTCTGACAAGAGGATTAGG + Intergenic
1144051234 17:11498807-11498829 CAGGCTCAGAGAAGGATAGTAGG - Intronic
1144310621 17:14010925-14010947 AAGGCTGTGAACAGAAGAATGGG + Intergenic
1144535210 17:16082185-16082207 CAAGCTCTGAAAAGAAAAGTGGG + Intronic
1145738946 17:27255917-27255939 CAGGCCCTGGGAAGAAGAGTGGG + Intergenic
1146138503 17:30344302-30344324 CATGCTATGAAAAGGAGAGTGGG + Intergenic
1146821377 17:35985790-35985812 CAGTTTCTGAAAAGGAGAGTAGG + Exonic
1147137350 17:38441959-38441981 CAGGCTCAAAAAAAAGGAGTGGG - Intronic
1148957402 17:51365159-51365181 GGGGCTCTGAAAATCAGAGTGGG + Intergenic
1148963337 17:51411902-51411924 CAGGCTATGAAAAGATTTGTAGG + Intergenic
1149320022 17:55473014-55473036 CAGGTTTTCAGAAGAAGAGTAGG - Intergenic
1150862328 17:68813621-68813643 CAGGGTCTGGGAGGAAGAGTGGG + Intergenic
1152119843 17:78411695-78411717 CAGGCCCTGGGATGAAGAGTCGG + Intronic
1153541349 18:6159250-6159272 CCGTCTCTGAACAGAAAAGTGGG - Intronic
1153812246 18:8762490-8762512 GAGGCTCTCAAATGAACAGTCGG + Intronic
1155038872 18:22048169-22048191 CTGGCACTGAAATGAACAGTTGG - Intergenic
1155060795 18:22226767-22226789 AAGGCACTGAGAAGGAGAGTGGG - Intergenic
1156744735 18:40375596-40375618 CAGGCTCTGAAACAAATTGTTGG - Intergenic
1157201721 18:45665056-45665078 AAAGCTTTGAAAGGAAGAGTAGG - Intronic
1157717034 18:49894898-49894920 CAGGCGCTGGCAAGCAGAGTGGG - Intronic
1158240855 18:55376504-55376526 CATGTTATGAAAAGAAGAATTGG - Intronic
1158306129 18:56107671-56107693 AAGGCTCTGGAAACAACAGTGGG + Intergenic
1159113369 18:64085794-64085816 CAGGCTCATAAAAGAAGACATGG + Intergenic
1161358332 19:3832047-3832069 CGGGCTCTGGAAAGGAGAGGTGG - Intronic
1161587830 19:5115068-5115090 CAGGCTTTGAAAAGCAGGGAAGG + Intronic
1163969045 19:20774778-20774800 CAGGATTTGAAAACAAAAGTGGG - Intronic
1167387240 19:49171234-49171256 GAGCCTCTGAACAGAAGATTAGG + Intronic
1168468210 19:56620934-56620956 CAGGCTCTGCAAACCTGAGTAGG - Intronic
1168708124 19:58481093-58481115 CAGCCTCTGCACAGACGAGTGGG - Exonic
925538711 2:4943105-4943127 CAAGCTCAGAAAAGAAGTCTGGG + Intergenic
925709477 2:6724862-6724884 AAGGAGCTGAAAAGAAAAGTGGG - Intergenic
927866027 2:26588228-26588250 CAGTCTCTGCATAGAAGAGCTGG - Intronic
928594446 2:32846658-32846680 AAGGCTATGAAAGAAAGAGTAGG + Intergenic
928728369 2:34202339-34202361 CAGGCTCTGAAAAGCACAATCGG + Intergenic
929021100 2:37554142-37554164 CAGGCACTGAAAAAAACTGTTGG - Intergenic
929215639 2:39408913-39408935 CAGGCACTGAAACTAACAGTGGG + Intronic
929236918 2:39615395-39615417 CAGACTCTACAATGAAGAGTTGG + Intergenic
929341939 2:40830358-40830380 CAGTATCTGAAAAGAGGAATTGG - Intergenic
929935889 2:46294467-46294489 CAGGCTCTAAAAAGTAAAATTGG + Intronic
931052802 2:58432677-58432699 CAGGCTGTGAAAAACAAAGTGGG + Intergenic
931242368 2:60464785-60464807 CTGGCTCTGAAAAAAAGTTTAGG - Intronic
933590884 2:84231071-84231093 CAGGCTCTGAACTGAACAATCGG - Intergenic
938314773 2:130317982-130318004 CAGGCACTGAAAAGAAATGTGGG + Intergenic
939247533 2:139645122-139645144 CAGGCTCTGCACAGAAGAGTGGG + Intergenic
940804814 2:158175013-158175035 CAGGCGCTGAAAAGCATAGTAGG - Intronic
941077727 2:161025034-161025056 CCAGCTGTGTAAAGAAGAGTTGG + Intergenic
943091566 2:183381663-183381685 CTGGCTGTGAAAAGAAGATCTGG + Intergenic
943238506 2:185354055-185354077 CAGGCTCAGAAAATAGGGGTTGG + Intergenic
944186060 2:196950041-196950063 CAGCATCTTAAAAGATGAGTGGG - Intergenic
944993312 2:205263168-205263190 AAGGCTCTGAAATAAATAGTTGG - Intronic
945795776 2:214361712-214361734 CAGGAGCTAAAAAGAAAAGTGGG - Intronic
946111783 2:217426223-217426245 CAGACTCTTAAAAGATGAGGGGG - Intronic
947097372 2:226581361-226581383 AAAGGTCTGAAAAGATGAGTAGG + Intergenic
1170092309 20:12604120-12604142 CTGCCTCTCAAAAGCAGAGTAGG + Intergenic
1170414092 20:16121715-16121737 CAGGCAGTGAAAAGGAGATTAGG + Intergenic
1171134472 20:22684390-22684412 AGGGCTCTGAAAAGATGAGGAGG - Intergenic
1171349605 20:24492511-24492533 CAGCCTCTGAAGAAAAGAGAAGG - Intronic
1171354629 20:24534424-24534446 GAGGTTCAGAAAAGAAGAGAGGG - Intronic
1172532586 20:35643359-35643381 CAGGCTCTCAAAAGCAGGATAGG + Intronic
1172896609 20:38304657-38304679 CTGGCTTTGGAAAGAAGAGAAGG - Intronic
1173396453 20:42684648-42684670 CAGACTCTGAAGAGCACAGTGGG + Intronic
1173410694 20:42807073-42807095 CAGGATGTGAAAAGAAAGGTGGG + Intronic
1174620206 20:51868320-51868342 AAGGCTCTGAAGACCAGAGTGGG - Intergenic
1174877828 20:54246729-54246751 CAGGCTCTGAATAGAACAAAAGG - Intergenic
1175433318 20:58923222-58923244 CAGGCTCTCAAAAGAATTCTTGG - Intergenic
1175459651 20:59142752-59142774 TAGGCACTGAAAATATGAGTAGG - Intergenic
1177062687 21:16394617-16394639 CAGGTTTTCAGAAGAAGAGTAGG + Intergenic
1177997974 21:28126669-28126691 CAGAGGCTGAAAAGAATAGTGGG - Intergenic
1178803679 21:35820371-35820393 CAGGCTCTCAACAGATGAGATGG - Intronic
1179167804 21:38948158-38948180 CAGGATCTCAAAAGAAAAGGTGG + Intergenic
1179176560 21:39011971-39011993 CAGGTTCTGAGAAGCAGTGTGGG + Intergenic
1181492420 22:23268886-23268908 CAGGCTAGAAAAGGAAGAGTGGG - Intronic
1182546456 22:31079520-31079542 CAGGCCCTGAAAATCAGAGGTGG + Intronic
1184165416 22:42724361-42724383 CAGGCTCTGAGAGGAAGGGAAGG + Intergenic
1184306602 22:43607147-43607169 CAGGGTCAGAAAGGAAGGGTAGG - Intronic
950650717 3:14404945-14404967 CAGACTCTGAAAAGCAGATGTGG - Intronic
951109890 3:18790546-18790568 CATGCTTAGAAAAGAAGAGAAGG - Intergenic
951597481 3:24333985-24334007 CAGGCTCTAAAACGCAGAATTGG + Intronic
953033578 3:39193028-39193050 CAGGCTCAGAACAGAGGAGGAGG - Intergenic
953311440 3:41883971-41883993 CAGGCTCTGAAAAGAAGAGTCGG + Intronic
954689810 3:52389666-52389688 CAGGCCCTGGAAAGCAGGGTAGG - Intronic
955325636 3:58008022-58008044 CAGGCTCTGAGAAGAATGGCTGG + Intergenic
955842298 3:63125239-63125261 CAGACACAAAAAAGAAGAGTTGG + Intergenic
955894219 3:63682134-63682156 CAGCCTTTGAAATGAAAAGTAGG + Intergenic
957169579 3:76720766-76720788 CAGGCTTTGCAAAAGAGAGTGGG - Intronic
957819670 3:85355260-85355282 CCAGCTCTGAAAACAAGAGACGG - Intronic
961921334 3:130429554-130429576 CAAGCTGTGAAAAGGAGAGAGGG - Intronic
964139450 3:153379968-153379990 CTGGCTCAGAAAAGAGGAGCAGG + Intergenic
966873511 3:184307873-184307895 CAGGCCCTGAAAAAAACAGAGGG - Exonic
966986740 3:185187389-185187411 CAGGCCCTGGAATGAAGAGCAGG - Intergenic
967322622 3:188209631-188209653 CAGGATCTGAGAACAGGAGTGGG + Intronic
967594152 3:191310784-191310806 CAATCTCTGTAAAAAAGAGTTGG - Intronic
970276228 4:14404094-14404116 CAGGCCATGAAGAGAAGAGGAGG - Intergenic
970349756 4:15190426-15190448 CATGTTCTCAGAAGAAGAGTGGG + Intergenic
970795479 4:19907444-19907466 CCAGCACTGACAAGAAGAGTTGG + Intergenic
970813446 4:20124632-20124654 CAGGCTTTGGAGAGAAGAGCTGG - Intergenic
971551089 4:27956282-27956304 CAGCCTCTGAAAGGTAGAGAAGG + Intergenic
972223978 4:36990501-36990523 AAATCTCTGAAAAGCAGAGTAGG + Intergenic
974594966 4:64002520-64002542 CTGGATCTGAAAAGAAAAGAAGG + Intergenic
976164558 4:82240410-82240432 CAGACCCTGGAAAGAAGAGAGGG + Intergenic
976309442 4:83596008-83596030 CCAGCTCTGGAGAGAAGAGTTGG + Intronic
976488524 4:85639430-85639452 CAGGCAAAGAAAAGAAGAATAGG + Intronic
976724930 4:88206555-88206577 CTGTCTTAGAAAAGAAGAGTGGG - Intronic
977283753 4:95075230-95075252 CAGACTCTGAGAAGAACAGATGG - Intronic
977310345 4:95378883-95378905 CAAGCTTTGCAAAGAAGACTTGG - Intronic
977764283 4:100778301-100778323 CAGTCTCTGCACAGAAGGGTGGG + Intronic
977900590 4:102417890-102417912 CAGGCTTGGAAAGGAAGACTAGG - Intronic
978665293 4:111174789-111174811 CAGGTTCTCAAAAGAAGAGTAGG - Intergenic
979119232 4:116873398-116873420 AAGCCTCAGAAAAAAAGAGTAGG + Intergenic
980157580 4:129126060-129126082 CTGGCTCTGAAAAGAACAGTGGG - Intergenic
980651974 4:135728368-135728390 CTGGCTCTGAAGAAAAGAGAGGG + Intergenic
981331258 4:143513349-143513371 CCGGCTCGGGAGAGAAGAGTGGG - Intergenic
981952784 4:150430451-150430473 CAGCGTCTGAAATGAAGAGAAGG - Intronic
986850189 5:11802946-11802968 CAGATTGTGAAAAGAAGAGAGGG + Intronic
987049890 5:14140476-14140498 CAGTCTCAGAAAACAAGACTAGG - Intergenic
987159022 5:15120749-15120771 CTGGCTTTGGAAAGAAGAGACGG + Intergenic
987656588 5:20815230-20815252 CCGGCTCTGAAGAGAGCAGTGGG + Intergenic
988291301 5:29291375-29291397 CCACCTCTGAAGAGAAGAGTAGG - Intergenic
988766965 5:34388715-34388737 CCGGCTCTGAAGAGAGCAGTGGG - Intergenic
990874148 5:60465565-60465587 CAAGCTTTTAAAAAAAGAGTGGG + Intronic
991012329 5:61897096-61897118 AATGCTATTAAAAGAAGAGTAGG - Intergenic
991465300 5:66906255-66906277 CAGGCCATGATAAGAAGAGAGGG - Intronic
991517906 5:67459816-67459838 GAGGGTTTGATAAGAAGAGTAGG - Intergenic
993172128 5:84431991-84432013 CAGACTCTGAAAAAAGCAGTGGG - Intergenic
993652662 5:90541273-90541295 CATGGTCTGAAGAAAAGAGTGGG + Intronic
994038974 5:95236429-95236451 CAGGATCTGAAAAGAAAACTGGG - Intronic
994595508 5:101827812-101827834 CCAGCTCTGAAAGGAAGAGAAGG - Intergenic
995956155 5:117778896-117778918 CATGCTACCAAAAGAAGAGTGGG - Intergenic
996161206 5:120167915-120167937 CAGGCCATGAAAAGACAAGTAGG - Intergenic
997021059 5:130002242-130002264 CAGGATCAAAAAAGAAGAGAAGG + Intronic
997588735 5:135060215-135060237 CAGGCTCTGCTATGGAGAGTGGG + Intronic
998197447 5:140087081-140087103 CAGACTGTGAGAAGAAGAGAGGG + Intergenic
998959296 5:147467605-147467627 GAGGTACTGAAAAGAAGACTTGG - Intronic
999666129 5:153915746-153915768 TAGACTCTAAAAAAAAGAGTGGG - Intergenic
1000553809 5:162698404-162698426 CAGGCTCTGAGGAGGAAAGTGGG + Intergenic
1001119492 5:168968029-168968051 CAGGCCTTGGAAAGGAGAGTGGG + Intronic
1002154334 5:177264678-177264700 CAAGCTCTTAAAATAAGAGTGGG - Intronic
1002899155 6:1396265-1396287 CAGGCTCTGAATTGGAGGGTGGG - Intergenic
1005134319 6:22550066-22550088 CAGACTTTGAAAAGAGTAGTTGG + Intergenic
1005443823 6:25900124-25900146 CAGGGTCTGAATAGAAGAAAAGG - Intergenic
1005875662 6:30008172-30008194 GGGGGTCTGAAAGGAAGAGTCGG - Intergenic
1006428650 6:33981933-33981955 CAGGCTCAGAGAGGAAGAGATGG - Intergenic
1006465623 6:34192566-34192588 CAGGCTTTTCAAAGAAGAGGAGG + Intergenic
1006623136 6:35381110-35381132 AAGTCTCTGAAAAGAAGATGAGG - Intronic
1007377019 6:41464009-41464031 CAGACTCTGAAAAGTATAGCAGG + Intergenic
1007929450 6:45677231-45677253 CAGACTCTGAAATGCAGAATTGG + Intergenic
1008484669 6:52023034-52023056 GAGGATGTGAAAAGAAGAATGGG - Intronic
1010095402 6:72037295-72037317 CAGGCATTAAAAAAAAGAGTTGG + Intronic
1010183003 6:73109754-73109776 CAGTCACTGAAAAGGAGAGATGG + Intronic
1010455256 6:76047282-76047304 CTGGCTCTTAAAAGAAAAGTAGG - Intronic
1010496642 6:76540546-76540568 CAGCCTCTGTAAAGAAAAGATGG - Intergenic
1012370804 6:98504445-98504467 CTTGCTATGAAAAAAAGAGTAGG - Intergenic
1013840194 6:114382513-114382535 CAGACTCTGGGAAGAACAGTTGG - Intergenic
1014242700 6:119035271-119035293 CAGGCTATGATAGGAAGAGGGGG + Intronic
1017067063 6:150538944-150538966 AAGGCTCTGGAAAACAGAGTTGG - Intergenic
1017801195 6:157897847-157897869 CATTCTCTGGAAAGAAAAGTGGG - Intronic
1019603046 7:1894846-1894868 GAGGCTGTGAAAAGAAGCCTAGG + Intronic
1019875856 7:3809934-3809956 CAGCCTCTGCAGAGAAGCGTTGG - Intronic
1020989612 7:15180586-15180608 AAGGCTCAGAAGAGCAGAGTAGG - Intergenic
1021369696 7:19828181-19828203 CAGGTTGTTAAAAGAAAAGTAGG + Intergenic
1023609915 7:41962243-41962265 CATGCTTTGAAAACAAGAGTTGG + Exonic
1023614244 7:42002980-42003002 CAGGCTCTGAAACTAATATTAGG - Intronic
1024241933 7:47442465-47442487 TAGGCTCTTTAAAAAAGAGTAGG - Intronic
1024544039 7:50502239-50502261 CAGCCTCTACAAAGAAGAGGGGG + Intronic
1026497092 7:70912689-70912711 CACGCCTTGAAAAGAAGATTTGG - Intergenic
1026565561 7:71487187-71487209 CAAGCTCTGAAATGGAGATTTGG - Intronic
1026647226 7:72182264-72182286 CATGCTCTGAAAAAAAAAGCTGG + Intronic
1027620678 7:80481357-80481379 CAGGCTGTGATAGGAAGGGTGGG + Intronic
1028445074 7:90912977-90912999 CAGGCACTAAAAAGAAAAGAAGG - Intronic
1028781771 7:94745431-94745453 CAGGCTCTTTGAAGAAGTGTTGG - Intergenic
1030288080 7:107847340-107847362 AAAACTGTGAAAAGAAGAGTGGG + Intergenic
1032672522 7:134098483-134098505 CAGGCTGTGAAAAGAAAGCTAGG + Intergenic
1034068306 7:148157976-148157998 CAGGTTCAGAAAAGAATAGAGGG - Intronic
1034489795 7:151387126-151387148 CAGGCTCTAATAAGAGGAGTGGG + Intronic
1035545880 8:482202-482224 CAGACTCTGCAAGGAAGAGTGGG + Intergenic
1035743839 8:1947560-1947582 CAGGCTATGAAAAGCAAAGCAGG + Intronic
1037092050 8:14932442-14932464 CAGGCTCTATAAAGTAAAGTTGG + Intronic
1037118759 8:15257728-15257750 GAGGCCCATAAAAGAAGAGTTGG - Intergenic
1038698655 8:29828961-29828983 CAGGTTCTTGAAAGATGAGTTGG - Intergenic
1040859569 8:51984874-51984896 CAGACTCTGAAAAAAGGAGTAGG - Intergenic
1043105211 8:76100943-76100965 CAGGATTAGAAAAGGAGAGTAGG - Intergenic
1043669747 8:82868044-82868066 CAGGGTTTGAAAAGATGAGGAGG + Intergenic
1043721166 8:83548006-83548028 CAGGTTTTCAGAAGAAGAGTAGG - Intergenic
1044607245 8:94058125-94058147 CAGGGTCTGAACAGAGGAGGGGG - Intergenic
1044836867 8:96304126-96304148 TACTCTCTGAAAAGAAGATTTGG - Exonic
1044871654 8:96625855-96625877 CAGTCATTGAAAAGAAGAGGGGG - Intergenic
1045570623 8:103365683-103365705 CAGTCTCTGGAAAGGAGAGCAGG - Intergenic
1046061619 8:109146431-109146453 GAAGCTCTGAGATGAAGAGTTGG - Intergenic
1046840288 8:118848952-118848974 CAGGCTCTGAAGTGAAGCCTTGG + Intergenic
1046867385 8:119165490-119165512 CAGGCTACGACAGGAAGAGTGGG - Intronic
1046969480 8:120205537-120205559 CAGACTCTTGAAAGAAGACTTGG - Intronic
1048371171 8:133777448-133777470 CAGGCTCTGTAAAGAGCAATTGG + Intergenic
1048642892 8:136384146-136384168 TAGGCAGAGAAAAGAAGAGTTGG - Intergenic
1050140849 9:2514310-2514332 CAGGTTTTCAGAAGAAGAGTAGG - Intergenic
1050201632 9:3151187-3151209 CAGTCACTGGAAAGGAGAGTGGG + Intergenic
1055135826 9:72827716-72827738 CAGGGACTGAAAGGAAGAGATGG - Intronic
1056869968 9:90268121-90268143 AAGGCCCTGGAAAGGAGAGTGGG - Intergenic
1058703030 9:107616317-107616339 TAGGCACTGAAAAGATGATTGGG - Intergenic
1058990015 9:110246499-110246521 CAGGCACTCAAAAGAGGACTGGG + Intronic
1060429729 9:123540395-123540417 CAGGCACTGAAGAAAAGAGATGG - Intronic
1060891562 9:127192482-127192504 CAGGCTCAGAAAAGAGGTCTGGG + Intronic
1061622073 9:131817240-131817262 CAGGCTCTGCACAGCAAAGTCGG - Intergenic
1186600233 X:11028860-11028882 CAGGCGCTAAAAAGAAGGCTGGG + Intergenic
1187747760 X:22428289-22428311 CAGGATTAGAAAAAAAGAGTTGG - Intergenic
1189860302 X:45264636-45264658 CAGCCTCTGGAATGAAGATTTGG - Intergenic
1189895169 X:45647948-45647970 CAGGCTATGAAACAAAGACTTGG + Intergenic
1192159222 X:68770242-68770264 CCTGGTCTCAAAAGAAGAGTAGG - Intergenic
1192598607 X:72437943-72437965 CTGGCTCTGAACAGAGCAGTGGG + Intronic
1192936793 X:75868994-75869016 CAGGCAAAGAAAAGAGGAGTAGG - Intergenic
1194065538 X:89256294-89256316 CAGTCTCTGAAAATTAGAGTAGG + Intergenic
1194221403 X:91197011-91197033 CAAGCTTTTAGAAGAAGAGTGGG + Intergenic
1194989420 X:100530072-100530094 CAGAGGCTGAAAAGAATAGTGGG - Intergenic
1196980584 X:121209253-121209275 CAGCCACAGAAAAGTAGAGTGGG - Intergenic
1196981437 X:121218171-121218193 CAGGTTCTCCAAAGCAGAGTTGG - Intergenic
1197008221 X:121529799-121529821 CAGATTCTGTAAAGCAGAGTAGG + Intergenic
1197995697 X:132370121-132370143 CAGGCACTGAACAGAAAAGCTGG + Intronic
1198018825 X:132638404-132638426 CAGTCTCATAAAAGAAGTGTGGG + Intronic
1198713625 X:139532703-139532725 CTGGGTCTTAAAAGATGAGTAGG + Intronic
1198799355 X:140433188-140433210 CAGACAATGGAAAGAAGAGTCGG - Intergenic
1199265456 X:145821689-145821711 CAGGAGCGGAAGAGAAGAGTTGG - Exonic
1200410107 Y:2852374-2852396 AAAGCTCTTAAAAGAAAAGTTGG - Intronic
1200557912 Y:4660765-4660787 CAAGCTTTTAGAAGAAGAGTGGG + Intergenic
1200742559 Y:6869933-6869955 TGGGCTCTGTAAAGAATAGTGGG - Intronic
1202093217 Y:21215814-21215836 CAGGCACTCAAAAGAGGAGAGGG - Intergenic
1202114355 Y:21456055-21456077 GAGGCTATGGAAAGAAGAATAGG - Intergenic