ID: 953311441

View in Genome Browser
Species Human (GRCh38)
Location 3:41883972-41883994
Sequence AGGCTCTGAAAAGAAGAGTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 3, 2: 1, 3: 19, 4: 268}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953311438_953311441 0 Left 953311438 3:41883949-41883971 CCGTCTGTAAATGGAGAGAAAAC 0: 1
1: 5
2: 6
3: 35
4: 399
Right 953311441 3:41883972-41883994 AGGCTCTGAAAAGAAGAGTCGGG 0: 1
1: 3
2: 1
3: 19
4: 268
953311436_953311441 7 Left 953311436 3:41883942-41883964 CCTTGGCCCGTCTGTAAATGGAG 0: 1
1: 0
2: 3
3: 4
4: 114
Right 953311441 3:41883972-41883994 AGGCTCTGAAAAGAAGAGTCGGG 0: 1
1: 3
2: 1
3: 19
4: 268
953311437_953311441 1 Left 953311437 3:41883948-41883970 CCCGTCTGTAAATGGAGAGAAAA 0: 1
1: 1
2: 9
3: 52
4: 471
Right 953311441 3:41883972-41883994 AGGCTCTGAAAAGAAGAGTCGGG 0: 1
1: 3
2: 1
3: 19
4: 268
953311434_953311441 23 Left 953311434 3:41883926-41883948 CCAATTACGTGAGCAACCTTGGC 0: 1
1: 0
2: 0
3: 7
4: 41
Right 953311441 3:41883972-41883994 AGGCTCTGAAAAGAAGAGTCGGG 0: 1
1: 3
2: 1
3: 19
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953311441 Original CRISPR AGGCTCTGAAAAGAAGAGTC GGG Intronic
900489942 1:2942823-2942845 AGGCCCTGACAGGAAGAGGCTGG + Intergenic
901536264 1:9884445-9884467 AGGATCTGAAAGGAAGACTCAGG + Intronic
902911131 1:19597832-19597854 AGGCCGTGAAATGGAGAGTCAGG + Intronic
903573492 1:24323020-24323042 AGCCTCTGAAAAGAAGACAGAGG + Intronic
905715333 1:40144686-40144708 AGGCACTGAAAAATAGAGTGGGG + Intergenic
905870155 1:41398953-41398975 AACCTCTGAACAGAAGAGACAGG - Intergenic
907269030 1:53279838-53279860 AGGCTCTGAAAGGGACAGTGAGG - Intronic
907552238 1:55314272-55314294 ATGCTCAGAAAAAAAGAGCCAGG - Intergenic
907558095 1:55362886-55362908 TGGCTCTGGAAAGGAGAGTGTGG - Intergenic
907897561 1:58706062-58706084 AGTCTCTGAAAAGCAGAGGGTGG + Intergenic
909418775 1:75438695-75438717 AGGCTCTGAACAAAAAAGCCTGG + Intronic
910217561 1:84857736-84857758 TGACTCTGAAAAGTAGAGTATGG + Intronic
910756983 1:90704606-90704628 AGGGTCTGGTAAGAAGTGTCAGG - Intergenic
913089629 1:115467873-115467895 AGGCTTTGGAAACAAAAGTCAGG - Intergenic
916169411 1:161989339-161989361 AGGAGCTGAAATGATGAGTCAGG + Intronic
916694782 1:167222811-167222833 AGGCTCTGAAAATAAAATACAGG - Intronic
916935875 1:169627798-169627820 AGGTAATGAAAAGAAGAGTAAGG + Intronic
919687069 1:200493663-200493685 AGGCTCTGAGAAGTGGAGTAAGG - Intergenic
921463267 1:215454408-215454430 TGGCTCTGAAAAGAATAATAAGG + Intergenic
921596162 1:217055750-217055772 ATGATCTGAAAAGGAGACTCTGG - Intronic
921924607 1:220700950-220700972 AGGCTCTGAACAGATGCATCTGG + Intergenic
922531529 1:226348996-226349018 GGGCTGTGAAGAGAACAGTCAGG + Intergenic
923465436 1:234244059-234244081 AGCCTCTGAACAGAAGAGTTTGG + Intronic
924021441 1:239788023-239788045 AGGCTCGGAAAAGACTAGCCTGG + Intronic
1063714868 10:8516683-8516705 AGACTCTGAAGAGGAGAGTAGGG + Intergenic
1067662673 10:48248058-48248080 AGGCTCTGAAAGGCAGAGAATGG - Intronic
1067690324 10:48497623-48497645 CAGCTCTGGAAAGAAGAGGCAGG + Intronic
1068463260 10:57354289-57354311 AGACTCTGAAAAGAAGCCACTGG - Intergenic
1071140070 10:82499094-82499116 ATGCCTTGAGAAGAAGAGTCTGG + Intronic
1073640641 10:105249373-105249395 AGGCTCTCTAAAGAGGAGTTGGG + Intronic
1074817387 10:117152754-117152776 TGGCTCAGAAATGAAGAGACAGG + Intergenic
1075336374 10:121611864-121611886 AGGCTCTGAGAATCAGAGCCAGG - Intergenic
1075836609 10:125459019-125459041 AGGCTCTCAAAAGAAGAACATGG - Intergenic
1076705033 10:132296894-132296916 CGGCTCTGGAAAGGAGTGTCAGG + Intronic
1076785295 10:132746680-132746702 AGGCTCTGGAAAGAGTGGTCCGG - Intronic
1077574858 11:3375153-3375175 AGACTCAGAGAAGGAGAGTCTGG + Intronic
1078648123 11:13161171-13161193 TGACCCTGGAAAGAAGAGTCTGG - Intergenic
1078798164 11:14615005-14615027 TGGGTCTGAAAAGAAAAGTTAGG - Intronic
1078885348 11:15494398-15494420 AGGCAAAAAAAAGAAGAGTCAGG + Intergenic
1080581900 11:33651190-33651212 AAACTCTGATAAGAATAGTCAGG + Intronic
1081047474 11:38294809-38294831 AGGTCCTGAAAAGAAGTGTAGGG + Intergenic
1081673047 11:44952144-44952166 AGGCACTAAAAGGCAGAGTCAGG - Intergenic
1082175540 11:49054659-49054681 AGTTTCTGAAAAGAATACTCTGG + Intronic
1084029792 11:66474571-66474593 ACGCTCTGGAAAGAAAAGCCAGG - Intronic
1084273788 11:68041891-68041913 TTGATCTGAAAGGAAGAGTCTGG + Intronic
1084522677 11:69674152-69674174 AGACTTTGAAAAGTAGATTCCGG - Intronic
1084584461 11:70049316-70049338 TGGCTGTGAACAGCAGAGTCAGG - Intergenic
1085310018 11:75510662-75510684 AGGCTCTGCGAAGAAGAGATGGG - Intronic
1085567996 11:77532188-77532210 ATGCACTGTAAAGAAGAGTTTGG - Intronic
1085960119 11:81451991-81452013 AAGCTGTGAAAAGAACACTCTGG - Intergenic
1086058583 11:82676804-82676826 TGGCTATGAAAAGAAGTTTCAGG - Intergenic
1086362325 11:86071531-86071553 AGGATCTGAATTGGAGAGTCAGG - Intergenic
1086690210 11:89781408-89781430 AGTTTCTGAAAAGAATATTCTGG - Intergenic
1086698449 11:89871566-89871588 AGTTTCTGAAAAGAATATTCTGG + Intronic
1086707715 11:89972921-89972943 AGTTTCTGAAAAGAATATTCTGG - Intronic
1086715644 11:90058549-90058571 AGTTTCTGAAAAGAATATTCTGG + Intergenic
1087312774 11:96568981-96569003 AGGTTCTGAAAGGAACAGTAGGG + Intergenic
1088144001 11:106652484-106652506 AGGCTTTGAATAGCAGGGTCAGG + Intergenic
1091744392 12:2982013-2982035 AGGCTCTGAAAGGAGGGCTCTGG + Intronic
1092281262 12:7099522-7099544 AGGCCCAGAAAAGAACAGGCAGG - Intronic
1094371108 12:29738404-29738426 AAGCTCTAAAACTAAGAGTCTGG + Intronic
1096073990 12:48790404-48790426 AGGCAAGGAAAAGAAGAGTTGGG + Intergenic
1096701296 12:53384736-53384758 AGGCACTGAGAAGACGAGGCAGG + Intronic
1096737781 12:53669337-53669359 AGGCTCTGTGAAAAAGAGGCAGG + Exonic
1097762055 12:63477686-63477708 AGGCTCTGAAAAGTAGATGATGG + Intergenic
1097801636 12:63920854-63920876 AGACCTTGAAAAGAAGAGTAGGG + Intronic
1098152836 12:67565595-67565617 AGGCTATGAGAAGAAGGATCTGG + Intergenic
1099420591 12:82454286-82454308 AGGATCTGAAAGGAGGAGTTTGG + Intronic
1099661607 12:85570131-85570153 AGCCTCTTAAAAGAAGAACCAGG - Intergenic
1101410662 12:104465282-104465304 GGGCTCTGAAAATAAGTGCCAGG - Intronic
1102021322 12:109685328-109685350 AGACTATGAAAAGCAGAGACAGG - Intergenic
1103250178 12:119493105-119493127 AGACTCAGAAAAGCACAGTCAGG - Intronic
1103839909 12:123854369-123854391 AGGCTCTACGAAGAAGAGTGAGG + Intronic
1104090477 12:125512699-125512721 ATGCTCTGAAAAGACCAGGCAGG - Intronic
1105501582 13:20977455-20977477 AGGTGCTGAAAAGGAGAGTGGGG + Intronic
1106458558 13:29948600-29948622 AGGAAGTGAAAGGAAGAGTCTGG + Intergenic
1106505932 13:30370487-30370509 AGACACTGAGAAGAAGAATCAGG - Intergenic
1106917670 13:34532380-34532402 AGGCTCTAAAAAGTAGTGTATGG + Intergenic
1107341219 13:39408660-39408682 AGCCTTTGAAAATAAAAGTCAGG + Intronic
1107473591 13:40713605-40713627 AGGCCAAGATAAGAAGAGTCCGG - Intergenic
1110209646 13:72956522-72956544 AGGCTCTGAGAAGAAAATGCTGG - Intronic
1110740167 13:78985652-78985674 AGGCTCTGAAACAGAGACTCAGG + Intergenic
1111177988 13:84623332-84623354 AGACTCTGAAAACAAGAAACTGG - Intergenic
1112915081 13:104538330-104538352 AGGCTTTGAATTCAAGAGTCCGG - Intergenic
1117154931 14:52929391-52929413 AAGCGCTGAAAAGATGACTCTGG - Intronic
1117850640 14:59965352-59965374 AGGCTCTGAAGAGAAGCTTGGGG - Intronic
1118840419 14:69505824-69505846 CGGCTCTGGGAAGATGAGTCAGG - Intronic
1119122720 14:72094421-72094443 TGTCTCTGAAAAGAAAAGTGGGG - Intronic
1119552625 14:75525918-75525940 ATGCTCTGAAAAGAGGAATCTGG - Intronic
1119567704 14:75642390-75642412 GGGCTCTGAAAGGACAAGTCAGG + Intronic
1121007883 14:90501910-90501932 AGGCTCAGCTAAGGAGAGTCTGG - Intergenic
1124487063 15:30127643-30127665 AGGCTCTGAAGAGAAGAGTCAGG - Intergenic
1124542148 15:30596618-30596640 AGGCTCTGAAGAGAAGAGTCAGG - Intergenic
1124756462 15:32410680-32410702 AGGCTCTGAAGAGAAGAGTCAGG + Intergenic
1124992814 15:34692663-34692685 AGGCGCTGAAAAGAAAGGTAGGG - Intergenic
1125130157 15:36275224-36275246 AGGCTGGGAAAAGAAGAGGTTGG - Intergenic
1125731221 15:41893738-41893760 GGGCTCTGAGAAGAAGAATCTGG - Intronic
1125921036 15:43526099-43526121 AGTCTCAGAAAAGAAGGATCAGG + Exonic
1127891516 15:63255889-63255911 AGCCTTTAAAAAGAAGAGCCAGG + Intronic
1128479861 15:68027903-68027925 ATCCTCTGAAGAGAGGAGTCTGG - Intergenic
1128723972 15:69974299-69974321 AGGCTGTCCAAAGAAGATTCAGG + Intergenic
1129324223 15:74791245-74791267 AGGCTGTGAAAAAAAAAGCCAGG - Intronic
1129714774 15:77840587-77840609 AGCCTTTGAAAAGAAGAGAAAGG - Intergenic
1131994393 15:98120146-98120168 AGGCTTTGAGATGGAGAGTCAGG + Intergenic
1132593570 16:737691-737713 GGGCTCTGAAAGGAGGAGGCGGG + Intronic
1132860191 16:2066960-2066982 AGGCTTTGAAAAGTAGAGGCAGG - Intronic
1133045775 16:3087551-3087573 AGGCTCTGCAGAGAGAAGTCCGG - Intergenic
1133313628 16:4868022-4868044 AGTCTCTGGAAAGGAGATTCAGG - Intronic
1133555255 16:6900550-6900572 AGGCTCTGAAATAATGAGTAAGG - Intronic
1134680824 16:16124084-16124106 ACACTTTGAAATGAAGAGTCTGG + Intronic
1134899642 16:17925690-17925712 AGCCACTGTAAAGAAGAGTTTGG - Intergenic
1135043348 16:19134925-19134947 AGGCTCAGAGAAAATGAGTCAGG - Intronic
1137495335 16:48965092-48965114 AGGCTCTGGAAAGAGCAGCCAGG + Intergenic
1137607308 16:49795435-49795457 AGGCACTGAACAGAAAACTCTGG + Intronic
1138046938 16:53734955-53734977 AGACTGGGAAAAGAAGTGTCTGG + Intronic
1138271933 16:55701845-55701867 AGTCTCTGAAAGGAAGAGAAGGG - Exonic
1138766677 16:59613458-59613480 TGAGTCTGAAAACAAGAGTCAGG - Intergenic
1139266975 16:65649069-65649091 AGGCTGAGGAAAGAAGAGGCTGG + Intergenic
1139545349 16:67647281-67647303 AGGCTCTGAGAAGCAGAGGGCGG - Exonic
1141410039 16:83826900-83826922 AAGCTCTGAAAAGAACAAGCTGG - Intergenic
1141552853 16:84817729-84817751 AGCCTCTGAATAGAAGAGCCAGG - Intergenic
1141607756 16:85164860-85164882 TGTCTCTGAAAAGAAGAGGATGG + Intergenic
1141638866 16:85329732-85329754 CGGCTCTGAAAGGAAGCGCCTGG - Intergenic
1141952070 16:87345738-87345760 AGGCCCTGAAGAGAAGGGACAGG + Intronic
1144436067 17:15242344-15242366 AGATTCTGAAAAGAAGCTTCAGG + Intronic
1144535211 17:16082186-16082208 AAGCTCTGAAAAGAAAAGTGGGG + Intronic
1150636843 17:66918980-66919002 AAGATCAGAAAAGAAGAGACTGG + Intergenic
1152119844 17:78411696-78411718 AGGCCCTGGGATGAAGAGTCGGG + Intronic
1153176166 18:2376279-2376301 GGGCTGTGAACAGAAGGGTCAGG + Intergenic
1153812247 18:8762491-8762513 AGGCTCTCAAATGAACAGTCGGG + Intronic
1153977718 18:10284082-10284104 TGGCTCTGCAAAGAACAGGCAGG - Intergenic
1154060171 18:11052877-11052899 AGGCTCTGGGAACAAGGGTCTGG - Intronic
1155194174 18:23457709-23457731 TGGCTCTGAAAAAAATAATCTGG - Intronic
1156900636 18:42296900-42296922 AGGTTCTGAAAGGAAGATGCTGG - Intergenic
1159136513 18:64343185-64343207 TGGCAGTGAAAAGAAGAGCCAGG + Intergenic
1159946870 18:74450543-74450565 AGCCTGTGAAAAGCAGAGTGAGG + Intronic
1160010449 18:75103447-75103469 AAGCTGTGGAGAGAAGAGTCTGG + Intergenic
1160155422 18:76429993-76430015 AAGCTCTGAACAGAAGGTTCTGG - Intronic
1160420813 18:78742601-78742623 AGGCTGTGCACAGAAGAGCCTGG - Intergenic
1163028405 19:14527806-14527828 AGGATCTGGAAACAAGAGTAAGG + Intronic
1165123662 19:33579303-33579325 AGGCCCTGAAAAGGGGAGCCAGG + Intergenic
1167127501 19:47560278-47560300 AGGCTTTGAAAAAATGAGCCAGG + Intergenic
1167612092 19:50512576-50512598 AGGCTCTGGAAGCAAGAGCCCGG + Exonic
928561447 2:32491131-32491153 AGGCTTTCCAAATAAGAGTCAGG + Intronic
928594447 2:32846659-32846681 AGGCTATGAAAGAAAGAGTAGGG + Intergenic
929068088 2:38000307-38000329 AGGTTCTGAAACAATGAGTCTGG - Intronic
930589174 2:53306686-53306708 TCACACTGAAAAGAAGAGTCTGG + Intergenic
931009767 2:57896862-57896884 AGGCCCTGAAAAGAACAGAATGG + Intergenic
931266141 2:60661956-60661978 AGGCTCTGAAAGTATGGGTCTGG - Intergenic
933889636 2:86755641-86755663 AGGCTCTTAGGAGAAAAGTCTGG - Intronic
937927059 2:127175599-127175621 ATGCTAGGAAAAGATGAGTCTGG + Intergenic
938314774 2:130317983-130318005 AGGCACTGAAAAGAAATGTGGGG + Intergenic
939247534 2:139645123-139645145 AGGCTCTGCACAGAAGAGTGGGG + Intergenic
939258635 2:139778227-139778249 AGTCTTTGTAAAGAAGATTCAGG + Intergenic
940928047 2:159390298-159390320 AAGATTAGAAAAGAAGAGTCTGG - Intronic
942661473 2:178269666-178269688 AGGCCCTGAAAGGGAGAGGCAGG - Intronic
942947048 2:181683256-181683278 AGGCCCTAAAAAGAGGAGCCTGG + Intergenic
944051644 2:195476680-195476702 AGGTTTTGAAGAGAAGAATCAGG - Intergenic
944360660 2:198851843-198851865 AGCCTGTAAAAAGGAGAGTCAGG - Intergenic
944993311 2:205263167-205263189 AGGCTCTGAAATAAATAGTTGGG - Intronic
945007336 2:205422832-205422854 AGGCCCTGAAAAGAATAGCTTGG + Intronic
945498069 2:210534129-210534151 AGCTTCTTAAAAGAAGTGTCAGG + Intronic
946792756 2:223318153-223318175 ATGCAATGAAAAGAAGAGGCAGG - Intergenic
947029807 2:225781369-225781391 AGACTCTGAAAAGTACATTCTGG + Intergenic
1170017954 20:11803396-11803418 AGGCTCTGTAAGTCAGAGTCTGG + Intergenic
1170133042 20:13043350-13043372 AGTCCTTGAAAAGAAAAGTCAGG - Intronic
1170668970 20:18412697-18412719 AGCCTCTCAAAAGCAGAGGCAGG - Exonic
1171134471 20:22684389-22684411 GGGCTCTGAAAAGATGAGGAGGG - Intergenic
1173196018 20:40913432-40913454 AGACACAGGAAAGAAGAGTCCGG - Intergenic
1174345476 20:49926054-49926076 AGCCACTGTAAAGAACAGTCTGG + Intergenic
1175745907 20:61457021-61457043 ACGCTCTGAAAGGAGAAGTCTGG - Intronic
1178141467 21:29688848-29688870 AGCCTCAGAAAACAGGAGTCAGG + Intronic
1179980790 21:44894706-44894728 AGAGTCTGGAATGAAGAGTCCGG + Intronic
1180041727 21:45283653-45283675 AGGCTCACAAAAGCAGAGACAGG + Intronic
1181470219 22:23134193-23134215 AGGCTCAAATTAGAAGAGTCAGG + Intronic
1181490899 22:23260326-23260348 AGGGTCTAAAAAGCAGGGTCAGG + Intronic
1182750355 22:32636734-32636756 AGGCTCTCTAAAGCAGTGTCAGG + Intronic
1183020331 22:35021496-35021518 AGATTCTGAAAAGAAGAATTAGG - Intergenic
1183044990 22:35212312-35212334 TGGCTCTGAGGAGAAGGGTCTGG + Intergenic
1183277321 22:36907286-36907308 AGCCTATAAAAAGAAGAGTTAGG + Intergenic
950764215 3:15261358-15261380 AGGATCTGCAAGGAAGAGTTTGG - Intronic
951064575 3:18249061-18249083 AGCCACTGAAAAGAAGGGTAAGG - Intronic
951513271 3:23528413-23528435 ACACTCTGAAAAGATGAGGCAGG + Intronic
951664363 3:25105717-25105739 AGGCTATGGAAAAAAGAGACTGG - Intergenic
951672018 3:25194893-25194915 ATGCTTTGAAAAGCAGAGCCAGG - Intronic
953311441 3:41883972-41883994 AGGCTCTGAAAAGAAGAGTCGGG + Intronic
954234103 3:49242582-49242604 ATGATCTGAAAAGAAAAATCAGG - Intronic
955735377 3:62033247-62033269 AAGCTTTAATAAGAAGAGTCTGG - Intronic
956082698 3:65576410-65576432 AGGCTCAGAGAGGAAGAGTGCGG - Intronic
958975276 3:100660498-100660520 AGTCTCTGTAAAAAAGAGGCTGG + Intronic
959426619 3:106197686-106197708 AGGGACTGAAAGGAAGAGCCAGG - Intergenic
959666968 3:108933289-108933311 AGGCTCAGGAAAGGAGAGTTTGG + Intronic
960293634 3:115916196-115916218 AGGCTTTGAAGAGAAAAGGCAGG - Intronic
962420581 3:135225549-135225571 ACCCTCTGAAAAGAGGAGTTTGG + Intronic
964086320 3:152822962-152822984 AGGCTGTAAAAAGTAGAATCAGG - Intergenic
964450042 3:156803235-156803257 AGGCTCTGATAGGAAGATTAAGG - Intergenic
965707796 3:171526534-171526556 AGGCTATGAAAGGGAGAGTTTGG - Intergenic
966314454 3:178630133-178630155 AGTCTCTTAAAAGAAGCGCCAGG - Intronic
972471397 4:39408719-39408741 ATGCTTTGAAAAGAAGACTCAGG + Intronic
974749246 4:66115257-66115279 AAGCTCTTAAAAAAAAAGTCAGG + Intergenic
977371812 4:96146885-96146907 AGGCCATGGAAAGAAGAGTGTGG - Intergenic
978566426 4:110087168-110087190 AGGCTGTGAAAAAGAGAGACAGG - Intronic
980161705 4:129171796-129171818 AGGCTCTGAAAAGAAGGGCTTGG + Intergenic
981260304 4:142710942-142710964 AGGATTTGAAGAGTAGAGTCAGG - Intronic
981659329 4:147147293-147147315 AGGCCCTCACAAGAAGATTCAGG + Intergenic
982308568 4:153959851-153959873 AGGCTCTGAAGAGAGGAGTCTGG + Intergenic
985101109 4:186459500-186459522 AACCTTTGAAAAGAGGAGTCTGG - Intronic
985193037 4:187398461-187398483 AGGCTCTGAGAAGGTGAGTCTGG - Intergenic
985790239 5:1922818-1922840 TGGCTCCGAAGAGAAAAGTCTGG - Intergenic
988971457 5:36472570-36472592 AGGCCCTCAAAAGAAGCTTCAGG + Intergenic
989204138 5:38794916-38794938 TGGCTCTGAAAGGCAGAGTTTGG + Intergenic
989429858 5:41340207-41340229 ATGCTCTGATAAAAAGAGACTGG - Intronic
989447295 5:41545173-41545195 AGACTCTTATAAGATGAGTCAGG + Intergenic
989624514 5:43416465-43416487 GTGCTCTGAAGATAAGAGTCAGG + Intergenic
991012328 5:61897095-61897117 ATGCTATTAAAAGAAGAGTAGGG - Intergenic
991477450 5:67037764-67037786 AGGCTTTGACAACAAGAGCCAGG + Intronic
991500430 5:67270905-67270927 AGGCTCTGGAATGAAGACTCTGG - Intergenic
992666013 5:79010333-79010355 AGGGTCTGATATGGAGAGTCAGG + Intronic
994725577 5:103431516-103431538 AAGCTCTGGAAAGAAGATCCTGG + Intergenic
994946435 5:106398761-106398783 ATGATCAGAAAAGAAGTGTCAGG - Intergenic
995024240 5:107400384-107400406 AGGACCTGAAAGGAAGTGTCAGG - Intronic
996658195 5:125966956-125966978 AGGGATTGAAAAGAACAGTCAGG - Intergenic
998106658 5:139473200-139473222 AGACTCAGAAAAGGAGATTCAGG - Intergenic
999592648 5:153165820-153165842 AGGGGCTAAAAAGAAGATTCAGG + Intergenic
1000999310 5:167990531-167990553 AGGTTCTCAAAAGCAGTGTCAGG + Intronic
1001097062 5:168783646-168783668 AGGCTCTGATTAGAATACTCTGG - Intronic
1003611334 6:7617369-7617391 CGGCTCTGAAAAGATGACTCTGG - Intergenic
1004366058 6:15013673-15013695 AGAGTCTGAAAAGATGGGTCAGG - Intergenic
1004470050 6:15920958-15920980 AGGATTTGGAAAGAGGAGTCTGG - Intergenic
1006623135 6:35381109-35381131 AGTCTCTGAAAAGAAGATGAGGG - Intronic
1006962262 6:37945168-37945190 AGACCCTGAAAAGCAGAGTGTGG - Intronic
1007170757 6:39861704-39861726 AGGCCATGAAAAGAAAATTCAGG - Intronic
1007663314 6:43499613-43499635 AGGCCCCGAAGAGCAGAGTCCGG - Intronic
1011891452 6:92166413-92166435 AGGCTGTGAAAAGAAGTGGTTGG - Intergenic
1012510078 6:99992547-99992569 AGGCACTGTAAAGAGGAGCCAGG - Intronic
1013125962 6:107184363-107184385 AGGCTCAAAAAAGAAAATTCTGG + Intronic
1013613403 6:111817936-111817958 AGCCTCTGAAAGCAAGAGTCAGG + Intronic
1016545527 6:145218903-145218925 AAGGCCTGAAAAGAAGAGGCTGG + Intergenic
1016583815 6:145661064-145661086 AGGCCCTGAAAAACAAAGTCGGG + Intronic
1017676078 6:156815134-156815156 AGTCTAAGAAAAGAAGAGTATGG + Intronic
1017949471 6:159123767-159123789 AGGATTTGACAAGAAGATTCTGG - Intergenic
1018285386 6:162232208-162232230 AGGCTCAGAAAATAGGAGTCAGG - Intronic
1018987196 6:168646952-168646974 TAGCTTTGAAAAGAACAGTCTGG + Intronic
1019603047 7:1894847-1894869 AGGCTGTGAAAAGAAGCCTAGGG + Intronic
1020154693 7:5713148-5713170 AGGGTCTGAAAAGGAGATGCTGG + Intronic
1020286121 7:6682518-6682540 AGGCTTTGGAAATAAGAGCCTGG - Intergenic
1020989611 7:15180585-15180607 AGGCTCAGAAGAGCAGAGTAGGG - Intergenic
1021542080 7:21770847-21770869 TTGCTCTGAGAAGAAGATTCCGG - Intronic
1021579272 7:22135223-22135245 AGCCTCTGAAGAAAAGAGGCTGG + Intronic
1021801972 7:24316463-24316485 AGGCTTAGAAAAGAAGAGAATGG - Intergenic
1022104643 7:27189232-27189254 AGGCTGTGGAAAGAAGCGTAAGG - Intergenic
1022537562 7:31107319-31107341 AGTCTCTGATGAGAAGAGCCTGG - Exonic
1022565219 7:31392662-31392684 AGGCTCTGAAAAGAGCTGCCTGG + Intergenic
1025235825 7:57234367-57234389 AGGCTCTCTGAAGAAGAATCTGG - Intergenic
1026873989 7:73869493-73869515 AGGGTCTCAAAACAAGAGGCGGG - Intergenic
1028891760 7:95995605-95995627 AGGAACTGAAAAGAGAAGTCAGG + Intronic
1030247269 7:107397105-107397127 AGACTGTGAAAACAAGTGTCTGG - Intronic
1031404477 7:121368178-121368200 AGGCTCTTAAAATGAGAGGCTGG - Intronic
1035199568 7:157252761-157252783 AGGCTGTGAAAAGAAAAGAATGG + Intronic
1035936649 8:3848653-3848675 AGGATCTGAAATGAAAAATCTGG - Intronic
1035999072 8:4581794-4581816 AGGCTCTGAGCAAATGAGTCAGG + Intronic
1036004477 8:4646080-4646102 AGTCTCTGAAGCGAAGACTCAGG - Intronic
1036104620 8:5826466-5826488 AAACTCTTAAAAAAAGAGTCAGG - Intergenic
1037269229 8:17107920-17107942 TGGCTTTGAAAGGAAGAGACAGG + Intronic
1037995164 8:23346977-23346999 AGGCTCTGAGAGGAAGATGCAGG - Intronic
1039479470 8:37861592-37861614 AGACTCTTAAAAAAAGAGCCTGG - Exonic
1043805804 8:84670972-84670994 AGGCTCTAAACAGAAGGGACTGG - Intronic
1044345815 8:91103099-91103121 AGCCTCTAAAAAGATGAGTGTGG - Intronic
1044621927 8:94199006-94199028 TGGCTCTGAGAGGAAGAGACTGG - Intronic
1044836866 8:96304125-96304147 ACTCTCTGAAAAGAAGATTTGGG - Exonic
1045426972 8:102077114-102077136 AGCCTCTGCAAAGGAGAGACAGG - Intronic
1050088694 9:1993536-1993558 AAGCACTGAAAAGAAGAGCATGG + Intergenic
1050129131 9:2391480-2391502 ACACTCTGATAAGAAGAGTTTGG + Intergenic
1050646807 9:7728776-7728798 AGGCTCTGCAAAGAGGAAGCTGG + Intergenic
1051716454 9:19989997-19990019 AGGCTGTGAAATGATGAGACTGG + Intergenic
1053830797 9:42078522-42078544 ATGTTCTGAATTGAAGAGTCAGG + Intronic
1054599761 9:67108915-67108937 ATGTTCTGAATTGAAGAGTCAGG - Intergenic
1056044176 9:82699771-82699793 AGGATCTGAAAAGAAGAAAATGG - Intergenic
1058775568 9:108280014-108280036 AGGCTTTGGACAGAGGAGTCAGG + Intergenic
1059656250 9:116360255-116360277 GGGCTCTGAGAAGGAGAGTCTGG + Intronic
1060282494 9:122223716-122223738 AGGCTCTGAACAGTGGAGTCAGG + Intronic
1061176160 9:128998656-128998678 AGGCACTGACAAGAAGGCTCTGG - Intronic
1061500700 9:131000162-131000184 AGGGGCTGGAAATAAGAGTCAGG + Intergenic
1061622072 9:131817239-131817261 AGGCTCTGCACAGCAAAGTCGGG - Intergenic
1061828972 9:133278487-133278509 AGGCTCTGCAAAGGAGAGCCCGG + Intergenic
1061850275 9:133410787-133410809 GGGCTCTCAAAACAAGAGCCTGG + Intronic
1186720687 X:12300442-12300464 GGGGTCTGAAAATAAAAGTCAGG + Intronic
1190737533 X:53265589-53265611 AGGCTCAGACAGGAAAAGTCGGG + Intronic
1193761518 X:85472728-85472750 AGCCACTGTAAAGAAGAGTATGG + Intergenic
1194723627 X:97369206-97369228 AGCCTCTGAAAGGTAGATTCTGG - Intronic
1198562714 X:137868069-137868091 AGGCTGTGATAGGAAGATTCAGG + Intergenic
1198799354 X:140433187-140433209 AGACAATGGAAAGAAGAGTCGGG - Intergenic