ID: 953313075

View in Genome Browser
Species Human (GRCh38)
Location 3:41899275-41899297
Sequence GTAGTATAGTTAGCAAAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 4, 2: 3, 3: 18, 4: 144}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953313075_953313077 11 Left 953313075 3:41899275-41899297 CCAGGTTTTGCTAACTATACTAC 0: 1
1: 4
2: 3
3: 18
4: 144
Right 953313077 3:41899309-41899331 ATGTGAACATTAAGAGCAGCTGG 0: 5
1: 0
2: 3
3: 17
4: 256
953313075_953313079 19 Left 953313075 3:41899275-41899297 CCAGGTTTTGCTAACTATACTAC 0: 1
1: 4
2: 3
3: 18
4: 144
Right 953313079 3:41899317-41899339 ATTAAGAGCAGCTGGGCAAAAGG 0: 1
1: 0
2: 1
3: 19
4: 241
953313075_953313080 27 Left 953313075 3:41899275-41899297 CCAGGTTTTGCTAACTATACTAC 0: 1
1: 4
2: 3
3: 18
4: 144
Right 953313080 3:41899325-41899347 CAGCTGGGCAAAAGGTATACAGG 0: 1
1: 4
2: 1
3: 17
4: 168
953313075_953313078 12 Left 953313075 3:41899275-41899297 CCAGGTTTTGCTAACTATACTAC 0: 1
1: 4
2: 3
3: 18
4: 144
Right 953313078 3:41899310-41899332 TGTGAACATTAAGAGCAGCTGGG 0: 5
1: 0
2: 3
3: 35
4: 356

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953313075 Original CRISPR GTAGTATAGTTAGCAAAACC TGG (reversed) Intronic
901346626 1:8550071-8550093 ATAGTACAGTTATCAGAACCAGG - Intronic
904937203 1:34140029-34140051 GTAGGATAATAAGCAAAGCCAGG + Intronic
905348631 1:37328803-37328825 ATAGCATGGTGAGCAAAACCAGG + Intergenic
907538054 1:55183210-55183232 TTAGTATATTTATCAAAACCAGG - Intronic
910199685 1:84686448-84686470 GGAGTAAAGTTAGTAAAACTGGG + Intronic
911113513 1:94218042-94218064 GTAATTTAGTTTTCAAAACCTGG - Intronic
916958318 1:169863445-169863467 GTAGTTTTATTTGCAAAACCAGG + Intronic
917220147 1:172720019-172720041 GCAGCTTAGTCAGCAAAACCAGG + Intergenic
921266059 1:213421519-213421541 ATAGTATAGTGAGAAAAACATGG + Intergenic
922427537 1:225513572-225513594 GTAATATAATTATCAAAATCAGG - Intronic
923331426 1:232928473-232928495 GTAGTGTATTGAGCAGAACCTGG + Intergenic
924443885 1:244110331-244110353 GTATTATAATTAGCAGAGCCAGG - Intergenic
1065843171 10:29722534-29722556 GGATTCTAGTTCGCAAAACCTGG - Intronic
1066191904 10:33063750-33063772 ATTGTAAAGTTAGCAGAACCTGG + Intergenic
1067349162 10:45460166-45460188 GTATTATAGGTAGGAAGACCAGG - Intronic
1067809368 10:49415427-49415449 GCAGTACAGTTATCAAAACCAGG - Intergenic
1069104507 10:64366298-64366320 GAAGTATTGTTAGTAAACCCTGG - Intergenic
1069332789 10:67312851-67312873 TTATTATGGTTAGCAAAAGCTGG - Intronic
1071050570 10:81443446-81443468 GAAGTATAGTTACCAGAAGCTGG - Intergenic
1071971005 10:90906740-90906762 GTAGTATACTTGGTAAGACCTGG + Intronic
1078189915 11:9085284-9085306 ATAGTACAATTATCAAAACCAGG - Intronic
1080430956 11:32199321-32199343 GTAGTATATTTAGAAAAATCTGG - Intergenic
1080468143 11:32517979-32518001 ATAGCACAGTTATCAAAACCAGG - Intergenic
1081198462 11:40189425-40189447 GTTTTATAGTTAGGAAGACCTGG + Intronic
1082080495 11:48008920-48008942 GAATTATTGTTAGCAAAACTGGG + Intronic
1086741159 11:90370745-90370767 GTAGTATAGTTTGAAACAACAGG + Intergenic
1088579677 11:111302321-111302343 GTTATATAATTAACAAAACCAGG + Intronic
1090126448 11:124090283-124090305 ATAATATAGTTATCAAAACCAGG - Intergenic
1093889552 12:24503119-24503141 ATAGTATAGTCACCAAAACTAGG - Intergenic
1094659098 12:32449236-32449258 GTAATATAGCTATCAAAACCAGG + Intronic
1095241656 12:39866914-39866936 GAAGTCTATTTTGCAAAACCAGG + Intronic
1095714659 12:45329696-45329718 GGAATATAGTCAGGAAAACCTGG - Intronic
1095853814 12:46839225-46839247 ACAGAATAGTGAGCAAAACCAGG + Intergenic
1097857624 12:64482332-64482354 ATAGTACACTTAGCAAAACCTGG - Intronic
1098667681 12:73184183-73184205 ATAATAAAGTTACCAAAACCTGG - Intergenic
1102580749 12:113885572-113885594 ATAGTACAGTTATCAAAACCAGG - Intronic
1106891286 13:34248493-34248515 ATAGTACAGTTACCAAAATCAGG - Intergenic
1109826021 13:67723181-67723203 GAAGGATGGTTACCAAAACCTGG - Intergenic
1110345977 13:74448385-74448407 AAAGTATAGTTATCCAAACCAGG + Intergenic
1110514554 13:76394403-76394425 GTAGTATAGTTATCACATCAGGG + Intergenic
1111155478 13:84317629-84317651 ATAGTCTAGTTAGAAAACCCTGG - Intergenic
1111191074 13:84806953-84806975 GTAACATAGTTAGCATAAGCAGG + Intergenic
1116055869 14:39863151-39863173 ATATTATAGTTAGCAAAAGAAGG - Intergenic
1118670250 14:68118226-68118248 ATAGTACAGTTACCAAAATCAGG + Intronic
1118790343 14:69085955-69085977 ATCGAATTGTTAGCAAAACCAGG - Intronic
1120772425 14:88395193-88395215 GTGGTATAGTTATCAAAACCAGG + Intronic
1124410377 15:29431972-29431994 TTTTGATAGTTAGCAAAACCAGG + Intronic
1124485572 15:30112154-30112176 ATAGTATAGTTAGCAAAACCTGG + Intergenic
1124518004 15:30385113-30385135 ATAGTATAGTTAGCAAAACCTGG - Intronic
1124540649 15:30581140-30581162 ATAGTATAGTTAGCAAAACCTGG + Intergenic
1124545700 15:30624975-30624997 GTAGAATGATGAGCAAAACCAGG - Intronic
1124758007 15:32426442-32426464 ATAGTATAGTTAGCAAAACCTGG - Intergenic
1128808043 15:70548376-70548398 ATATTACAGTTATCAAAACCAGG - Intergenic
1132160740 15:99539328-99539350 GAAGTATAGTAAGCAAAGCTGGG + Intergenic
1138671797 16:58621574-58621596 CTATTCTTGTTAGCAAAACCAGG + Intronic
1146564277 17:33898562-33898584 GTAGTACAATAATCAAAACCGGG + Intronic
1146700519 17:34955357-34955379 GCAGTATAGTTATAAAAACCAGG - Intronic
1148377764 17:47164482-47164504 ATAGTACAGTTATCAAAACTAGG + Intronic
1149137491 17:53386507-53386529 GTAGAATGGTTAGCAGGACCTGG + Intergenic
1149741218 17:59047291-59047313 ATAGAATAGTTATCAAAATCTGG - Intronic
1150204579 17:63392934-63392956 GTAGTCTCATTATCAAAACCAGG + Intronic
1155633107 18:27918976-27918998 ATAGTTCAGTTACCAAAACCAGG - Intergenic
1158141133 18:54257343-54257365 ATAGTATAATTATCAAAACCAGG + Intergenic
1159341509 18:67140203-67140225 ATACTAGAGTTAGCAAAAGCTGG - Intergenic
1166015614 19:39977285-39977307 ATAGTATAATTAGGAAAACCAGG + Intronic
927559759 2:24061653-24061675 ATAGTACAATTATCAAAACCAGG + Intronic
928288289 2:30012735-30012757 ATAGTATAATTATCAAAACCAGG - Intergenic
929177567 2:38996513-38996535 AAAGTATTGTTAGCAAAACTTGG + Intronic
930308392 2:49706015-49706037 GTATTCCAGTTAGCAAAACATGG - Intergenic
933115581 2:78465950-78465972 GGAGAATAGTTAGCTCAACCTGG + Intergenic
934126323 2:88895547-88895569 GTAGAATAGTTACCAGAAGCTGG - Intergenic
934959829 2:98662173-98662195 ATATTATAGTTATCAAAACCAGG - Intronic
935313670 2:101810129-101810151 GTATAATAGGTAGCAAAAACAGG + Intronic
935355157 2:102191304-102191326 ATAGTATAGTTATCAAATTCAGG + Intronic
937553381 2:123123580-123123602 GCAGTATAGTTAGAAAGAACTGG - Intergenic
938884041 2:135624924-135624946 GTACTAAAGATAGCAAAAACAGG + Intronic
940498158 2:154459954-154459976 GTAGGATAGTTAGCACCTCCTGG - Intergenic
941410556 2:165151691-165151713 GTTGTATAGTTCACAAAACAGGG + Intronic
942138273 2:172951419-172951441 GTAGAACAGTGAGCAAAACAAGG + Intronic
942386966 2:175452702-175452724 GTAGTTTTGTTTGCAAAATCTGG - Intergenic
943569278 2:189554152-189554174 CAGGTATAGTTAACAAAACCTGG - Intergenic
944320247 2:198332090-198332112 GTAGTATATTTACTAAAATCAGG - Intronic
947325997 2:228977282-228977304 GTAGGAAAATTAGCAAAATCAGG + Intronic
1169133970 20:3185055-3185077 GAAGTACAGTGAGCAAAACATGG - Intergenic
1169896306 20:10508671-10508693 CCAGTAAAGTTAGCAAAAGCAGG - Intronic
1172087744 20:32401096-32401118 ATAGTATAGTTATTAAAACTAGG + Intronic
1172291037 20:33777003-33777025 ATACTATAGTTACCAAAATCAGG + Intronic
1172369462 20:34377071-34377093 GTAGAATAGAAAGAAAAACCAGG + Intronic
1172796126 20:37539476-37539498 GTAGTATAATTATTAAAATCAGG - Intergenic
1175223860 20:57433594-57433616 GTAGTAGAGTGGGCAACACCAGG + Intergenic
1177161775 21:17555483-17555505 ATATTATAATTATCAAAACCAGG + Intronic
1179008783 21:37537167-37537189 GTAGTAAAGTTAGAAAAAAAAGG + Intergenic
1183771360 22:39928719-39928741 GTTCTAAAGTTAGCAAGACCTGG + Intronic
950671174 3:14526329-14526351 GTAGTAGAGTCAGCAGAACTGGG - Intronic
950879123 3:16307839-16307861 GTGGTATATTTATCAAAACTAGG + Intronic
952051802 3:29393533-29393555 GTATCATATTTAACAAAACCAGG + Intronic
952204307 3:31164513-31164535 TGAGGAAAGTTAGCAAAACCTGG + Intergenic
952852120 3:37737993-37738015 GTAGTATAGTTATCACATTCAGG + Intronic
953313075 3:41899275-41899297 GTAGTATAGTTAGCAAAACCTGG - Intronic
957480456 3:80786443-80786465 ATAGTAAATTTATCAAAACCAGG + Intergenic
957522776 3:81341885-81341907 ATCGTACAGTTATCAAAACCGGG - Intergenic
959259599 3:104059361-104059383 ATAGTATAAGGAGCAAAACCAGG + Intergenic
959658807 3:108842332-108842354 GTAGCATAGTTAGCAAAGAAAGG - Intronic
960128773 3:114030063-114030085 ATAGTATAATTATCAAAACTAGG - Intronic
960280326 3:115774435-115774457 ATGGTATACTTATCAAAACCAGG + Intergenic
960976706 3:123182411-123182433 ACAGTACAGTTATCAAAACCTGG - Intronic
961073338 3:123958677-123958699 ACAGTATAATTATCAAAACCAGG + Intronic
961310305 3:125994067-125994089 ACAGTATAATTATCAAAACCAGG - Intergenic
961966075 3:130904212-130904234 ATAGTATAATTATTAAAACCAGG + Intronic
961981676 3:131085770-131085792 ATAGTATAATTATCAAAACTAGG + Intronic
964567206 3:158070022-158070044 GTAATATACTTAGAAATACCAGG - Intergenic
965363595 3:167770948-167770970 GTAGTATTCTTAGCAAAATAAGG - Intronic
972259348 4:37392611-37392633 GGAGTACAGTTAGCGAAACTAGG + Intronic
972461733 4:39310392-39310414 ATAGCATAGTTATAAAAACCAGG - Intronic
972666554 4:41170752-41170774 ATTGTACAGTTACCAAAACCAGG - Intronic
975953860 4:79811407-79811429 ATAGTACAATTATCAAAACCAGG - Intergenic
976749492 4:88439718-88439740 GTTGTATTGTGACCAAAACCTGG - Intronic
976777085 4:88718855-88718877 GTGGTATAGTTATCAAACCAAGG + Intergenic
980756887 4:137176528-137176550 ATAGTACAATTATCAAAACCAGG - Intergenic
980904563 4:138934978-138935000 TTAGTATAGTTAGCAAAATTGGG - Intergenic
986008622 5:3690713-3690735 ATAGTATAATTATCAAAATCGGG + Intergenic
986670887 5:10141271-10141293 GTAGATTAGAAAGCAAAACCTGG - Intergenic
989359144 5:40579485-40579507 TTAGTATAGTCAGCAAAATGTGG + Intergenic
989684265 5:44066063-44066085 GAAGGATAGTTAGGAAAACAAGG - Intergenic
990242134 5:53826433-53826455 GTGGCACATTTAGCAAAACCAGG + Intergenic
992968674 5:82031861-82031883 GTAGAATAGTTAGCACAATTTGG - Intronic
993543128 5:89177066-89177088 TTAGAATAGATAGCAAAACCTGG + Intergenic
997277058 5:132602682-132602704 ATAATACAGTTATCAAAACCAGG + Intronic
999464673 5:151791302-151791324 GTAGTACAGTTATCAAATTCAGG + Intronic
1000309102 5:160024343-160024365 ATAGTGCAGTTATCAAAACCAGG + Intronic
1003293885 6:4806545-4806567 GTAGCACAGTTACCAAAACCGGG + Intronic
1005255749 6:24001267-24001289 GTATTTTAGTTAACAAAACTTGG + Intergenic
1005308945 6:24540848-24540870 GTAATACAATTATCAAAACCAGG + Intergenic
1005376912 6:25192272-25192294 GCAGCATAGTTAGAATAACCTGG + Intergenic
1010957904 6:82112141-82112163 GAATGATAGTTACCAAAACCTGG + Intergenic
1012542978 6:100383008-100383030 GTAGTTGAAATAGCAAAACCAGG + Intergenic
1014766797 6:125416473-125416495 GTAGTTTAGTTAGGAAAGACTGG + Intergenic
1015479711 6:133694508-133694530 GTAGTAAAATTAGCAATGCCAGG + Intergenic
1020845765 7:13280773-13280795 GTAGTATAGCGAGCAAAACCTGG + Intergenic
1024943264 7:54783735-54783757 GTAGTATAATCATCAAAGCCAGG + Intergenic
1026391689 7:69909079-69909101 GCAATATTGTTAGCAAAACTTGG + Intronic
1030641923 7:112015667-112015689 ATAGTACATTTACCAAAACCAGG + Intronic
1032632212 7:133665926-133665948 GTAGATGAGGTAGCAAAACCAGG - Intronic
1039514601 8:38121489-38121511 ATAGTACAGTTATCAAAACTGGG + Intronic
1039915353 8:41856431-41856453 ATATTATAATTAGGAAAACCTGG + Intronic
1040848897 8:51877847-51877869 GCAGTATAGTTATTAAAATCAGG - Intronic
1044189038 8:89292538-89292560 TTTGTATACTAAGCAAAACCAGG + Intergenic
1044992714 8:97810418-97810440 GTAGCATAACTACCAAAACCAGG - Intronic
1045017888 8:98014613-98014635 GTAGTATAGTCAGAAAATACGGG + Intronic
1045240421 8:100395909-100395931 GTTGTAAACTTAGCAAAAGCAGG - Intronic
1045267605 8:100633329-100633351 ACAGTATAGTTAGCAAAATCAGG - Intronic
1047994775 8:130323966-130323988 GTAGTATTGTTAGGAAGCCCTGG - Intronic
1048496908 8:134942989-134943011 GTAGTATAGTGTGGAAAACAGGG - Intergenic
1049133280 8:140868945-140868967 ATAATATAGCTAGTAAAACCAGG - Intronic
1050467554 9:5945385-5945407 ATTGTATAGTTAGCAAACCAAGG - Intronic
1050951704 9:11604427-11604449 GTAGTACAATTAGCAAAACCAGG - Intergenic
1052207708 9:25863423-25863445 GTTGTATAGTGAGGAAAACTTGG + Intergenic
1053599904 9:39600155-39600177 GTAATATAGCTAGAAAAATCAGG + Intergenic
1053857555 9:42354011-42354033 GTAATATAGCTAGCAAAATCAGG + Intergenic
1054253622 9:62742229-62742251 GTAATATAGCTAGAAAAATCAGG - Intergenic
1054567739 9:66776728-66776750 GTAATATAGCTAGCAAAATCAGG - Intergenic
1055383139 9:75730935-75730957 ATAGTACAGTTATCAAAAACTGG + Intergenic
1057512105 9:95689237-95689259 AGAGTACAGTTATCAAAACCAGG + Intergenic
1058311381 9:103507520-103507542 GTACTAAAGTCAGCAAAACAAGG - Intergenic
1186992618 X:15085672-15085694 ATGGTACAGTTATCAAAACCAGG - Intergenic
1188257072 X:27976142-27976164 ATAGTATAATTATCAAGACCAGG - Intergenic
1190825256 X:54012056-54012078 TTTGTATAGTTATCAAAATCAGG - Intronic
1191027302 X:55927903-55927925 GTATCATAGTTAGGAAAACTGGG - Intergenic
1195631594 X:107061239-107061261 ATAGTACAGTTATCAAAATCAGG - Intergenic
1196261685 X:113590069-113590091 TTAGTATAATTATCAAAATCAGG + Intergenic