ID: 953319421

View in Genome Browser
Species Human (GRCh38)
Location 3:41958998-41959020
Sequence CAGGTAGGTCACCTGAAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105597
Summary {0: 1, 1: 90, 2: 2588, 3: 30820, 4: 72098}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953319415_953319421 0 Left 953319415 3:41958975-41958997 CCCAGCAATTTGGGAGGCCAAGG 0: 1150
1: 92665
2: 219436
3: 251336
4: 265358
Right 953319421 3:41958998-41959020 CAGGTAGGTCACCTGAAGTCAGG 0: 1
1: 90
2: 2588
3: 30820
4: 72098
953319417_953319421 -1 Left 953319417 3:41958976-41958998 CCAGCAATTTGGGAGGCCAAGGC 0: 696
1: 58431
2: 173956
3: 231690
4: 278447
Right 953319421 3:41958998-41959020 CAGGTAGGTCACCTGAAGTCAGG 0: 1
1: 90
2: 2588
3: 30820
4: 72098

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953319421 Original CRISPR CAGGTAGGTCACCTGAAGTC AGG Intronic
Too many off-targets to display for this crispr