ID: 953323991 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:41996961-41996983 |
| Sequence | CTTACTTAAGAATACACAGT AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 953323991_953323992 | 3 | Left | 953323991 | 3:41996961-41996983 | CCTACTGTGTATTCTTAAGTAAG | No data | ||
| Right | 953323992 | 3:41996987-41997009 | AATGTCTCAAAGCATGATGTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 953323991 | Original CRISPR | CTTACTTAAGAATACACAGT AGG (reversed) | Intergenic | ||