ID: 953323991

View in Genome Browser
Species Human (GRCh38)
Location 3:41996961-41996983
Sequence CTTACTTAAGAATACACAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953323991_953323992 3 Left 953323991 3:41996961-41996983 CCTACTGTGTATTCTTAAGTAAG No data
Right 953323992 3:41996987-41997009 AATGTCTCAAAGCATGATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953323991 Original CRISPR CTTACTTAAGAATACACAGT AGG (reversed) Intergenic