ID: 953326740

View in Genome Browser
Species Human (GRCh38)
Location 3:42017909-42017931
Sequence AGTCCAAACAGGCTGCCTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 159}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953326740_953326743 13 Left 953326740 3:42017909-42017931 CCTGTAGGCAGCCTGTTTGGACT 0: 1
1: 0
2: 0
3: 10
4: 159
Right 953326743 3:42017945-42017967 TTTTTTTCTTAAATAGAGACAGG 0: 5
1: 166
2: 1118
3: 5893
4: 31405

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953326740 Original CRISPR AGTCCAAACAGGCTGCCTAC AGG (reversed) Intronic
902660465 1:17897246-17897268 ATTCCAACCAGGCAGCCAACAGG - Intergenic
903003463 1:20282838-20282860 ACTCCAAGCAGCCTGCCTCCAGG + Intergenic
904051689 1:27643632-27643654 AGGACAAACAGGTTGCCCACAGG + Intergenic
904629793 1:31832218-31832240 CCTCCAAACAGGCTGCCCAATGG + Intergenic
904711358 1:32432895-32432917 AGTAAAAAGAGGCTGCTTACCGG - Intergenic
906723596 1:48027376-48027398 AGTCCAAGCAGGCTTCCTGGAGG + Intergenic
917057375 1:170997808-170997830 AGTCCAAGATGGCTGCATACAGG - Intronic
919289238 1:195608275-195608297 TGTCCAAACACTCTGCCTATGGG - Intergenic
919476085 1:198035202-198035224 AGTAAAAACAGGCCGCTTACCGG - Intergenic
923908485 1:238412997-238413019 ACTCCAACCAGCCTGCCCACTGG + Intergenic
923962481 1:239101765-239101787 AGTAAAAAGAGGCTGCTTACCGG - Intergenic
1063362824 10:5471323-5471345 AGTAAAAAGAGGCTGCTTACTGG - Intergenic
1064768808 10:18702367-18702389 ATTCAAAACAAGCTGCCTACAGG - Intergenic
1066296565 10:34059067-34059089 ATTCTAAACAGACTGCCAACCGG + Intergenic
1071880926 10:89897624-89897646 ATTCCAGAAAGGCTGTCTACAGG + Intergenic
1076694353 10:132240013-132240035 AGTTCACCCAGGCTGCCTTCCGG + Intronic
1077509741 11:2951918-2951940 AGTCCAGCCACGCTGCCTGCTGG + Intronic
1077845013 11:6014065-6014087 AGTCCACGTATGCTGCCTACTGG + Intergenic
1078059193 11:8032409-8032431 AATCCAAACTTGCTGCCCACAGG - Intronic
1078091434 11:8266954-8266976 AGTGCAATCAGGATGCCTGCTGG + Intronic
1079914413 11:26350343-26350365 AGTCTAAAGAGGCTGCTTAGGGG + Intronic
1083622573 11:64056411-64056433 AGCCCAACCAGGCTGCCTGAGGG + Intronic
1083741235 11:64712704-64712726 TGACCACACAGGCTGCCCACAGG + Intronic
1084028547 11:66467361-66467383 TTTCCAAACGGGCTGCCTGCGGG + Intronic
1084613580 11:70219588-70219610 AGTAAAAAGAGGCTGCTTACCGG + Intergenic
1093578452 12:20763504-20763526 AGTCAAAAGAGGCCGCTTACTGG - Intergenic
1095974083 12:47927420-47927442 AGTCCAGACAGCCAGCCTTCTGG + Intronic
1096095958 12:48935879-48935901 AGTCCATACAGTCTACCAACAGG + Exonic
1102666375 12:114577493-114577515 AGTCTCAGCACGCTGCCTACAGG - Intergenic
1103891140 12:124239971-124239993 TGTCCAATCAGGGTGCCTGCTGG - Intronic
1104538196 12:129638270-129638292 AGCCCAAATATGCTGCCTACTGG + Intronic
1104719919 12:131039564-131039586 AGTCCACACAGCCAGCCTCCAGG - Intronic
1106355142 13:28975129-28975151 GATCCAATCGGGCTGCCTACTGG - Intronic
1106903387 13:34378957-34378979 AGTCCAGCCAGGCTGACTCCTGG - Intergenic
1107220591 13:37974356-37974378 AGTAAAAAGAGGCTGCTTACCGG + Intergenic
1107802265 13:44119747-44119769 AGTCCCAACCAGCTTCCTACTGG + Intergenic
1109526858 13:63586732-63586754 ACTCCAACCAGCCTGCCCACTGG - Intergenic
1110765170 13:79274637-79274659 AGTAAAAAGAGGCTGCTTACCGG - Intergenic
1111630195 13:90840137-90840159 AGTAAAAAGAGGCTGCCTACCGG - Intergenic
1113737292 13:112688105-112688127 AGTCCCAACAGGAAGCCTGCTGG - Intergenic
1116690258 14:48097192-48097214 AGGCCAAACACGCTGACAACAGG - Intergenic
1118318376 14:64738997-64739019 AGGCCAAACAGGCTTCATGCAGG - Intronic
1119316877 14:73703914-73703936 AGTAAAAAGAGGCTGCTTACCGG - Intergenic
1122318951 14:100841751-100841773 ATTCCAAACAGGCAGGCTGCTGG + Intergenic
1124412716 15:29450189-29450211 AGAGAAAACAGGCAGCCTACAGG - Intronic
1129090391 15:73143533-73143555 AGTCCACACTGCCTGCCCACCGG - Intronic
1129259205 15:74354683-74354705 AGTAAAAAGAGGCTGCTTACCGG - Intronic
1130814193 15:87413714-87413736 AGTCCCCACAGGCAGCCTAAAGG - Intergenic
1131413794 15:92233472-92233494 TGTCCAAAGAGGCTGTCTATAGG - Intergenic
1132340126 15:101073084-101073106 AGTAAAAAGAGGCTGCTTACTGG - Intronic
1132469931 16:96890-96912 AATCCAAAAAGGCTGCTTTCGGG + Intronic
1133593483 16:7268208-7268230 AGTAACTACAGGCTGCCTACAGG - Intronic
1134622023 16:15696716-15696738 AGTCCAAACTCGCTTCCTGCCGG + Exonic
1134884166 16:17775222-17775244 AGACCAAACAGGCTGTCTTCTGG - Intergenic
1136175758 16:28515135-28515157 GGTCCCAACAGGCTGCCTGCAGG + Intergenic
1143373677 17:6455283-6455305 GGCCCAATCAGGCTGCCTGCGGG - Exonic
1144350441 17:14389980-14390002 AATTCTAACAGGCTGCCTGCTGG + Intergenic
1148044334 17:44733397-44733419 AGTGTAAACAGGCTGCAAACAGG - Intronic
1152327751 17:79651426-79651448 ACTCCAAAATGGCTGCCTTCTGG + Intergenic
1154081186 18:11258775-11258797 ACTGCAACCAGGCTGCCTTCAGG - Intergenic
1155586628 18:27374067-27374089 AGTCCTTAAAGGCTGCCTAGAGG - Intergenic
1158883448 18:61803509-61803531 TCTCCCAACAGGCTGCCTTCGGG + Intergenic
1159134923 18:64326413-64326435 ACTCCAAGCAGCCTGCCCACTGG - Intergenic
1159285370 18:66342820-66342842 ATTCCTAACAGGCTGCAGACTGG + Intergenic
1165963322 19:39553376-39553398 AGTCCACAGAGGCTGCATGCTGG - Intergenic
1168212396 19:54900017-54900039 AGTAAAAAGAGGCTGCTTACTGG + Intergenic
926168901 2:10538455-10538477 GCTCCAAACATGCTGCTTACAGG - Intergenic
928770844 2:34700789-34700811 AGTAAAAAGAGGCTGCTTACCGG + Intergenic
929597739 2:43186855-43186877 AGTCCAAAGAGGCTGCTTGTTGG - Intergenic
931625475 2:64253041-64253063 AGTAAAAAGAGGCTGCTTACTGG - Intergenic
931947962 2:67332060-67332082 AGTAAAAAGAGGCTGCTTACCGG - Intergenic
932509606 2:72272317-72272339 ACACCAAACAGGCTGCATACTGG - Intronic
933329809 2:80879628-80879650 AGTAAAAAGAGGCTGCTTACCGG + Intergenic
933552640 2:83793905-83793927 AGTAAAAAGAGGCTGCTTACTGG + Intergenic
936885708 2:117308492-117308514 ATTCCAGAAAAGCTGCCTACAGG + Intergenic
938628548 2:133138995-133139017 TGTCCAAACAGGTTTCCTATGGG - Intronic
943314008 2:186363121-186363143 AGTTGCAACAGGCTGCTTACAGG + Intergenic
943968978 2:194378873-194378895 TGTCAAAAAAGGCTGCCTGCAGG + Intergenic
948869981 2:240792912-240792934 AGTCCAATCAAGATGCCCACAGG - Intronic
1170541529 20:17393611-17393633 AGTCCCAACAGAATGCTTACTGG - Intronic
1170715751 20:18829432-18829454 AACCCAAACAGGCTGGCTACAGG - Intronic
1172932804 20:38598220-38598242 AGTAAAAACAGGCTGCTTAGCGG + Intergenic
1173366174 20:42387388-42387410 AGCACAAGCAGGCTGGCTACAGG + Intronic
1173675643 20:44832751-44832773 CCTCCAAACAGGCTGGCCACTGG - Intergenic
1173895265 20:46546051-46546073 AGTGCAAACAGGCAGCGGACTGG + Exonic
1177840948 21:26232910-26232932 AGTAAAAAGAGGCTGCTTACCGG + Intergenic
1182113665 22:27742578-27742600 AGTACAAAGAGGCCGCTTACTGG - Intergenic
1184878574 22:47290881-47290903 AGTCCAGCCAGGCTGCCTGGTGG + Intergenic
953326740 3:42017909-42017931 AGTCCAAACAGGCTGCCTACAGG - Intronic
955223766 3:57044544-57044566 ACTCCCACCAGGCAGCCTACAGG + Intronic
956022765 3:64949758-64949780 AGGTCAACCAGGCCGCCTACAGG - Intergenic
956800885 3:72757268-72757290 AGTTCAAACTGGATGCTTACTGG + Intronic
957654843 3:83061045-83061067 ACCCCAAACAGAGTGCCTACTGG - Intergenic
959486035 3:106927815-106927837 AGTGAAAAGAGGCTGCTTACCGG + Intergenic
959623430 3:108423223-108423245 ACTCCAACCAGCCTGCCCACTGG - Intronic
961471126 3:127113672-127113694 AGTGCAAACAGCCTGTCTCCTGG - Intergenic
961730308 3:128960397-128960419 AGTCAAAAGAGGCCGCTTACCGG - Intronic
964906847 3:161727203-161727225 AGTAAAAAGAGGCTGCTTACTGG + Intergenic
965336071 3:167431832-167431854 AGTAAAAAGAGGCTGCTTACTGG - Intergenic
966085160 3:176061893-176061915 ACTAAAAACAGGCTGCTTACCGG - Intergenic
967149634 3:186636894-186636916 AGTCAAGACAGGCTTCCTAGAGG - Intronic
967740201 3:192996202-192996224 AGTAAAAAGAGGCTGCTTACCGG - Intergenic
969286683 4:6206874-6206896 AGTCCAGAGAGGCTTCCTAGAGG + Intergenic
969367370 4:6704917-6704939 AGTCCAAAAATTCTGCCTTCTGG - Intergenic
969703810 4:8781510-8781532 AGGCCTAAGAGGCTGCCCACAGG - Intergenic
971642743 4:29156825-29156847 AGTCTAAGGAGGCTGCCTGCAGG - Intergenic
972365627 4:38371701-38371723 ACTCCAAAGAGACTGCTTACTGG + Intergenic
977824681 4:101517083-101517105 AGTCCATACAGTCAGCCTCCTGG - Intronic
979353204 4:119670331-119670353 AAGCCAAACAGGCTGGCTATGGG - Intergenic
981779725 4:148413857-148413879 AGTACAAACATACTGGCTACTGG + Intronic
983186137 4:164702949-164702971 CTTCAAAACAGGCTACCTACAGG - Intergenic
984099314 4:175466515-175466537 AGTAAAAAGAGGCTGCTTACCGG + Intergenic
984873981 4:184351069-184351091 TGGCCAAACAGGCTACCTTCAGG + Intergenic
985571127 5:645889-645911 CGTCCACACAGGCCGCCGACGGG - Intronic
986923660 5:12718302-12718324 TGTCCACAGAGGCTTCCTACTGG + Intergenic
988939036 5:36122523-36122545 AATCCAAACATGCTCCCTAGTGG - Intronic
991014436 5:61915930-61915952 ACTCCAACCAGCCTGCCCACTGG + Intergenic
994505538 5:100639170-100639192 ACTCCAAACATCCTGCCCACTGG + Intergenic
997439936 5:133902059-133902081 CCTCCAGAGAGGCTGCCTACTGG + Intergenic
997769965 5:136544800-136544822 AGTAAAAAGAGGCTGCTTACCGG + Intergenic
1000030046 5:157393712-157393734 AGTCCAAACAGGATGCTTTCAGG + Intronic
1001900575 5:175424495-175424517 AGAGCAAACAGACAGCCTACAGG + Intergenic
1002680836 5:180962212-180962234 AGACCAAGATGGCTGCCTACAGG - Intergenic
1005395364 6:25377122-25377144 ATTCCAGAAAGGCTGTCTACAGG + Intronic
1008476265 6:51938825-51938847 AGTAAAAAGAGGCTGCTTACCGG - Intronic
1010065681 6:71680166-71680188 ATTCCTCACAGGCTGCCTCCTGG - Intergenic
1010841560 6:80652815-80652837 AGTAAAAAGAGGCTGCTTACTGG + Intergenic
1012315521 6:97780093-97780115 AGTAAAAAGAGGCTGCTTACTGG - Intergenic
1013778497 6:113704779-113704801 AGTCAAAGCAGGCTTCCTACTGG + Intergenic
1015277890 6:131403503-131403525 AGTAAAAAGAGGCTGCTTACTGG - Intergenic
1016493556 6:144634024-144634046 AGTCAGAACAGGCTGCCCAGGGG + Intronic
1017360002 6:153557117-153557139 AATCCAAACAGACTGGCTTCAGG + Intergenic
1017567804 6:155707321-155707343 AGCCCAGACTGGCTGCCTCCAGG + Intergenic
1017779637 6:157705919-157705941 AGTAAAAAGAGGCTGCTTACCGG + Intronic
1019614167 7:1951393-1951415 ACTCCTAACAAGCTGCCTGCTGG + Intronic
1021054947 7:16035940-16035962 ACTCCAACCAGCCTGCCCACTGG + Intergenic
1022854992 7:34304966-34304988 AGTAAAAAGAGGCTGCTTACTGG + Intergenic
1023441304 7:40187580-40187602 AGTCTAAACTGGAGGCCTACAGG - Intronic
1026574635 7:71561870-71561892 GGTCCAAAGGGGCTGCCTTCTGG + Intronic
1027916065 7:84322835-84322857 AGTCCATACAGGCTTCCTGAAGG + Intronic
1028689906 7:93640489-93640511 AGTAAAAAGAGGCTGCTTACCGG - Intronic
1029414123 7:100432342-100432364 ACTCCAGTTAGGCTGCCTACTGG + Intronic
1030441933 7:109597021-109597043 AGTAAAAAGAGGCTGCTTACTGG + Intergenic
1031365028 7:120890816-120890838 AGTAAAAAGAGGCTGCTTACTGG + Intergenic
1031685598 7:124729700-124729722 AGTAAAAAGAGGCTGCTTACCGG - Intergenic
1031834591 7:126668029-126668051 ACTCCAAGCAGCCTGCCCACTGG + Intronic
1036639175 8:10571656-10571678 AGTAAAAAGAGGCTGCTTACTGG - Intergenic
1037104528 8:15090468-15090490 TGTCCAATCAGGCTGCCCATAGG + Intronic
1037928611 8:22864677-22864699 AGTCCTAACAAGCTGCCTGGCGG - Intronic
1045552092 8:103181776-103181798 GGGCCAAACATGCTGCATACTGG + Intronic
1046293842 8:112196421-112196443 AGTAAAAAGAGGCTGCTTACCGG - Intergenic
1047699062 8:127432293-127432315 AGTAAAAAGAGGCTGCTTACCGG - Intergenic
1047704585 8:127484700-127484722 ACTCCAACCAGCCTGCATACTGG - Intergenic
1048097320 8:131310710-131310732 AGTAAAAAGAGGCTGCTTACCGG - Intergenic
1048522004 8:135164914-135164936 AGTCCAAAGAAGCTGCATCCTGG - Intergenic
1049477566 8:142803848-142803870 ACTCCCTACAGGCTCCCTACAGG - Intergenic
1053126585 9:35585825-35585847 AGCACAAACAGGGTCCCTACGGG - Intergenic
1054731023 9:68703327-68703349 TGTCCAACCAGACTGCCCACTGG - Intergenic
1058829537 9:108803092-108803114 ACTCCTAGCAGGCTGGCTACTGG + Intergenic
1059546427 9:115179758-115179780 AGTAAAAATAGGCTGCTTACTGG + Intronic
1186056007 X:5650553-5650575 ACTCCAACCAGGTTGCCCACTGG + Intergenic
1193885670 X:86982430-86982452 AGTAAAAAGAGGCTGCTTACCGG - Intergenic
1194217477 X:91148428-91148450 TGCCCAACCAGGGTGCCTACCGG - Intergenic
1194350997 X:92825026-92825048 AGTAAAAAGAGGCTGCTTACCGG - Intergenic
1194969232 X:100324671-100324693 AGTCAAAAGAGGCTGCTTTCTGG + Intronic
1196787096 X:119430475-119430497 AGTCCAAACAGTCTGGCTTCAGG + Intronic
1196887318 X:120260609-120260631 AGTCCAAACAAGCTTCTTGCTGG + Exonic
1199377904 X:147134206-147134228 AGTAAAAAGAGGCTGCTTACCGG + Intergenic
1200553990 Y:4612220-4612242 TGCCCAACCAGGGTGCCTACCGG - Intergenic
1200659324 Y:5941706-5941728 AGTAAAAAGAGGCTGCTTACCGG - Intergenic