ID: 953327079

View in Genome Browser
Species Human (GRCh38)
Location 3:42021527-42021549
Sequence CGAAGCTGCCTGTCATAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 131}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953327079_953327083 29 Left 953327079 3:42021527-42021549 CCTGTTTATGACAGGCAGCTTCG 0: 1
1: 0
2: 1
3: 9
4: 131
Right 953327083 3:42021579-42021601 CAGTTATTATTTTTTTGAAATGG 0: 1
1: 0
2: 22
3: 452
4: 5419

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953327079 Original CRISPR CGAAGCTGCCTGTCATAAAC AGG (reversed) Intronic
902666678 1:17944258-17944280 CTGAGCTGCCTGTCATGGACTGG - Intergenic
908435625 1:64102826-64102848 CTAAGCAGCCTGTAATACACAGG - Intronic
908605125 1:65790470-65790492 CAAAGCTGTCTCTCAAAAACTGG - Intergenic
910588224 1:88901833-88901855 CTAAACTGCCTATCATGAACTGG + Intergenic
910831085 1:91463313-91463335 CTGAACTGCCTATCATAAACGGG - Intergenic
911974269 1:104471811-104471833 CTGAGCTGCCCTTCATAAACTGG + Intergenic
917195515 1:172460882-172460904 CAAAGCTGCCTGCCAAAGACAGG - Intronic
923253558 1:232199327-232199349 CTGAACTGCCTGTCATTAACTGG - Intergenic
923592284 1:235329099-235329121 AGAAGCCGCCTGATATAAACAGG - Intronic
924847123 1:247785026-247785048 CTGAACTGCCTGTCATGAACTGG - Intergenic
1069145772 10:64890551-64890573 CTAAACTGCGTATCATAAACTGG + Intergenic
1069192293 10:65506259-65506281 CTAAACTGCCTTTCATGAACTGG - Intergenic
1070585680 10:77764146-77764168 TGAAGCTGTCTTTCAGAAACTGG + Intergenic
1071937700 10:90549387-90549409 CTGAACTGCCTGTCATGAACTGG + Intergenic
1072209250 10:93231569-93231591 CTGAACTGCCTGTCATGAACTGG - Intergenic
1073830494 10:107377898-107377920 CCAAGCTGCCCATCATAAACTGG - Intergenic
1076927405 10:133499115-133499137 CTGAACTGCCTATCATAAACTGG - Intergenic
1080020131 11:27551555-27551577 CTGAGCTGCCTATCATGAACTGG - Intergenic
1080076602 11:28157601-28157623 CTGAACTGCCTGTCATGAACTGG + Intronic
1081065451 11:38534791-38534813 CTGAACTGCCTGTCATGAACTGG - Intergenic
1081378296 11:42386029-42386051 CCAAACTGCCTATCATGAACTGG + Intergenic
1082999670 11:59279964-59279986 CTGAACTGCCTGTCATAAACTGG + Intergenic
1083268900 11:61560815-61560837 AGAAGCTCCCTGTCACCAACAGG - Intronic
1084929621 11:72544200-72544222 AGGAGCTGCCTGTCATAAACTGG - Intergenic
1088265427 11:107983696-107983718 CTGAACTGCCTATCATAAACTGG + Intergenic
1089018069 11:115183279-115183301 CCATGCTGCCTGTATTAAACAGG + Intronic
1090119186 11:124006288-124006310 CTGAACTGCCTGTTATAAACTGG - Intergenic
1090726202 11:129529517-129529539 CTATGCTGCCTTTCATACACTGG + Intergenic
1091103486 11:132897344-132897366 CGGAGCTGCCCATCATGAACTGG + Intronic
1092381571 12:8001024-8001046 CTGAACTGCCTGTCATGAACTGG + Intergenic
1092984885 12:13836039-13836061 CGAAGCTGCAAGTCCTGAACTGG + Intronic
1093036347 12:14335769-14335791 CTGAGCTGCCTATCATGAACTGG + Intergenic
1097437829 12:59572168-59572190 CTGAACTGCCTGTCATGAACTGG - Intergenic
1097564640 12:61252358-61252380 CTGAACTGCCTATCATAAACTGG - Intergenic
1098805382 12:75015598-75015620 CCAAACTGCCTATCATGAACTGG + Intergenic
1101264141 12:103066208-103066230 CTGAACTGCCTATCATAAACTGG + Intergenic
1106176537 13:27336989-27337011 CGAAGCTGGCTGTAGGAAACCGG - Intergenic
1115130702 14:30049346-30049368 CTAAACTGCCTATCATGAACTGG + Intronic
1115143408 14:30199460-30199482 CTGAACTGCCTATCATAAACTGG + Intergenic
1115782072 14:36780644-36780666 TGAAACTACCTGTCATTAACAGG - Intronic
1116531447 14:45978142-45978164 CTGAACTGCCTGTCATGAACTGG - Intergenic
1118385491 14:65252459-65252481 CTGAGCTGCCTATCATGAACTGG - Intergenic
1123908487 15:24943568-24943590 CTAAGCTGCCCTTCATGAACTGG - Intronic
1124889681 15:33721091-33721113 CCAAGCTGCCTTTAATAACCTGG - Intronic
1125021040 15:34987329-34987351 CTAACCTGACTCTCATAAACAGG - Intronic
1138639690 16:58374741-58374763 CTAAGCACCCTGTCACAAACTGG + Intronic
1143050107 17:4118276-4118298 CTGAACTGCCTGTCATGAACTGG - Intronic
1146850943 17:36221126-36221148 CTGAACTGCCTGTCATGAACTGG + Intronic
1153100842 18:1467763-1467785 CGAGGCTGCCTGTCACATCCCGG - Intergenic
1153435771 18:5066572-5066594 GCAAGCTGCCTGTCACCAACAGG - Intergenic
1157224662 18:45851799-45851821 AGAAGCTGCCTGTCTGAATCAGG - Exonic
1157998495 18:52588042-52588064 CTGAACTGCCTGTCATGAACTGG - Intronic
1158216529 18:55105705-55105727 CAAAGGTGCATGTTATAAACAGG + Intergenic
1159561875 18:70004107-70004129 TGAAGCTGACAGTCATCAACAGG - Exonic
925742055 2:7014516-7014538 AGATGCTGCCTGCCCTAAACAGG + Exonic
926826770 2:16913750-16913772 CTGAACTGCCTATCATAAACTGG + Intergenic
927660440 2:24988751-24988773 CTGAACTGCCTATCATAAACTGG + Intergenic
939017206 2:136916653-136916675 GGAAGCTGAATGTCATACACAGG - Intronic
940033524 2:149289374-149289396 CTTAGCTGCCTGTCAAAATCTGG - Intergenic
943384054 2:187181006-187181028 CAGAACTGCCTGTCATGAACTGG - Intergenic
946066739 2:216994389-216994411 AGAAGCTGCCTGTGAAAAGCAGG - Intergenic
946527856 2:220539883-220539905 CTGAACTGCCTATCATAAACTGG - Intergenic
947066113 2:226227428-226227450 CTTAGCTGCCTATCATGAACTGG + Intergenic
947467777 2:230369294-230369316 CCAAGCTGCCTCTCATGCACTGG - Intronic
1181420663 22:22795914-22795936 CTGAACTGCCTGTCATGAACTGG + Intronic
949638788 3:6012600-6012622 CTAAACTGCCTATCATGAACTGG + Intergenic
949905883 3:8858140-8858162 TTGAGCTGCCTGTCATAAGCTGG + Intronic
949958876 3:9294834-9294856 AGAAGATGCCTGGCATAAGCAGG - Intronic
951970752 3:28441782-28441804 CTAAACTGCCTATCATGAACTGG - Intronic
953327079 3:42021527-42021549 CGAAGCTGCCTGTCATAAACAGG - Intronic
955076290 3:55616880-55616902 CCAAGCTGACTGTGAAAAACAGG + Intronic
955418744 3:58716486-58716508 CTGAGCTGCCTGTCATGACCTGG - Intergenic
956506006 3:69940792-69940814 CTAAACTGCCTGCCCTAAACAGG - Intronic
957024265 3:75163118-75163140 CGCAGTTGCCTGAAATAAACTGG - Intergenic
961095171 3:124148323-124148345 TGAAGATTCCTCTCATAAACTGG - Intronic
962290981 3:134136145-134136167 CTACGCTGCCTGGCAAAAACTGG + Intronic
965893145 3:173540011-173540033 CTGAGCTGCCCATCATAAACTGG - Intronic
968449001 4:666395-666417 CGAGCCTGCCTGACAGAAACTGG - Intronic
969887561 4:10229177-10229199 CTGAGCTGGCTGTCATAAACTGG + Intergenic
973098063 4:46226844-46226866 CTGAGCTGCCTGTCATGAACTGG + Intergenic
973130182 4:46639612-46639634 CTGAACTGCCTGTCATGAACTGG - Intergenic
974289578 4:59912825-59912847 CTGAACTGCCTATCATAAACTGG + Intergenic
974479031 4:62420753-62420775 CTAAACTGCCTATCATGAACAGG - Intergenic
977430775 4:96928295-96928317 CTGAACTGCCTGTCATGAACTGG + Intergenic
977834427 4:101631947-101631969 AGATGCTGCCTGTCATTTACAGG - Intronic
977847088 4:101779138-101779160 TTGAGCTGCCTATCATAAACTGG - Intronic
978665301 4:111174871-111174893 TGAAGCTGCCCCTCATGAACTGG + Intergenic
980629530 4:135414369-135414391 CTGAACTGCCTGTCATGAACTGG + Intergenic
982597768 4:157406943-157406965 CTGAACTGCCTGTCATAAACTGG - Intergenic
984181767 4:176491722-176491744 CCAGGCTGCCTTTCAAAAACTGG + Intergenic
986959845 5:13199302-13199324 CTGAACTGCCTGTCATGAACTGG + Intergenic
988188784 5:27901319-27901341 CTGAACTGCCTATCATAAACTGG + Intergenic
988228778 5:28448210-28448232 CTAATCTGCCTATCATGAACTGG + Intergenic
989486375 5:41996275-41996297 CTGAACTGCCTGTCATGAACTGG - Intergenic
991946155 5:71900225-71900247 CTGAACTGCCTATCATAAACTGG + Intergenic
992489025 5:77222882-77222904 CAAAGCTGCCAGACATAAATAGG + Intronic
999316609 5:150588298-150588320 GGAAGCTGCGTGTTATAAAAGGG + Intergenic
1002997975 6:2304830-2304852 CTGAACTGCCTGTCATGAACTGG + Intergenic
1007055125 6:38875399-38875421 CCATGCTGCCTGTCTAAAACAGG + Intronic
1007971663 6:46057807-46057829 CACAGCTGGCTGTCATGAACTGG - Intronic
1011069112 6:83361750-83361772 CTGAACTGCCTGTCATGAACTGG + Intronic
1012108558 6:95197652-95197674 CTGAGCTACCTGTCATAAACTGG - Intergenic
1012820814 6:104083003-104083025 CTGAACTGCCTGTCATGAACTGG + Intergenic
1013311611 6:108900155-108900177 GGAAGCTGAGTCTCATAAACTGG + Intronic
1015095442 6:129409516-129409538 CTAAACTGCCTTTCATGAACTGG - Intronic
1018122919 6:160655137-160655159 TGAACCTGCCTATCATGAACTGG - Intronic
1021988821 7:26123007-26123029 CTGAACTGCCTGTCATGAACTGG + Intergenic
1022413297 7:30156079-30156101 CGGACCTGCCTGTGATAACCAGG - Intronic
1023844884 7:44115002-44115024 AGAAGCTGCCAGAAATAAACAGG + Intronic
1024063583 7:45715953-45715975 GGGAGCTCCCTGTCATAACCAGG - Exonic
1028043868 7:86091549-86091571 CTGAACTGCCTATCATAAACTGG + Intergenic
1028237830 7:88382905-88382927 CTGAACTGCCTGTCATGAACTGG + Intergenic
1031682048 7:124687442-124687464 CCAAACTGCCTATCATGAACTGG + Intergenic
1031767836 7:125803782-125803804 CTGAGCTGCCTGTCATGAACTGG + Intergenic
1033858240 7:145592211-145592233 CTGAGCTGCCTGTCATGATCTGG + Intergenic
1035825401 8:2639448-2639470 GGAGGCTGCCTTTCATTAACAGG - Intergenic
1035945934 8:3962478-3962500 GCATGCTGGCTGTCATAAACAGG - Intronic
1039262045 8:35782441-35782463 TTAAGCTGCCTATAATAAACTGG - Intronic
1040030975 8:42823347-42823369 CTGAGCTGCCTATTATAAACTGG - Intergenic
1044202400 8:89452571-89452593 CTGAACTGCCTATCATAAACTGG + Intergenic
1044285967 8:90412364-90412386 CTGAACTGCCTATCATAAACTGG - Intergenic
1046575606 8:116024948-116024970 CCAAGCTTCCTGTCATGATCTGG - Intergenic
1052561516 9:30089673-30089695 CTGAACTGCCTATCATAAACTGG - Intergenic
1053223561 9:36331898-36331920 CAAAGCTGCCTGGCATAAGCTGG + Intergenic
1055786131 9:79870730-79870752 CCAAGCTGACTAACATAAACAGG + Intergenic
1058544158 9:106042667-106042689 CTGAACTGCCTATCATAAACTGG - Intergenic
1062565012 9:137160379-137160401 GGAAGATGCCTGGCATACACGGG + Intronic
1186279507 X:7977201-7977223 CTGAACTGCCTTTCATAAACTGG + Intergenic
1188232283 X:27679547-27679569 CCCAGCTGCTTGTCATGAACTGG - Intronic
1189032428 X:37464197-37464219 CTAAACTGCCTATCACAAACTGG - Intronic
1191719231 X:64215627-64215649 CTGAACTGCCTGTCATGAACTGG - Intergenic
1192059346 X:67807431-67807453 CTGAGCTGCCTATCAGAAACTGG - Intergenic
1194443559 X:93961184-93961206 CTGAGCTGCCTATCATGAACTGG + Intergenic
1194521090 X:94919520-94919542 CTGAACTGCCTATCATAAACTGG + Intergenic
1195782344 X:108479784-108479806 TTAAACTGCCTGTCATAAACTGG - Intronic
1197044424 X:121978406-121978428 CTAAACTGCCTATCATGAACTGG + Intergenic
1197591875 X:128419465-128419487 CTGAACTGCCTGTCATGAACTGG + Intergenic
1198587655 X:138140538-138140560 CTAAGCTGCCCCTCATAAATTGG - Intergenic
1198673937 X:139111686-139111708 CGCTGCTGCTTCTCATAAACGGG + Intronic
1198783029 X:140257716-140257738 CTAAACTGCCTATCATGAACTGG - Intergenic
1199310416 X:146314319-146314341 CTTAACTGCCTATCATAAACTGG - Intergenic
1200340483 X:155390561-155390583 CTGAACTGCCTGTCATGAACTGG - Intergenic