ID: 953336366

View in Genome Browser
Species Human (GRCh38)
Location 3:42097757-42097779
Sequence CGTACCTGAACTTTATATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 43}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953336364_953336366 -4 Left 953336364 3:42097738-42097760 CCATGCGGCACCTGCTGGGCGTA 0: 1
1: 0
2: 2
3: 5
4: 84
Right 953336366 3:42097757-42097779 CGTACCTGAACTTTATATCAAGG 0: 1
1: 0
2: 0
3: 1
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953336366 Original CRISPR CGTACCTGAACTTTATATCA AGG Intronic
906916733 1:50020131-50020153 GTTACCTGAACTGTGTATCATGG - Intronic
918880386 1:190111784-190111806 GGTCCCTGAACTTGATTTCAGGG - Intronic
923933548 1:238732353-238732375 TGAATCTGAACTTTATATAAGGG - Intergenic
1064100049 10:12455623-12455645 GGAACCTAAACTTTATATGATGG - Intronic
1064913443 10:20428618-20428640 TGTCCCTGAACTTTTTATCTTGG - Intergenic
1065097477 10:22295994-22296016 CATATCAGAACTTTATTTCAAGG - Intergenic
1066035333 10:31475820-31475842 CTTACCTGTGCTTTATATGATGG - Intronic
1066610157 10:37236662-37236684 CAAACCTGAACTTAATTTCAAGG - Intronic
1078599225 11:12715756-12715778 CTTACCTGAAATTTGAATCATGG - Intronic
1091014196 11:132035129-132035151 CGTACATGAACTTGATATTCAGG + Intronic
1096163221 12:49398282-49398304 TGAACTTGAACTTTATATAAGGG + Intronic
1098336714 12:69412307-69412329 TGAACCTGAACCTTATCTCAAGG + Intergenic
1106316961 13:28602826-28602848 GGGACCTGAACAATATATCATGG - Intergenic
1118985389 14:70750106-70750128 TGTACCTGAAGTTTATTACATGG - Intronic
1122497423 14:102168623-102168645 AGTAGTTGAACTTTATATGAAGG + Intronic
1128929184 15:71688978-71689000 CGTTCCTGAGCTTTATCTCATGG - Intronic
1140516469 16:75546139-75546161 GGTCCCTGAACTTCATATCTGGG + Intronic
1146462507 17:33057378-33057400 CATACCTGAGCTATAAATCAAGG + Intronic
1157220172 18:45823930-45823952 AGCACCTGAACCTTATATCTGGG + Intergenic
939716362 2:145589109-145589131 AGTACCTGATCTTTTTTTCATGG + Intergenic
941355558 2:164486976-164486998 CCTTCCTGAACTTTAGATCCAGG - Intergenic
941412181 2:165172570-165172592 AGTACCTGAACCTTAAATTACGG - Intronic
942414142 2:175740883-175740905 CTTACATGAACTGTATCTCATGG - Intergenic
944876795 2:203970589-203970611 GGTACCTGGATTTTATACCACGG - Intergenic
1169698414 20:8418174-8418196 CTTAACTGAACTGTAAATCAAGG - Intronic
1178478647 21:32959533-32959555 CATAACTGAATTTTATAGCATGG + Intergenic
951414995 3:22413449-22413471 AGTTCCTGAACATTTTATCAAGG + Intergenic
951742389 3:25938847-25938869 AGTTCCTCAATTTTATATCAGGG - Intergenic
953336366 3:42097757-42097779 CGTACCTGAACTTTATATCAAGG + Intronic
960295518 3:115938642-115938664 CGTACCTGAATTTTATACATGGG - Intronic
961102957 3:124217394-124217416 GATACCTGAACATTGTATCAGGG + Intronic
966189989 3:177263441-177263463 CGCACATGAAGTTTAGATCAAGG - Intergenic
971148956 4:24010716-24010738 TGTACCTAAACTATAAATCATGG + Intergenic
971232435 4:24810538-24810560 GGTCCTTGAACTTTATATCCAGG + Intronic
972153372 4:36124493-36124515 CTTACCTGACCTTTATATTTTGG - Intronic
972276321 4:37561094-37561116 TGCACCTGAATTTCATATCAAGG - Intronic
972737717 4:41861362-41861384 GATACTTGAACTTGATATCAAGG + Intergenic
973308580 4:48681186-48681208 TGTACCTGAACTTCTCATCAAGG - Intronic
978549408 4:109909116-109909138 TGTTCTTGAACTTTATATAAAGG - Intergenic
982422943 4:155219258-155219280 CTTACCTGAGTTTAATATCATGG - Intergenic
1012344730 6:98171354-98171376 CGTATCTGCCCTTTACATCATGG - Intergenic
1017370104 6:153694951-153694973 AGTTCCAGAACTTTGTATCAGGG - Intergenic
1017605951 6:156133367-156133389 CTTAACTGAACTTAATATGAAGG + Intergenic
1040770256 8:50966055-50966077 TGTACCTGAAATTTATAAAAGGG - Intergenic
1187434489 X:19254751-19254773 TGTAGCTGAACTCTAGATCAGGG + Intergenic