ID: 953338116

View in Genome Browser
Species Human (GRCh38)
Location 3:42111140-42111162
Sequence CTCCTTCTGGACCTTCTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 279}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953338116_953338118 3 Left 953338116 3:42111140-42111162 CCAGACAGAAGGTCCAGAAGGAG 0: 1
1: 0
2: 1
3: 22
4: 279
Right 953338118 3:42111166-42111188 TGAACCCAGAAAATCTGAGACGG 0: 1
1: 5
2: 14
3: 62
4: 347

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953338116 Original CRISPR CTCCTTCTGGACCTTCTGTC TGG (reversed) Intronic
900894215 1:5471999-5472021 CTCCTCCGGGACCTCCTGTCTGG + Intergenic
901442529 1:9287170-9287192 CACCTTCTGACCCTTCTGTCTGG + Intergenic
903386146 1:22928211-22928233 CTCCTGCTGTCCCCTCTGTCTGG - Intergenic
903623767 1:24716664-24716686 CTCCTGCTAGGCCCTCTGTCTGG + Intergenic
904644805 1:31957713-31957735 CTCCTTCCTGAGCTTCTGTGAGG + Intergenic
905731300 1:40301064-40301086 CTCCCCCAGGACCTTCTGTCTGG - Exonic
905867127 1:41382427-41382449 CTCCTGCTGGACGCTCTGCCGGG + Exonic
906148568 1:43574670-43574692 CTCCTTATGGACCTCCTGAAAGG + Intronic
908042885 1:60134115-60134137 CTCCTTCTGGACTTATTTTCTGG + Intergenic
908506274 1:64804097-64804119 CTCCTGCTGGTCCTTCTTCCTGG + Intronic
908890733 1:68844638-68844660 CTGCTTCTGGGGCTTCTGTGGGG - Intergenic
910712165 1:90193322-90193344 CTCCATATGGCCCCTCTGTCAGG - Intergenic
910826873 1:91418508-91418530 TTCCTCCTGGATCCTCTGTCTGG - Intergenic
914223782 1:145703652-145703674 CTCCTGCTGTTCCTTCTGCCTGG - Intronic
915717072 1:157954756-157954778 TTTGTTCTGGACCTTCTGCCTGG + Intergenic
915975845 1:160388150-160388172 ATCCTTGTTAACCTTCTGTCTGG + Intergenic
917950721 1:180031473-180031495 ATCTTTCTGGACATTCTGTGAGG + Exonic
919742766 1:200990705-200990727 CTTCTTCTGGAACTTCTTTCTGG + Exonic
920543279 1:206795124-206795146 CTCCAGCTGGCCCTTGTGTCTGG - Intergenic
920647750 1:207815763-207815785 CTCCTTCTGGCTTTTCTGTGTGG - Intergenic
1064572907 10:16714380-16714402 CTGCTACTGGACCAGCTGTCAGG + Intronic
1068958707 10:62844961-62844983 CTCCTTCTTGTCCTTGTGTCTGG + Intronic
1069614615 10:69799043-69799065 CTCCTGCTAGACCCTCTGCCAGG - Intergenic
1069756555 10:70777321-70777343 CTCCTTCTGCTCCTTCTGCTGGG + Exonic
1069772113 10:70906615-70906637 CACCTTCTGGACATTCTCTCTGG - Intergenic
1070448463 10:76532352-76532374 AACCTTCTGGGCCTTCTGTTTGG + Intronic
1071420361 10:85490739-85490761 TTCCTTGTTGATCTTCTGTCTGG - Intergenic
1071731046 10:88248913-88248935 CTTCTGCTGTTCCTTCTGTCTGG + Intergenic
1073598673 10:104824851-104824873 TTTCTTCTGGAGCTTCTGTCAGG - Intronic
1073687337 10:105769756-105769778 CTCCTACTGGATTTTCTGTCGGG - Intergenic
1076130134 10:128008328-128008350 CTCCTCCTGGAGCTTCTGGAAGG + Intronic
1077062862 11:625414-625436 TTCCTTCAGAACCTGCTGTCAGG - Intronic
1077411695 11:2406732-2406754 CTCCTTCTGGACTGTCTCCCAGG + Exonic
1078242573 11:9543888-9543910 ATCCTTGTTGACTTTCTGTCTGG + Intergenic
1078508611 11:11969248-11969270 CAGCTCCTGGACCTGCTGTCAGG + Intronic
1078517052 11:12031788-12031810 CTGCTTCTGGGCCTTGTCTCTGG + Intergenic
1080486283 11:32710733-32710755 TTCTTTGTTGACCTTCTGTCTGG + Intronic
1080488885 11:32741218-32741240 CTCTTTGTTGACTTTCTGTCTGG + Intronic
1080599666 11:33809454-33809476 CTCCCTCTGGGCCTCCAGTCTGG - Intergenic
1082622953 11:55446337-55446359 CTTCCTCTGGACACTCTGTCAGG + Intergenic
1082625507 11:55479532-55479554 CTTCCTCTGGACATTCTATCAGG + Intergenic
1082735814 11:56854526-56854548 ATCCTGATGGATCTTCTGTCCGG + Intergenic
1085217299 11:74843959-74843981 CTCCTCCATGACCTTCTGCCAGG - Exonic
1090265933 11:125352931-125352953 CTCCTTCTGAACTTTGTCTCGGG - Intronic
1090484544 11:127101147-127101169 CTCATTCTGGTCCAGCTGTCTGG - Intergenic
1090822711 11:130358154-130358176 ATCCTTATTGATCTTCTGTCTGG + Intergenic
1090881497 11:130835809-130835831 TTCCTTATTGATCTTCTGTCTGG + Intergenic
1090950822 11:131471778-131471800 CTGCTCCTGGAGGTTCTGTCTGG + Intronic
1091873123 12:3911751-3911773 CTCCTCCTTCACCTTCTGCCAGG + Intergenic
1095150638 12:38791684-38791706 TTCCTTGTTGACCTTTTGTCTGG - Intronic
1095195268 12:39307582-39307604 CTGCTTCTGGAAATGCTGTCAGG - Exonic
1095363275 12:41370664-41370686 CTTCTTCTGGAACTTCTTTTAGG + Intronic
1096111326 12:49030938-49030960 CTCCTTCCGCAGCTTCTTTCGGG + Exonic
1097544031 12:60976239-60976261 CTCCTTCAGGAGCTTTTGTAGGG + Intergenic
1097950705 12:65424856-65424878 TTCCTTATTGACTTTCTGTCTGG + Intronic
1098624526 12:72646917-72646939 TTCCTTATTGATCTTCTGTCTGG - Intronic
1098767327 12:74507071-74507093 ATCCTTGTTGACTTTCTGTCTGG + Intergenic
1098958565 12:76714038-76714060 TTCCTTCTGGAAGTTCTATCTGG + Intergenic
1100047518 12:90400751-90400773 ATCTTTCTCGAGCTTCTGTCTGG - Intergenic
1100525201 12:95412607-95412629 GTCTATGTGGACCTTCTGTCTGG - Intergenic
1100600236 12:96106724-96106746 TTCCTTCTTGACCTTCCATCTGG - Intergenic
1101677577 12:106932224-106932246 TTCCTTTGGGACCTTCTGCCTGG + Intergenic
1101784268 12:107869049-107869071 TTCTTTATTGACCTTCTGTCTGG - Intergenic
1106638151 13:31553226-31553248 CTCCTTCTGGAGCCCATGTCTGG - Intergenic
1106679711 13:31997570-31997592 CTCCTGTGGGCCCTTCTGTCTGG + Intergenic
1106872466 13:34036774-34036796 GTCCTTCTGCCCCTTCTTTCAGG - Intergenic
1108952215 13:56109233-56109255 TTCCTTTTTGATCTTCTGTCTGG + Intergenic
1111110914 13:83708138-83708160 CTTTTTCTGGATATTCTGTCTGG + Intergenic
1112306779 13:98281496-98281518 CTCCTTATTGCCCTCCTGTCAGG + Intronic
1112631289 13:101163867-101163889 CTCCTTCTGGAGGTTCTGAGGGG + Intronic
1114555763 14:23561431-23561453 CCCCTTCTGTCCCTTCTGCCAGG - Exonic
1116503492 14:45649843-45649865 CTCCTTCTGGATCTTCAGCGGGG + Intergenic
1117822597 14:59666032-59666054 ATCCTTGTTAACCTTCTGTCTGG - Intronic
1119719813 14:76883169-76883191 CTCCATCTCGACCTTCTTCCCGG - Intergenic
1121027650 14:90628350-90628372 CTCCTAGAGGACCTTCTCTCTGG + Intronic
1122104310 14:99440640-99440662 CTCTTTCTGCACCTTCTTACTGG - Intronic
1122467049 14:101940925-101940947 CTTCTTATGGACCTTGTGTCAGG - Intergenic
1122588197 14:102825755-102825777 GTTCTTCTGGAACTTCTGTGGGG + Intronic
1122756836 14:103987792-103987814 CTACTTCTTGATCTTCTGCCTGG + Intronic
1123843026 15:24268606-24268628 TTCCTTCTGGATCTCCTTTCCGG + Intergenic
1123858065 15:24434684-24434706 TTCCTTCTGGATCTCCTTTCCGG + Intergenic
1123981093 15:25604467-25604489 TTCCTTCTTGATTTTCTGTCTGG + Intergenic
1125412878 15:39423018-39423040 ATCCTTGTTGACTTTCTGTCTGG - Intergenic
1125414613 15:39439170-39439192 CTCCCCCTGGACCATCTCTCTGG - Intergenic
1125837614 15:42766724-42766746 ATCCTTGTTAACCTTCTGTCTGG - Intronic
1126009312 15:44287876-44287898 CAGCTTCTGGACTTTCTGTTTGG + Intergenic
1126297124 15:47152597-47152619 CCCCTTCAGGATCTTCTGTATGG + Intergenic
1126858891 15:52864944-52864966 CTCCTTCTGGTCCTTGACTCAGG + Intergenic
1127011812 15:54639244-54639266 TTCCTTGTTGACTTTCTGTCTGG - Intergenic
1128087918 15:64898486-64898508 CTCCTCCTCGCCCTTCTGCCAGG - Intronic
1128713271 15:69887880-69887902 CTCCTGCTGGTCCCTCTGCCTGG - Intergenic
1128917984 15:71583949-71583971 TTCCTTATGGATTTTCTGTCTGG + Intronic
1130326626 15:82886444-82886466 ATCCTTGTTGACTTTCTGTCTGG + Intronic
1130711406 15:86285251-86285273 CTCCTGCTGGACCTGCCATCAGG - Intronic
1132079134 15:98850273-98850295 CTCCTTCTCAACCTTCATTCAGG - Intronic
1132499744 16:280172-280194 CTCCTGAGGGAGCTTCTGTCTGG - Intronic
1134088850 16:11378927-11378949 TTCCTTCTTGATCTTCTGTCTGG + Intronic
1135122477 16:19778322-19778344 CTCCCTGTGGGCCTTCTGTGGGG + Intronic
1142187092 16:88699676-88699698 CTGCTCCTGGACCTTCAGGCAGG + Exonic
1142360386 16:89623485-89623507 GTTCATCTGGACCTTCTGTTGGG - Intronic
1144286863 17:13785426-13785448 CTCCTTCTAGACCTTCTAGAGGG - Intergenic
1146893135 17:36521500-36521522 CTCCTTCTGGAACTTCTGTGAGG - Intronic
1148071871 17:44913380-44913402 CTCCACATGGACCTGCTGTCGGG + Exonic
1148565978 17:48633357-48633379 CTCCTTCCTGACCTTCGGTCTGG + Intronic
1149332471 17:55599875-55599897 TTCCTTGTCGATCTTCTGTCTGG + Intergenic
1149836947 17:59921596-59921618 TTCAATCTGGACATTCTGTCTGG + Intronic
1151399494 17:73846669-73846691 CCCTTCCTGGACCTTTTGTCTGG + Intergenic
1151513903 17:74579997-74580019 CTCCTTCAAGACCTTCTTTGTGG + Exonic
1152326460 17:79642712-79642734 CTCCTTCTCGGCCTTCTTTGTGG - Intergenic
1153910009 18:9698437-9698459 CTCCACCTGGCCCTTCTTTCTGG + Intergenic
1155566261 18:27138021-27138043 CTCCTTCTAGCACTTCTATCTGG + Intronic
1155675058 18:28420092-28420114 ATCCTTGTTGACTTTCTGTCTGG + Intergenic
1157608053 18:48938692-48938714 CTCCATCTGGAGTTTCTGTCTGG - Intronic
1158492323 18:57921256-57921278 TTCCTTCCGGACCTTCTTTTGGG + Intergenic
1161237761 19:3206254-3206276 CTCCTGCTGGATCTGCTGTAGGG - Exonic
1161837435 19:6657516-6657538 CTCCTTGTGCCCCTTCTGGCCGG - Intergenic
1162080374 19:8214431-8214453 CACCTGCTGGGCCTTCTGCCCGG - Intronic
1163097717 19:15072261-15072283 CACCTCCATGACCTTCTGTCTGG - Intergenic
1165481566 19:36067575-36067597 CTGCTTCTGGGCCTACTCTCAGG + Intronic
1165975606 19:39673643-39673665 TTCCTGCTGGACCATCTGTGAGG - Intergenic
925205548 2:2002913-2002935 CTCCTTCTTTACCTTCTGCCAGG + Intronic
925303758 2:2835101-2835123 CTTCTTCTGGATGTTCTGCCTGG - Intergenic
925425161 2:3743350-3743372 TTCCTTATTGACTTTCTGTCTGG - Intronic
926551846 2:14310532-14310554 CTGCTCCTGGAGCTTCTGTGTGG - Intergenic
927378450 2:22447720-22447742 CTTCTTATGGAACTTCTATCAGG - Intergenic
927761604 2:25761140-25761162 CTCATTCTTGAGCTTCAGTCAGG - Intronic
929781340 2:44959159-44959181 CTCCTTCTGGCCCATCTGCAGGG - Intergenic
931523868 2:63130743-63130765 GTCCTTATTGATCTTCTGTCTGG + Intronic
931778242 2:65558018-65558040 CACCATCTGGACCTTCTCCCTGG + Intergenic
934777847 2:96950306-96950328 CTCCTTCTGGGCCTTGGGTGGGG + Intronic
934852749 2:97711874-97711896 CTCCTTGGGGACCTCCTTTCTGG - Intergenic
934880511 2:97972780-97972802 CTCCTTATGTGCCTTCTCTCTGG - Intronic
934887386 2:98036828-98036850 CTCCTCCTGGGCCTGCTCTCAGG - Intergenic
935605011 2:104962907-104962929 TTCCTTATTGATCTTCTGTCTGG + Intergenic
936166824 2:110128182-110128204 CTCCTTCTGTTTCTGCTGTCAGG + Intronic
936786936 2:116104814-116104836 CTCTTTCTGAAACTTCTGTATGG + Intergenic
938766004 2:134460779-134460801 CACCTGGTGGACCTGCTGTCAGG - Intronic
940316738 2:152335248-152335270 CTCCTACTCGGCCTTCTGCCGGG - Exonic
943006024 2:182388276-182388298 TTCCTTCTTGATTTTCTGTCTGG - Intronic
943661057 2:190559798-190559820 CTACTTCTGGACCTGCTGCCAGG - Intergenic
944632940 2:201645261-201645283 CTCCTCCTGAGCCTTCTGTATGG + Exonic
946479535 2:220040803-220040825 CTCCTTCTGGGTCTCCTGTGGGG + Intergenic
947457995 2:230273940-230273962 CACCTTCTGAACCTTCTGATAGG - Intronic
947576964 2:231283226-231283248 CTCCTTCTGGAACTCCTATTGGG - Intronic
948897246 2:240933216-240933238 CTCCTGCTGGAGCTTCTGTGCGG - Intronic
1170457193 20:16544248-16544270 CTCATGCTGGTCCTTCTGCCTGG + Intronic
1170981040 20:21213232-21213254 TTCCATCCAGACCTTCTGTCCGG + Intronic
1172779223 20:37425942-37425964 CACCTTCTGCACCTTCTCACTGG + Intergenic
1172956982 20:38767911-38767933 CTCATGCTAGTCCTTCTGTCTGG - Intronic
1173104525 20:40121002-40121024 TTCCTTCTGATCCTTCTGCCAGG - Intergenic
1174928289 20:54784962-54784984 ATCCTTGTTGACTTTCTGTCAGG - Intergenic
1176926506 21:14756428-14756450 TTCCTTATTGATCTTCTGTCTGG - Intergenic
1177945656 21:27466424-27466446 CCCCTTCTGGACTTGCTGTGAGG + Intergenic
1178194244 21:30324882-30324904 TTCCTTTTTGATCTTCTGTCTGG + Intergenic
1178806821 21:35846281-35846303 CTCTTTCTGTACCTGCCGTCAGG + Intronic
1180211471 21:46297531-46297553 CTCCTTCTGGAACATCTGGAAGG - Exonic
1180567468 22:16685694-16685716 TTCCTTATTGATCTTCTGTCTGG - Intergenic
1181475191 22:23163804-23163826 CTCCTTCTGGACATACTGCCTGG + Exonic
1184406709 22:44304633-44304655 CTCCTTCTGGCCCTCCTGGGAGG + Intronic
1185068308 22:48642941-48642963 CTCCTTCTGGGACTACTGACAGG - Intronic
1185172182 22:49300461-49300483 CTCCTTCCAGCCCTTCTCTCGGG - Intergenic
950314550 3:11988982-11989004 CTGCATCTGCACCTCCTGTCTGG - Intergenic
951439813 3:22709488-22709510 ATCCTTGTTAACCTTCTGTCTGG - Intergenic
951919660 3:27840571-27840593 CACTTTCTGGTCCTTCTATCTGG - Intergenic
952611721 3:35217183-35217205 CTCCTTCTGGAGTTTCTGCCTGG - Intergenic
953338116 3:42111140-42111162 CTCCTTCTGGACCTTCTGTCTGG - Intronic
953787329 3:45921104-45921126 CTCTTTCTGGCCCTTTTGTCTGG - Exonic
953983770 3:47426236-47426258 GTCCTGATGGACCCTCTGTCCGG - Intronic
954547348 3:51448769-51448791 TTCCTTATTGATCTTCTGTCTGG - Intronic
955090706 3:55748010-55748032 TTCCTTCTGCAGCTGCTGTCTGG - Intronic
955262002 3:57400811-57400833 TTCCTTATTGATCTTCTGTCAGG - Intronic
955689014 3:61572418-61572440 CTCGTTCTGGATCTTGTGTCTGG + Intronic
955818546 3:62873847-62873869 CGCCCTCTGGTCCTTCCGTCCGG - Intronic
955839630 3:63097715-63097737 CTCCTACTGGAATTTCTGCCTGG - Intergenic
958412514 3:93834831-93834853 ATCCTTCTTAACTTTCTGTCTGG - Intergenic
961017617 3:123479792-123479814 CTCCTTCTGCACCTGCAGGCTGG - Intergenic
961072883 3:123952647-123952669 CTCCTTATGTACTTTCTATCTGG - Intronic
961813019 3:129532561-129532583 CTCCTTCTCTGCCTTCTGTGTGG - Exonic
962735730 3:138323569-138323591 ATCCTTCTGGAACCTCTGTGTGG - Intronic
964631887 3:158819580-158819602 CTCCTTAGGAACCTTCTGTTTGG + Intronic
965605601 3:170495385-170495407 CTCCTTCTGGAATCTCTGCCTGG + Intronic
966281014 3:178229132-178229154 TTCCTTATTGATCTTCTGTCTGG + Intergenic
966288606 3:178327550-178327572 CTCCTTCTGGACATTTTTTTGGG - Intergenic
968018374 3:195360467-195360489 TTCCTTGTGGATTTTCTGTCTGG - Intronic
968120216 3:196120636-196120658 CCCCTTCTTGATCTTCGGTCTGG - Intergenic
968339959 3:197947261-197947283 CACTTCCTGAACCTTCTGTCAGG - Intronic
968713326 4:2136761-2136783 TTCCATCTGGAGCTTCAGTCAGG - Intronic
969078776 4:4601975-4601997 CTGCTCCCCGACCTTCTGTCGGG - Intergenic
970632785 4:17970191-17970213 CTATTTCTGGATCTTCTATCTGG - Intronic
972480660 4:39492957-39492979 CTCCTTCTGGATGTTGTGGCTGG - Intergenic
972573163 4:40328965-40328987 CTCCTTCTGTTCCCTCTGCCTGG - Intergenic
974049922 4:56931017-56931039 CTCCTTCTGGACCACCTGCATGG - Exonic
974049949 4:56931161-56931183 CTCCTTCTGGACCACCTCTATGG - Exonic
974513655 4:62878693-62878715 TTCCTTCTGGATCTTCTGAAGGG + Intergenic
975062203 4:70017198-70017220 ATCCTTGTTGACTTTCTGTCTGG + Intergenic
975835044 4:78413863-78413885 CTCCTCCGTGACCCTCTGTCTGG + Intronic
979364986 4:119811079-119811101 TTCCTTATTGACTTTCTGTCTGG + Intergenic
980387449 4:132104636-132104658 CTCCTGCTTCACCTTCTGCCAGG + Intergenic
980984295 4:139680852-139680874 CTGATTCTGGACCTTTTGTTTGG + Intronic
982517445 4:156369719-156369741 ATCCTTGTTGACTTTCTGTCTGG - Intergenic
983447082 4:167866122-167866144 CTCCTTAGTGACCTTCAGTCTGG - Intergenic
984061745 4:174997210-174997232 TTCCTTGTTGACCTTCTGTAGGG - Intergenic
985126705 4:186701825-186701847 ATGTTTCTGGAGCTTCTGTCTGG - Intronic
986259912 5:6135000-6135022 CTCCATCTGGAGCCTCTATCTGG - Intergenic
986779325 5:11049654-11049676 TTCCTTCTGAACTTTCTTTCTGG + Intronic
986808165 5:11328667-11328689 CTCCTTCTGGGCTTTCTCTCAGG + Intronic
988884821 5:35545258-35545280 CTCCTTCTGGAGCCTCTGAGGGG + Intergenic
988998642 5:36738600-36738622 CTCATTCTGTTCCTTCTGCCTGG + Intergenic
990900653 5:60745002-60745024 CTCCTTCTGGAATCTCTGCCTGG - Intergenic
993478819 5:88397466-88397488 CTCTTTCTGGCCCTTCTCTATGG - Intergenic
994270409 5:97770148-97770170 ATCCTTGTTGACTTTCTGTCTGG + Intergenic
994618378 5:102133812-102133834 ATCCTTGTTGACTTTCTGTCTGG - Intergenic
994861358 5:105199779-105199801 TTCCTTCTGGACCTCTTGTAAGG - Intergenic
997474656 5:134135820-134135842 CTCCTTCCTGACCTTGTTTCTGG - Intronic
997578029 5:134997710-134997732 CTCCCTCTGCACATTCTCTCTGG + Intronic
997735897 5:136212515-136212537 CTCCTTCCTGACCTTAGGTCTGG + Intergenic
999690519 5:154142179-154142201 ATCCTTCTGGGGCTTTTGTCTGG - Intronic
1000400927 5:160826318-160826340 CTCCAGCTGGTCCTTCTGTTCGG - Intronic
1000598044 5:163238125-163238147 TTCCTTCAGGAGCTCCTGTCAGG - Intergenic
1001757022 5:174178392-174178414 CTACTTCTTGACTTTCTGCCAGG + Intronic
1001837874 5:174847253-174847275 CTCCTTCTCGACCATCTGTGGGG + Intergenic
1002257247 5:177967067-177967089 TTCCTTCAGGACCTGCTTTCAGG + Intergenic
1002671242 5:180869254-180869276 CTCCTTCTAGACCTTTTCCCAGG - Intergenic
1003147825 6:3523578-3523600 CTAGCTCTTGACCTTCTGTCTGG + Intergenic
1003805292 6:9721281-9721303 CTTCTTCTGGTCCTCATGTCTGG - Intronic
1007412284 6:41671893-41671915 CTCCTGCTTGACCTCCTGCCAGG - Intergenic
1008621385 6:53274788-53274810 TTCTTTCTGGTCCTTCTGTATGG - Intronic
1008677262 6:53833119-53833141 CTCCATCTGCACCATCAGTCTGG + Intronic
1009727662 6:67556523-67556545 CTCCTTCTGGAGCTCTTGTACGG + Intergenic
1011425058 6:87218977-87218999 TTCCTTCTGTAACTTCTGACAGG + Intronic
1012288153 6:97418883-97418905 TTCCTTGTGGATTTTCTGTCTGG + Intergenic
1012968305 6:105699419-105699441 CTCCTTCTGCCCCTTTGGTCTGG - Intergenic
1013594321 6:111647033-111647055 CTCCTCCTGGGCCTTGTGCCTGG - Intergenic
1013613115 6:111813922-111813944 ATACTTCTGTGCCTTCTGTCTGG - Intronic
1013997017 6:116320929-116320951 CTCCTTCTTTGCCTTCTGTTAGG - Intronic
1015361519 6:132344960-132344982 CTCCTTTTGCACCTGCTGTTTGG - Intronic
1015539406 6:134298730-134298752 CTCCTTCTGGAATCTCTGCCTGG - Intronic
1016647624 6:146427934-146427956 CTCTCTCTGGCCCTGCTGTCAGG - Intronic
1016996242 6:149964089-149964111 CCGCTTCTGCACCTGCTGTCTGG + Exonic
1018317102 6:162568323-162568345 CTCCTTCTGGAATCTCTGCCTGG + Intronic
1021039513 7:15844518-15844540 CTACTTCTTGATCTCCTGTCTGG - Intergenic
1021615969 7:22503764-22503786 CTCCATGTGGACTCTCTGTCAGG - Intronic
1022541710 7:31143172-31143194 CTCTTTATTGACTTTCTGTCTGG + Intergenic
1022729492 7:33009037-33009059 CAGCCTCTGGACCTTCTGACAGG + Intergenic
1022925764 7:35054967-35054989 CTCCATGTGGACTCTCTGTCAGG - Intergenic
1024187358 7:46964755-46964777 CTTCTTATTGATCTTCTGTCCGG - Intergenic
1024566879 7:50688724-50688746 CACCTTCTGGCCATTCTGTGTGG - Intronic
1028376501 7:90150578-90150600 CTCCATGTGGACTCTCTGTCAGG + Intergenic
1028762159 7:94509196-94509218 CTCCTTCTGTACCTTCCATTCGG + Intergenic
1029275399 7:99400974-99400996 CTTCTTCTGGAACTTCTGCAGGG - Intronic
1032160295 7:129504353-129504375 CTCTTTGTGCACCTTCTCTCCGG + Intronic
1034349822 7:150408401-150408423 CTCCCTCGGGACCCTCTGGCTGG + Intronic
1036436109 8:8735076-8735098 CTTCTTCAGGACATTCTATCTGG - Intergenic
1037576907 8:20214796-20214818 CTTCTGCTTGACCTGCTGTCAGG + Exonic
1039646143 8:39285205-39285227 CTCCTTCTGGTCCTTCTCATGGG + Intergenic
1041265712 8:56062492-56062514 TTCCTTATTGATCTTCTGTCTGG - Intergenic
1042574755 8:70205625-70205647 CTCCTTCTGGGTCTTCTGTTTGG - Intronic
1042740668 8:72041305-72041327 TTCCTTATTGAACTTCTGTCTGG - Intronic
1043063918 8:75542475-75542497 CACCTGCTGTTCCTTCTGTCTGG - Intronic
1044101940 8:88151304-88151326 ATCCTTGTTGACTTTCTGTCTGG - Intronic
1044245000 8:89933453-89933475 CTGTTTCTGGACTTTCTGTTTGG - Exonic
1047129586 8:122003845-122003867 ATCCTTGTTAACCTTCTGTCTGG - Intergenic
1047869432 8:129066324-129066346 CTCCTTCTTGAGTTTGTGTCTGG - Intergenic
1050534417 9:6619435-6619457 CTGCGCCTGGCCCTTCTGTCAGG - Intronic
1050824939 9:9933669-9933691 ATCCTTGTTGACTTTCTGTCTGG - Intronic
1051825937 9:21220007-21220029 ATCCTTGTTGACTTTCTGTCTGG + Intronic
1052147960 9:25074490-25074512 ATCCTTGTTGACTTTCTGTCTGG + Intergenic
1052459724 9:28747141-28747163 CTCCTTCTGGATCCTGGGTCTGG - Intergenic
1053390707 9:37733589-37733611 CACCTTCATTACCTTCTGTCGGG - Exonic
1055091136 9:72365348-72365370 CGCCTCCTGGACCTACTGACAGG - Intergenic
1056668316 9:88599906-88599928 ATCCTTATTAACCTTCTGTCTGG - Intergenic
1056921141 9:90790153-90790175 CTCCTTGTTGAGCTTATGTCCGG - Intergenic
1057692657 9:97299745-97299767 TTCCTTATGAATCTTCTGTCTGG - Intergenic
1058295288 9:103298844-103298866 CTCCTACTGGTTCCTCTGTCTGG - Intergenic
1059346278 9:113631190-113631212 CTCCTTCTGGATCATCTGGAGGG - Intergenic
1059366408 9:113789854-113789876 CTCATGCTGGTCCTTCTATCTGG - Intergenic
1059442264 9:114315086-114315108 CCCCCTCTGGCCCTTCTGGCTGG - Intergenic
1059695418 9:116725793-116725815 CTGCTGCTGGACCTTCTTGCTGG + Exonic
1060038043 9:120275329-120275351 TTCCTTCAGGACCTTTTGTAAGG + Intergenic
1060320537 9:122555331-122555353 CTCCTTCTGTCCCTTCTCTTTGG + Intergenic
1060406812 9:123376913-123376935 CTCCTCCTGGGCCTCCTTTCAGG + Exonic
1186798169 X:13066708-13066730 CTCTTCCTGAACCCTCTGTCTGG + Intergenic
1187767237 X:22655757-22655779 CTCCTTCTGGGTCTCCAGTCTGG - Intergenic
1190981234 X:55458163-55458185 CACCAGCTGGACCTTCTGCCCGG - Intergenic
1190987464 X:55515017-55515039 CACCAGCTGGACCTTCTGCCCGG + Intergenic
1191635957 X:63377014-63377036 TTCCTTCTGGAGCTCCTGTAAGG - Intergenic
1192200423 X:69063016-69063038 CTCCTGCTGAACCTTCAGTGGGG + Intergenic
1192209403 X:69118109-69118131 CTCCTTCTTATCCTGCTGTCAGG - Intergenic
1192702982 X:73496199-73496221 CTCCTTCAGGAGCTTTTGTAAGG + Intergenic
1193571868 X:83153641-83153663 CTCCTTCTGGAGCTCTTGTAAGG - Intergenic
1193770875 X:85585744-85585766 ATCCTTCTTAACTTTCTGTCTGG - Intergenic
1194342150 X:92718174-92718196 ATCCTTGTTAACCTTCTGTCTGG - Intergenic
1195286525 X:103390419-103390441 TTCCTTATTGATCTTCTGTCTGG - Intergenic
1196244888 X:113389575-113389597 CTCCTTCAGGACCTCTTGTAAGG + Intergenic
1196335639 X:114529629-114529651 CTTCTCCTGGACCTTCTTACTGG + Intergenic
1197262598 X:124333970-124333992 GTCCTTCTGTACCTTCTTCCTGG - Intronic
1197437096 X:126444191-126444213 TTCCTTCTTGATTTTCTGTCTGG + Intergenic
1199927085 X:152479521-152479543 CTCCTTCTGGAATCTCTGCCTGG + Intergenic
1200650508 Y:5834870-5834892 ATCCTTGTTAACCTTCTGTCTGG - Intergenic
1202164913 Y:21977395-21977417 TTCCTTCTGAACCTTAGGTCTGG + Intergenic
1202226443 Y:22608979-22609001 TTCCTTCTGAACCTTAGGTCTGG - Intergenic
1202316673 Y:23586683-23586705 TTCCTTCTGAACCTTAGGTCTGG + Intergenic
1202554091 Y:26083375-26083397 TTCCTTCTGAACCTTAGGTCTGG - Intergenic