ID: 953339763

View in Genome Browser
Species Human (GRCh38)
Location 3:42123484-42123506
Sequence AGATCCTGGGGTGCTCCACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 140}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953339763 Original CRISPR AGATCCTGGGGTGCTCCACA CGG (reversed) Intronic
900149843 1:1173594-1173616 AGGTCCTGGGGTGCTGAGCATGG + Intergenic
900420552 1:2554243-2554265 TGACCCTGGGGTCCTGCACAGGG + Intergenic
901218430 1:7567727-7567749 AGATGCTGGGGTGATTCAGATGG + Intronic
902741862 1:18444365-18444387 AGAAACTGGGGTGATACACAAGG - Intergenic
904405054 1:30283000-30283022 AGATCTGGGGCTGCTCCTCAAGG - Intergenic
905731442 1:40301659-40301681 AGACTCCGGGGTGCTCCAAAGGG + Intronic
908485439 1:64587782-64587804 AGATCCTGGGCTCTCCCACAAGG + Intronic
911849791 1:102803779-102803801 ACATCCTGTGGTGCTGTACAAGG - Intergenic
912490677 1:110061009-110061031 AGATCCTGGACTGGCCCACAGGG + Exonic
913194993 1:116448896-116448918 AGCTCCTGGGGTGCTCAGCTGGG + Intergenic
913663989 1:121030795-121030817 ACATTCTGAGGTGCTCTACAAGG - Intergenic
914015381 1:143814074-143814096 ACATTCTGAGGTGCTCTACAAGG - Intergenic
914162404 1:145146934-145146956 ACATTCTGAGGTGCTCTACAAGG + Intergenic
914196828 1:145452035-145452057 AGATCCAGGGGTCCTGCCCAGGG + Intergenic
914653999 1:149722615-149722637 ACATTCTGAGGTGCTCTACAAGG - Intergenic
915030570 1:152877339-152877361 AGAACCAGGGGTGAACCACAGGG + Intergenic
918232735 1:182550773-182550795 TGATGCTGGGGTGCACCCCAGGG + Intronic
918489180 1:185061931-185061953 AGATTCTTGGGTGAACCACAGGG - Intronic
919583649 1:199408781-199408803 ACATATTGGGGTGCTCAACAGGG - Intergenic
920102379 1:203525450-203525472 AGAACCTGGGGTGCTCAGGAGGG + Intergenic
924844324 1:247750061-247750083 AGACCCTGGGGTGGTCCCCATGG + Intergenic
1063950985 10:11223327-11223349 GTATGCTGGGGTGCTCCACAAGG - Intronic
1067700324 10:48566988-48567010 AGATCCTTGAGGGCTCCACCAGG - Intronic
1069712737 10:70500394-70500416 AGATCCTGGCATGGTCCCCAGGG + Intronic
1073588160 10:104730977-104730999 AGACCATAGGGTGATCCACAGGG - Intronic
1074420714 10:113306561-113306583 ACCTCCTAGGGTGGTCCACAGGG - Intergenic
1074967848 10:118508150-118508172 AGAGCCTGGGCTGAACCACATGG + Intergenic
1075720878 10:124586598-124586620 AGGTCCAGGGAGGCTCCACAGGG + Intronic
1076348930 10:129801612-129801634 AGAGCCTGATGTGCTCCACGAGG + Intergenic
1082092716 11:48102911-48102933 AAATCCTGGACTCCTCCACAGGG - Intronic
1083490937 11:63014766-63014788 AGGGCCTTGGGTGCTCCCCATGG - Exonic
1083959767 11:66008029-66008051 GAGTCCTGGGCTGCTCCACAGGG - Intergenic
1084979104 11:72819571-72819593 AGAGCCTGGGGAGCTCGACGGGG - Intronic
1087104711 11:94398103-94398125 AGATAATGGGGTACCCCACAAGG - Intronic
1088927903 11:114320839-114320861 AGATGCTGCGGTGCTACACCTGG + Intergenic
1091281074 11:134382004-134382026 AGATCCTGGTGTGGCACACACGG - Exonic
1096270319 12:50161027-50161049 AGATTCTGGGTTACTCCTCAGGG + Intronic
1096465773 12:51847290-51847312 AGAGACTGGGCGGCTCCACAGGG + Intergenic
1101342380 12:103854398-103854420 AGATCCTTGGGTGCCCTGCAGGG - Intergenic
1110760477 13:79225246-79225268 AGATCCTGGGATGCTTCCTAGGG + Intergenic
1113237070 13:108289276-108289298 AGATCCAGGGGTGCTGAACTGGG + Intronic
1118182920 14:63511271-63511293 AAAGCCTGGGGTTCTCCACTTGG - Intronic
1122723427 14:103735127-103735149 AGACCATGCGGTGCTCCAAAAGG + Exonic
1123693157 15:22856102-22856124 AGAGCCTGGGGAGCTCTCCATGG - Intronic
1127371121 15:58342655-58342677 GGATCCTGGGGAGCTCTGCATGG - Intronic
1134226688 16:12396591-12396613 AGATACTGGCGTCCTCCACATGG + Intronic
1137679150 16:50324057-50324079 ACACCCTTTGGTGCTCCACATGG + Intronic
1138071721 16:53999101-53999123 ACTTACTTGGGTGCTCCACATGG - Intronic
1139061917 16:63263411-63263433 AGATACTGGGCTCTTCCACATGG + Intergenic
1139675037 16:68517714-68517736 AGACCCTGGGTTTCTCCCCAAGG - Intergenic
1140504218 16:75460364-75460386 AGATCCTGGAGGGCTCTACTGGG - Intronic
1140881315 16:79200355-79200377 TGATTCTGGGGTGCTACAAAGGG + Intronic
1141064453 16:80902633-80902655 CCATCCTGGGGTGCTCCAATAGG - Intergenic
1141720226 16:85751532-85751554 AGTCCCTGGGGTCCTGCACAAGG - Intergenic
1142982953 17:3681837-3681859 AGCCACGGGGGTGCTCCACAGGG + Intronic
1143028294 17:3953575-3953597 TGATCCTGGGGAGCTCAGCAAGG + Intronic
1143407436 17:6686711-6686733 AGAGCCTGAGGAGGTCCACAGGG - Intronic
1144834427 17:18149502-18149524 AGAGCCTGCTGTGCCCCACAAGG + Exonic
1150398046 17:64836568-64836590 AGATCTTGGGGAGCTGGACAGGG + Intergenic
1152412182 17:80132909-80132931 AGATCCTGAGGGGCTTCCCAAGG - Intergenic
1156551189 18:38019165-38019187 AGATCCTGGGGTGATCAGCAGGG + Intergenic
1160549107 18:79681678-79681700 AGATCTTGGGGTACCTCACAGGG + Intronic
1160710848 19:550316-550338 AGATCCTGGGATGCTGTTCAAGG - Intergenic
1161135277 19:2615955-2615977 AGATCCTGGGGTGGCCCGTAAGG - Intronic
1161749877 19:6087875-6087897 AGGTGCTGGGTTTCTCCACATGG + Intronic
1166532282 19:43550214-43550236 TGATCATGGGGTGCTCCCCCAGG - Intronic
1168102665 19:54149307-54149329 GGATTCTCGGGTGCTCCACCAGG - Intronic
925121593 2:1422411-1422433 AGAGCCTGGTGTGCCCCTCAGGG + Intronic
930228816 2:48822978-48823000 AGATGCTGGGGTAATTCACATGG - Intergenic
935763658 2:106343675-106343697 AGGGTCTGTGGTGCTCCACAGGG + Intergenic
946164589 2:217856302-217856324 ACATGCTGGGGTTCTCCACGGGG - Intronic
947967777 2:234296554-234296576 AGATCCTGGAGTGCATAACAGGG - Intergenic
948004200 2:234593873-234593895 AGCTCTTGGTATGCTCCACATGG - Intergenic
948432663 2:237929912-237929934 GGGTCCTGGGGTGGCCCACAGGG + Intergenic
1168734058 20:115276-115298 AGGGCCTGTGGGGCTCCACATGG - Intergenic
1169310245 20:4531950-4531972 AGATCCTGGGGTTCCCTACTTGG - Intergenic
1169936737 20:10891717-10891739 ACATCCTGGTATACTCCACATGG - Intergenic
1170657719 20:18305466-18305488 AGATCCTGGGGGGCCACACAGGG - Intronic
1173930078 20:46811153-46811175 AGACCCTGGGGTGCGACAAAGGG + Intergenic
1174461835 20:50688850-50688872 TCATCCTGGGGAGCTCCAAAGGG - Intronic
1175121195 20:56717415-56717437 AGATCCTGGAATGCTCAGCAGGG - Intergenic
1175487617 20:59356655-59356677 GGTTGCTGGGGTGCCCCACAGGG + Intergenic
1175768582 20:61608124-61608146 AGATCCTGGGCTGCAGGACAAGG + Intronic
1175817637 20:61891727-61891749 AGGGTCTGGGGTGTTCCACAAGG - Intronic
1177225158 21:18244716-18244738 AGGTGCTGGGATGCTCCACATGG + Intronic
1179309806 21:40185489-40185511 AGGTCCTGGGCTGCTCCAGTAGG + Intronic
1185100260 22:48836540-48836562 AGATCGTGGGGTGCTGCCCTGGG + Intronic
950640159 3:14343543-14343565 AGATCCCGGTGGGCTCCCCAGGG - Intergenic
953339763 3:42123484-42123506 AGATCCTGGGGTGCTCCACACGG - Intronic
955412022 3:58661891-58661913 AGAACAGGGTGTGCTCCACATGG + Intronic
956373991 3:68594556-68594578 AGAGCCTTGAGGGCTCCACAGGG - Intergenic
957939778 3:86990688-86990710 AGATACTGGGACGCTCCATAAGG + Exonic
961521279 3:127468701-127468723 AGAACCTGGGGCTCTCCCCAAGG + Intergenic
961772188 3:129258133-129258155 AGATCCTGGGTTCCTCCACCAGG - Intronic
967020134 3:185515457-185515479 AAATCCTGGGCTGCCACACATGG + Intronic
967768356 3:193307260-193307282 AGAGCCTGAGGTCCTCCAGAGGG + Intronic
969375189 4:6758851-6758873 AGATCCTGGGGTCATTCTCAGGG - Intergenic
969393506 4:6906474-6906496 AGATGCGGGGGTGCTCGGCAGGG + Intergenic
974197193 4:58590783-58590805 AGTCCGTGGGGTGCTCTACATGG + Intergenic
974390058 4:61254833-61254855 AGGTTCTGAGGTGATCCACAAGG - Intronic
985515499 5:342846-342868 AGATACTGGGCTGCTCCTCAGGG + Intronic
987040968 5:14061732-14061754 AGATTCTGGGCTGCTTCAAAGGG + Intergenic
988688688 5:33550115-33550137 TGAACCTGGGCTGCTGCACAAGG - Intronic
994095359 5:95842858-95842880 AAATGCTGGGGTGGTCCCCAGGG - Intergenic
999769787 5:154766675-154766697 TTCTCCTGGGGTGGTCCACATGG + Intronic
1006239118 6:32661991-32662013 GGAGGCTGGGGTGCTCCACGTGG + Exonic
1006245563 6:32731444-32731466 GGAGGCTGGGGTGCTCCAGATGG + Intergenic
1006247749 6:32755041-32755063 GGAGGCTGAGGTGCTCCACATGG + Intergenic
1006248258 6:32758874-32758896 GGAGGCTGGGGTGCTCCACTTGG + Exonic
1007777629 6:44232718-44232740 AGATCCTGAGGGGCCCCAGATGG + Intronic
1013416990 6:109934138-109934160 TGAACCTGGTGTGCTCCTCAGGG + Intergenic
1014505695 6:122252134-122252156 AGATGCTGGGCAGCTCCACGAGG + Intergenic
1017941340 6:159055854-159055876 ACATCGTAGGGTGGTCCACAAGG - Intergenic
1018229715 6:161663872-161663894 AGAGGCTGGGATGCTGCACATGG + Intronic
1021963070 7:25891841-25891863 AGAGCCTGGAGTGCTCTGCAGGG - Intergenic
1022305586 7:29143824-29143846 AGACCCTGGGGTGCAGGACAGGG - Intronic
1023151097 7:37202069-37202091 AGGTCCCGGGGTGCTCTGCAGGG - Intronic
1023675767 7:42628292-42628314 AGATCCTGGGCTAATCAACAGGG - Intergenic
1029381067 7:100215040-100215062 AGGTGCTGTGCTGCTCCACAAGG - Intronic
1029400443 7:100341989-100342011 AGGTGCTGTGCTGCTCCACAAGG - Intronic
1029593028 7:101519905-101519927 AGGGCCTGGGATGCTTCACAGGG - Intronic
1034419415 7:150981134-150981156 AGAGCCTGGGGTTACCCACAGGG + Intergenic
1037611957 8:20483320-20483342 GGGTCCTGGGGTGCTCCTCCTGG + Intergenic
1039089162 8:33810057-33810079 AAATCCTGGGGATCTCCACTGGG - Intergenic
1039184504 8:34901561-34901583 ACATCGTGGGGTCCTCCACCGGG + Intergenic
1039814761 8:41083559-41083581 AGAGCCTGTGGTGAGCCACAGGG - Intergenic
1045236288 8:100355318-100355340 ACAACCTGGGATGTTCCACAGGG + Intronic
1048750765 8:137671677-137671699 TCATCCTGGGTTTCTCCACATGG - Intergenic
1049850931 8:144829702-144829724 AGACCCTTGTGGGCTCCACAGGG + Intronic
1053020659 9:34691712-34691734 AGATCCTGGGGTGGCCTCCAAGG + Intergenic
1056098312 9:83276486-83276508 AGAGCCTGGGTTTTTCCACAGGG - Intronic
1057509204 9:95663643-95663665 AGATCTGGGGGAGCTGCACAGGG + Intergenic
1057638726 9:96796532-96796554 AGCTGCTGAGGTGCTCCACCTGG + Intergenic
1058673483 9:107380532-107380554 AGATCATGGGTTGGTCCCCATGG - Intergenic
1059009844 9:110445065-110445087 AGATTCTGTGGTGCACCACATGG - Intronic
1060938406 9:127528992-127529014 AGATCCTGGGGAGCTCGAATGGG + Intronic
1062167215 9:135113838-135113860 ACAGCCTGGGGGGCACCACAGGG + Intronic
1062697905 9:137884807-137884829 AGATCCAGGGGTCCTGCCCATGG - Intronic
1189208418 X:39262001-39262023 AGATCCAGGGGTTCCTCACAGGG + Intergenic
1194795761 X:98209952-98209974 AGAGACTGGGGTACTTCACATGG + Intergenic
1194915255 X:99699315-99699337 AGTTACTGGGGTGATCCAGATGG - Intergenic
1197180095 X:123525639-123525661 ATAGCCTGGGCTGCTTCACATGG - Intergenic
1199616608 X:149660763-149660785 TGATCCTCGGGTGCTCCAGAGGG + Intergenic
1199626033 X:149742485-149742507 TGATCCTCGGGTGCTCCAGAGGG - Intergenic
1200390767 X:155944625-155944647 AGATACTGGGTTGCTTCCCAGGG + Intergenic
1201017906 Y:9624119-9624141 GGCTCCTGGGGAGCTCCTCAGGG - Intergenic
1202119833 Y:21510511-21510533 GGTTCCTGGGGGGCCCCACAGGG + Intergenic
1202122284 Y:21534052-21534074 GGTTCCTGGGGGGCCCCACAGGG + Intronic
1202156721 Y:21895331-21895353 GGTTCCTGGGGGGCCCCACAGGG - Intronic
1202159169 Y:21918872-21918894 GGTTCCTGGGGGGCCCCACAGGG - Intergenic
1202185618 Y:22183787-22183809 GGTTCCTGGGGGGCCCCACAGGG - Intergenic
1202205742 Y:22402609-22402631 GGTTCCTGGGGGGCCCCACAGGG + Intronic