ID: 953341815

View in Genome Browser
Species Human (GRCh38)
Location 3:42140770-42140792
Sequence AAGGTTAGGAAGCCTCTTCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 160}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953341807_953341815 -1 Left 953341807 3:42140748-42140770 CCTATGGCCCCCTCAAGGACGGA 0: 1
1: 0
2: 0
3: 1
4: 52
Right 953341815 3:42140770-42140792 AAGGTTAGGAAGCCTCTTCCGGG 0: 1
1: 0
2: 0
3: 14
4: 160
953341809_953341815 -8 Left 953341809 3:42140755-42140777 CCCCCTCAAGGACGGAAGGTTAG 0: 1
1: 0
2: 2
3: 6
4: 41
Right 953341815 3:42140770-42140792 AAGGTTAGGAAGCCTCTTCCGGG 0: 1
1: 0
2: 0
3: 14
4: 160
953341803_953341815 29 Left 953341803 3:42140718-42140740 CCTGCTTGTAAGGCTGTCTTTCA 0: 1
1: 0
2: 1
3: 15
4: 159
Right 953341815 3:42140770-42140792 AAGGTTAGGAAGCCTCTTCCGGG 0: 1
1: 0
2: 0
3: 14
4: 160
953341812_953341815 -10 Left 953341812 3:42140757-42140779 CCCTCAAGGACGGAAGGTTAGGA 0: 1
1: 0
2: 0
3: 5
4: 93
Right 953341815 3:42140770-42140792 AAGGTTAGGAAGCCTCTTCCGGG 0: 1
1: 0
2: 0
3: 14
4: 160
953341810_953341815 -9 Left 953341810 3:42140756-42140778 CCCCTCAAGGACGGAAGGTTAGG 0: 1
1: 0
2: 0
3: 4
4: 38
Right 953341815 3:42140770-42140792 AAGGTTAGGAAGCCTCTTCCGGG 0: 1
1: 0
2: 0
3: 14
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953341815 Original CRISPR AAGGTTAGGAAGCCTCTTCC GGG Intronic
902535420 1:17116913-17116935 AGTGGAAGGAAGCCTCTTCCAGG - Intronic
903174003 1:21569971-21569993 AGGGTCAGGAAGGCTATTCCAGG - Intronic
903366669 1:22809621-22809643 AAGGTTAGGAGGCATCTGCCAGG + Intronic
903664082 1:24996086-24996108 AAGGGTAGAAAGGCCCTTCCAGG + Intergenic
904471547 1:30739689-30739711 GAGGGTAGGAGCCCTCTTCCTGG - Intronic
905252295 1:36657384-36657406 AAAGTTTGGAAGCTTCTCCCAGG - Intergenic
905493249 1:38361822-38361844 AAGGGTGGGAAGCTTCCTCCAGG + Intergenic
906642158 1:47447875-47447897 AACGTTAGAAATCCTCTTCTAGG + Intergenic
909834029 1:80231168-80231190 GAGGCTAGGAAGCCTCTGCTTGG - Intergenic
910367597 1:86483265-86483287 CAGGTGTGGAAGCCTCTGCCTGG + Intronic
917077904 1:171224923-171224945 AAGGTTCAGAAGACTCTACCTGG + Intergenic
918590380 1:186234504-186234526 AAGGTCAGAGAGCCTGTTCCAGG - Intergenic
921250878 1:213296925-213296947 AAGGTGGGGAAGAATCTTCCAGG + Intergenic
921290581 1:213653073-213653095 AAAGTTAGCCAGCATCTTCCAGG - Intergenic
921934662 1:220786015-220786037 AAGGTAAGGAAGACTATTCAAGG - Intergenic
1066409153 10:35149266-35149288 AAGGTGAGGAAGCATATTCTAGG + Intronic
1066656877 10:37704875-37704897 AGGGTGAGGAAGCCCTTTCCAGG - Intergenic
1066795834 10:39119569-39119591 AAGGTTGGAAACCCTCTTCTTGG + Intergenic
1067041403 10:42955113-42955135 AGGGTGAGGAAGCCCTTTCCAGG - Intergenic
1067440099 10:46303972-46303994 AAGGTCAAGAAGCCTCTTGGGGG - Intronic
1068016935 10:51528763-51528785 AGGGTTAGGAATCCTCTACCTGG - Intronic
1068893650 10:62175397-62175419 AAGTTTAGGCAAGCTCTTCCAGG + Intergenic
1070660289 10:78300785-78300807 ATGGCTAAGAAGCCTCTCCCAGG + Intergenic
1074640247 10:115371105-115371127 GAGGTTTGGGAACCTCTTCCTGG + Intronic
1074945442 10:118276615-118276637 AAGGTCAGGCCACCTCTTCCTGG - Intergenic
1075591915 10:123698031-123698053 AAGTTCAGGAAGCGTCTTCATGG - Intergenic
1075967026 10:126621997-126622019 CAGGTTAGCAAGCATCGTCCTGG + Intronic
1077120447 11:905088-905110 ATGGTGAGGAAGCTTCTTTCTGG - Intronic
1087061239 11:93979900-93979922 GAGGTTAAGAAGGATCTTCCTGG + Intergenic
1089127822 11:116189780-116189802 AAAGTTGGGCAGCCTCTTCTTGG - Intergenic
1090987226 11:131779196-131779218 GAGGTTTCGAATCCTCTTCCAGG - Intronic
1096593592 12:52679394-52679416 ATGGTTAGGAAGACCTTTCCAGG + Intronic
1097114536 12:56687913-56687935 AAGGCTAGGGGGCCGCTTCCAGG + Intronic
1099487764 12:83249415-83249437 GAGGCTTGGAAGCCTCTGCCCGG + Intergenic
1100521116 12:95376923-95376945 AAGGTTAGGAATCTTCTGGCCGG - Intergenic
1100607430 12:96163148-96163170 AAAGTCAGGAAGTCTTTTCCCGG + Intergenic
1101679038 12:106947043-106947065 TAGTTTAGAAAGGCTCTTCCAGG - Intergenic
1102823397 12:115926745-115926767 AGGGTTAGGATGCTTTTTCCTGG - Intergenic
1102939274 12:116924732-116924754 AAGGATATGAAGCCACATCCTGG - Intronic
1106033151 13:26020606-26020628 AGGGTGCGGAAGACTCTTCCAGG - Exonic
1107493435 13:40901313-40901335 GAGGTGAGGAACCCTCTGCCTGG + Intergenic
1110362477 13:74643028-74643050 GAGGTTGGGAAGCCTCTTCTTGG + Intergenic
1111654089 13:91130760-91130782 AAGAAGAGGGAGCCTCTTCCAGG - Intergenic
1114321017 14:21547153-21547175 GAGGTTTGGGAGCCTCTGCCTGG - Intergenic
1114845969 14:26322322-26322344 GAAGTTAGGAAGTCTCTTCCAGG + Intergenic
1115730765 14:36267197-36267219 AAGGTTAGGGAGCCTCAACAGGG - Intergenic
1118434887 14:65761732-65761754 AAGGTCAGGAAGCCACTGCTAGG + Intergenic
1119115899 14:72021231-72021253 GTGGATAGGAAGCCTCTGCCTGG + Intronic
1120015017 14:79462424-79462446 AAGTTTTGGAAGCATCTCCCAGG - Intronic
1122104978 14:99446190-99446212 AGGGTTAGGGAGCCTCTGTCAGG + Intronic
1127043433 15:55001815-55001837 AATGTTTGGCAGCCTCTGCCTGG - Intergenic
1128972425 15:72118877-72118899 AACGTGAGGAAGCCCTTTCCAGG + Intronic
1129657685 15:77535243-77535265 GAGGTTAGGAAGCTTATTCAAGG + Intergenic
1131091130 15:89625583-89625605 AGGCCGAGGAAGCCTCTTCCTGG + Exonic
1131919850 15:97313420-97313442 AAGGATGGGAACCCTCTTCTTGG - Intergenic
1133602450 16:7352569-7352591 AAGGCCAGGATGACTCTTCCTGG - Intronic
1137388151 16:48059393-48059415 GAAGTGAGGAAGCCTCTGCCTGG - Intergenic
1137647951 16:50092390-50092412 GAGGTTAAGGAACCTCTTCCAGG + Intronic
1138527876 16:57619503-57619525 CAGGGATGGAAGCCTCTTCCAGG - Intronic
1138845607 16:60561738-60561760 AAAATCAGGAAGCGTCTTCCAGG - Intergenic
1139292849 16:65873864-65873886 ATGGTTAGGAAGCCTGTCCCAGG - Intergenic
1140876111 16:79153889-79153911 AAGGTTTGAAAGCGTTTTCCAGG + Intronic
1141686973 16:85576014-85576036 CAGGATAAGAAACCTCTTCCAGG - Intergenic
1141842884 16:86585434-86585456 AGGTTAAGGAACCCTCTTCCGGG - Intergenic
1146255716 17:31390863-31390885 AAAGGGAGGAAGCCTCTTCCAGG + Intergenic
1150236505 17:63596977-63596999 AAAGTGAGTAAGCCACTTCCCGG - Intergenic
1150375644 17:64679286-64679308 AATCTTAGGTTGCCTCTTCCTGG - Intergenic
1153549873 18:6251151-6251173 AAAGTTAGGAAGGCCCTTGCAGG + Intronic
1154423780 18:14256609-14256631 ATGGTTAGGCAGCATCTTCTTGG + Intergenic
1157661744 18:49451440-49451462 AAGGTTAGGAACCCTGTGCGGGG - Intronic
1158448893 18:57546136-57546158 AACGTTAGGAGCCCTGTTCCTGG + Intergenic
1163744077 19:19034417-19034439 AGGGTTGGGAAGCCACTACCGGG + Intronic
1163904265 19:20137785-20137807 AAAGTGAGGAGGTCTCTTCCCGG + Intergenic
1165682389 19:37789143-37789165 ACGTTTAGGAAGCCTATTCCAGG + Intronic
925862902 2:8197695-8197717 CAGGTTTTGAAGCCTCTTGCAGG + Intergenic
926723046 2:15976857-15976879 ATGGGCAAGAAGCCTCTTCCAGG - Intergenic
927724703 2:25412494-25412516 AAGGATAGGAAGCTCCTTCAGGG - Intronic
928704376 2:33931829-33931851 AAGAGTAAGAAGCCTCTTCTAGG + Intergenic
930664656 2:54090205-54090227 AATGTTGGGAATCCTCTTCTTGG + Intronic
931432681 2:62221080-62221102 AAGGATAGGAAGGAACTTCCTGG - Intronic
933920167 2:87037927-87037949 AAGGTGAGGAAGACTGTTTCAGG + Intergenic
933931457 2:87155859-87155881 AAGGTGAGGAAGACTGTTTCAGG - Intergenic
934002831 2:87731966-87731988 AAGGTGAGGAAGACTGTTTCAGG - Intergenic
935282335 2:101528902-101528924 AGGGTTAGGAAGAATCTTCGAGG + Intergenic
936361663 2:111809580-111809602 AAGGTGAGGAAGACTGTTTCAGG + Intronic
936767612 2:115872564-115872586 CAGATTAGAAACCCTCTTCCAGG + Intergenic
937984912 2:127634099-127634121 CAGGCTAGGAAGGCTCATCCTGG + Intronic
939282719 2:140085489-140085511 AAGGTTAGGCAGTCCCTTACAGG + Intergenic
940013510 2:149079746-149079768 AGGGTTAGAAGGCATCTTCCGGG + Intronic
942862587 2:180634080-180634102 TAGTGTATGAAGCCTCTTCCTGG + Intergenic
943035083 2:182734026-182734048 AAGGTTAAGAAACCTCTCCTTGG - Intronic
943690060 2:190860574-190860596 AATTTAAGGAAGCATCTTCCAGG - Intergenic
947844637 2:233234047-233234069 AGTGTTAGGAAGCCTCTTATAGG - Intronic
948004260 2:234594277-234594299 TGGCTAAGGAAGCCTCTTCCTGG + Intergenic
948330012 2:237157206-237157228 AACGCTAGGAAGCCTGTTCGAGG - Intergenic
1170586800 20:17740971-17740993 AGGGATTGGATGCCTCTTCCTGG + Intergenic
1170907785 20:20531332-20531354 AAGGTGTGGAGGCCTCTCCCAGG + Intronic
1171992552 20:31708040-31708062 GAGGTTAGGAAGACTCTTCTGGG - Intronic
1173432087 20:42997333-42997355 AAAGCCAGGTAGCCTCTTCCTGG + Intronic
1175094060 20:56527790-56527812 AAGGGTGGGCAGCATCTTCCCGG + Intergenic
1177006001 21:15672745-15672767 GAGGTGAGGAGGCCTCTGCCCGG - Intergenic
1177006014 21:15672781-15672803 GAGGTGAGGAGGCCTCTGCCCGG - Intergenic
1178612726 21:34099290-34099312 AAGGTTATGAAGTCTCTTTTGGG + Exonic
1181834020 22:25587280-25587302 AGGGTCAGGAAGCCTCATGCAGG - Intronic
1183796662 22:40124187-40124209 AAGGCTAAGAAGGCACTTCCAGG - Intronic
1184239597 22:43205150-43205172 GAGGTCACGATGCCTCTTCCCGG + Intronic
1184694122 22:46130429-46130451 CAGGTGAGGAAGCCCCTGCCAGG + Intergenic
949897358 3:8778183-8778205 ACGGGTGGGAAGCCTCCTCCTGG - Intronic
950709681 3:14805336-14805358 AAGGTCAGGCAGCATTTTCCAGG - Intergenic
951211330 3:19978642-19978664 CAGTTTAGGCAGCTTCTTCCAGG + Intronic
953341815 3:42140770-42140792 AAGGTTAGGAAGCCTCTTCCGGG + Intronic
954694102 3:52411087-52411109 CGGGTTAGGAAGCCACTGCCTGG + Exonic
959159882 3:102710533-102710555 AAGGTCATGAAGCCTGTTACAGG + Intergenic
960308078 3:116087053-116087075 AAGTTTGGGATGCCACTTCCAGG + Intronic
961486178 3:127218370-127218392 AAGGTGAGGATGGCTCATCCCGG - Intergenic
961625427 3:128259240-128259262 AAGGTAAGGGTGGCTCTTCCTGG + Intronic
962443255 3:135442740-135442762 AAGGCCATGAAGCCTCTACCTGG + Intergenic
963071743 3:141310500-141310522 AAAGTTGTGAACCCTCTTCCTGG - Intergenic
963887219 3:150596256-150596278 ATGCTTAGGAAGCCTGTGCCTGG - Intronic
964616627 3:158673065-158673087 AGGATGAGCAAGCCTCTTCCTGG - Intronic
966123395 3:176548006-176548028 GAGGTTTGGGAGCCTCTGCCTGG - Intergenic
966650383 3:182294427-182294449 AATGTTAGGAATCTTCATCCTGG + Intergenic
969517950 4:7658950-7658972 AAGATGAGGAAGTCACTTCCTGG - Intronic
972565735 4:40267477-40267499 AAATATAGGAAGCCTCTTCCTGG - Intergenic
974911396 4:68125078-68125100 AAGTTTATGAAGTCTTTTCCTGG - Intronic
980264652 4:130499819-130499841 AGATTTAGAAAGCCTCTTCCTGG + Intergenic
981426866 4:144613701-144613723 AAGGGTAGTAGGCCTCTTACAGG + Intergenic
981621696 4:146707882-146707904 AAGGCTATGCAGCCTCTACCTGG + Intronic
981931253 4:150191387-150191409 TAGGTTAGCAAACCTGTTCCAGG + Intronic
982083134 4:151809484-151809506 AAGGTCAGGAAGCCTTTTTCAGG + Intergenic
987937734 5:24489125-24489147 AAGGATGGGAAGACTCTTACTGG + Intronic
989099179 5:37808641-37808663 TAGTTTAGGCAGCCACTTCCAGG + Intergenic
991586899 5:68210913-68210935 GAGGTTTGGAAACCTCTGCCCGG - Intergenic
993893703 5:93505563-93505585 GAGGTTTGGAAACCTCTGCCTGG - Intergenic
995298188 5:110543763-110543785 GAGGTTAGGTAGAGTCTTCCTGG - Intronic
996511967 5:124326485-124326507 AAAGTTAGGAAACCTTTTTCTGG + Intergenic
997648063 5:135494271-135494293 AGAGATAGGAAGCCTCTGCCGGG - Intergenic
998428416 5:142049366-142049388 AAGGTGAGACAGCCTCTCCCTGG - Intergenic
999199609 5:149806359-149806381 AAGGTCAGGCAGCCCCTTCATGG - Intronic
1005029593 6:21496331-21496353 AAGTTTAGGAACACTTTTCCTGG - Intergenic
1006314133 6:33280233-33280255 AAGGTAAGGTTTCCTCTTCCTGG - Intronic
1008516156 6:52321066-52321088 AAGGTTATGCAGCTTCTTCAAGG + Intergenic
1010160266 6:72845988-72846010 GAGGTTAGGAAGCCTGTTCAGGG + Intronic
1010885513 6:81234189-81234211 AAGGTTAGGCATCATCCTCCTGG + Intergenic
1012114098 6:95271708-95271730 GAGGTGAGGAAGCCTCTGCTAGG + Intergenic
1015092844 6:129379593-129379615 GAGGGTAGGAAGACTCTTCAGGG - Intronic
1025739028 7:64181932-64181954 AAGGTTAGGTAGCCGCTGGCTGG - Intronic
1026148446 7:67768483-67768505 GAGGTTATGCAGCCTCCTCCAGG + Intergenic
1028146391 7:87324316-87324338 CAGGTTAGGAACCCTGTTCGGGG + Intergenic
1029483265 7:100825198-100825220 TGGGTGAGGCAGCCTCTTCCTGG + Intronic
1031014315 7:116556708-116556730 AAGGTTAGGAAGCAATTTACCGG - Intronic
1033209978 7:139453497-139453519 GAGCTTGGGCAGCCTCTTCCTGG - Exonic
1037688876 8:21166300-21166322 AAGCTTAGGAACACACTTCCAGG - Intergenic
1046786477 8:118272160-118272182 AAGGTTTGGAAACCTCTGCCTGG - Intronic
1047432937 8:124808363-124808385 AAGGTCAGGAAGTTTATTCCTGG + Intergenic
1048842561 8:138578484-138578506 CTGGTTAGGAAGCCTCTTAAGGG - Intergenic
1052266809 9:26583626-26583648 AAGTTAATGAAGCCTCTGCCTGG - Intergenic
1052705403 9:31988598-31988620 AAGGTTTGGGAACCTCTGCCTGG - Intergenic
1054547845 9:66359972-66359994 AAGAAAAGGAAGCCTCTTGCTGG - Intergenic
1057454623 9:95197119-95197141 AAAGTTGTGAACCCTCTTCCAGG + Intronic
1059447679 9:114348966-114348988 AAGGAGTGGAGGCCTCTTCCTGG + Intronic
1061081750 9:128374951-128374973 AAGGTCAGAAAGCCTCTTGAGGG - Intronic
1061398037 9:130354135-130354157 AAGGTTAAGAAGCATCTCCCAGG + Intronic
1185445971 X:258197-258219 AAGGTCAGGCAGCGTCTCCCAGG - Intergenic
1189553978 X:42123083-42123105 AAGGATTGGAGTCCTCTTCCAGG - Intergenic
1192343349 X:70281627-70281649 AAGGTTAGGAACCCCTTTCTGGG - Intronic
1193489703 X:82134019-82134041 GAGGCTTGGAAGCCTCTGCCTGG - Intergenic
1193733951 X:85134634-85134656 CAGCTCAGGAAGCTTCTTCCAGG - Intergenic
1193887952 X:87006529-87006551 AAGGTTTGGGAACCTCTGCCTGG - Intergenic
1194206917 X:91020407-91020429 TATGTTAGGAAGCCTCTCCCAGG + Intergenic
1195907463 X:109859181-109859203 AAGGTTAGAGAAACTCTTCCAGG - Intergenic
1196982264 X:121227989-121228011 AAGGGTAGGAAACTTTTTCCTGG - Intergenic
1199797958 X:151220345-151220367 AAGTTGATGAAGGCTCTTCCTGG + Intergenic
1200366735 X:155673837-155673859 AAGGATAGGATTCCTCCTCCAGG + Intergenic
1200552666 Y:4595196-4595218 TATGTTAGGAGGCCTCTCCCAGG + Intergenic