ID: 953344749

View in Genome Browser
Species Human (GRCh38)
Location 3:42165875-42165897
Sequence GATGCTGGTACCCCACTATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 74}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953344749_953344753 -4 Left 953344749 3:42165875-42165897 CCTAATAGTGGGGTACCAGCATC 0: 1
1: 0
2: 0
3: 8
4: 74
Right 953344753 3:42165894-42165916 CATCACCCCAAGGCTGGCCATGG 0: 1
1: 0
2: 7
3: 31
4: 269
953344749_953344759 29 Left 953344749 3:42165875-42165897 CCTAATAGTGGGGTACCAGCATC 0: 1
1: 0
2: 0
3: 8
4: 74
Right 953344759 3:42165927-42165949 TACTCACGTTCTCTGTATTTTGG 0: 1
1: 0
2: 0
3: 13
4: 134
953344749_953344751 -10 Left 953344749 3:42165875-42165897 CCTAATAGTGGGGTACCAGCATC 0: 1
1: 0
2: 0
3: 8
4: 74
Right 953344751 3:42165888-42165910 TACCAGCATCACCCCAAGGCTGG 0: 1
1: 0
2: 3
3: 12
4: 145
953344749_953344760 30 Left 953344749 3:42165875-42165897 CCTAATAGTGGGGTACCAGCATC 0: 1
1: 0
2: 0
3: 8
4: 74
Right 953344760 3:42165928-42165950 ACTCACGTTCTCTGTATTTTGGG 0: 1
1: 0
2: 0
3: 16
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953344749 Original CRISPR GATGCTGGTACCCCACTATT AGG (reversed) Intronic
903342985 1:22666130-22666152 GATGCTGGGACCCCACGTTGAGG - Intergenic
905047014 1:35012700-35012722 GATGATGAAACCACACTATTGGG + Intronic
915182562 1:154075171-154075193 GATGTTTGTACATCACTATTGGG + Intronic
915639160 1:157208665-157208687 GATGCTGCTGCCCCAAGATTCGG + Intergenic
922820743 1:228483710-228483732 GATGCTGGCACCACACAATGTGG + Intergenic
924927086 1:248693420-248693442 GATGCTGGTCCACCAGTATGGGG - Intergenic
1063443871 10:6095793-6095815 GATGTTGGTACCACACTGTGTGG - Intronic
1063542448 10:6947879-6947901 GATCCAGGAACCCCACTACTGGG + Intergenic
1067287624 10:44918355-44918377 TGTGCTGATACCCCACTCTTTGG - Intronic
1081930970 11:46871139-46871161 GATGCTGGGACCGCAGCATTAGG + Intronic
1082773343 11:57226409-57226431 GATCCTGATAGCCCACTACTGGG + Intergenic
1085663804 11:78394661-78394683 ACTGCTGTTACCCCACTGTTTGG + Intronic
1086556011 11:88111766-88111788 GATGCAGGTATCCCTCTTTTGGG + Intergenic
1090534408 11:127625029-127625051 GATGCTGGGTCCCCTCTGTTGGG + Intergenic
1091187773 11:133661997-133662019 GATGCTGGAACCCCAGTCTTTGG - Intergenic
1095647852 12:44570279-44570301 GATGCTGGTGCTCCACAATTAGG + Intronic
1098671749 12:73239118-73239140 GATCCAGCTATCCCACTATTGGG + Intergenic
1111547721 13:89764978-89765000 GATGCAGGCATCCCACTAGTAGG + Intergenic
1113457044 13:110456762-110456784 GATGCTGGTGCCTCACAACTGGG + Intronic
1115005129 14:28473248-28473270 GATGCAGATATCCCATTATTGGG - Intergenic
1116444116 14:44988513-44988535 GAAGCAGGTACCAAACTATTAGG + Intronic
1120043175 14:79776669-79776691 GATGCTTGGACCACACTGTTAGG + Intronic
1124038162 15:26075872-26075894 GATGCTAGTACCTCACCATGTGG - Intergenic
1132906889 16:2287052-2287074 GATGCTGGCACCACTCTATTGGG - Intronic
1136060884 16:27725680-27725702 GCTGCTGGAAGCCCACTTTTTGG - Intronic
1137891035 16:52162144-52162166 GGTACTGGTGCCCCACTTTTGGG + Intergenic
1150348093 17:64420229-64420251 GGTGCTGATGCCCCACAATTGGG + Intergenic
1155965656 18:32033109-32033131 CATGCTGGTAACCAATTATTGGG + Intronic
1165855855 19:38879001-38879023 GTTGCTGGGACCCCAGTTTTGGG + Exonic
1166766334 19:45253684-45253706 GATGATGGCCCCCCACTGTTAGG + Intronic
1166799343 19:45446548-45446570 AAAGATGGTACCCCTCTATTGGG + Intronic
925110740 2:1334421-1334443 GATCCAGCAACCCCACTATTGGG + Intronic
928328519 2:30339034-30339056 GATGCTGGTGACCCGCTATCTGG + Intergenic
929478567 2:42279307-42279329 GATGCTGCAATCCCACTACTGGG - Intronic
931136553 2:59409026-59409048 GATCCAGCTATCCCACTATTGGG - Intergenic
931524633 2:63139336-63139358 GATCCAGCAACCCCACTATTGGG - Intronic
932240721 2:70154486-70154508 CATGCTAGTACCACACTCTTTGG - Intronic
942502887 2:176610444-176610466 GATCCAGGAACCCCACTAATGGG - Intergenic
942852657 2:180508513-180508535 GATTCTGCAATCCCACTATTAGG - Intergenic
948081282 2:235207338-235207360 GATGCAGGTCCCCCACTACAGGG - Intergenic
948308042 2:236964277-236964299 GAGGCTGGCACACCTCTATTTGG + Intergenic
948606010 2:239135635-239135657 GATGCTGGAGCTCCACTCTTGGG + Intronic
1170196279 20:13692766-13692788 GATGCTGGCACCACACTTCTTGG + Intergenic
1185054730 22:48573641-48573663 GATGGTGGTCCCCCAACATTAGG + Intronic
952953804 3:38544215-38544237 GAGGCTGGGACCCCACTGTGAGG - Intergenic
953344749 3:42165875-42165897 GATGCTGGTACCCCACTATTAGG - Intronic
954478502 3:50773059-50773081 TATGCTAGTACCACACTGTTTGG - Intronic
963586462 3:147196182-147196204 GATGCTGGGACCACACTTTGAGG + Intergenic
970155956 4:13141973-13141995 CATGCTGGTACCATAATATTGGG + Intergenic
979900729 4:126214513-126214535 GATGTTGATACACCAATATTCGG + Intergenic
979902909 4:126246265-126246287 GATCCTGCAATCCCACTATTAGG + Intergenic
982694264 4:158581847-158581869 GATGCTGGTACCCTGCTTTTTGG - Intronic
986138171 5:5002834-5002856 GATGCTGGTACCTTAATCTTGGG - Intergenic
988820418 5:34878820-34878842 GATCCAGGAATCCCACTATTAGG + Intronic
990505222 5:56437315-56437337 GATCCAGCTACCCCACTACTAGG + Intergenic
993541042 5:89152028-89152050 GATGCAGCAATCCCACTATTGGG - Intergenic
996441864 5:123500426-123500448 GAGGCTGCTACCATACTATTGGG - Intergenic
998752776 5:145340892-145340914 GATGCTGGTAGGCCAGTCTTTGG - Intergenic
1000577037 5:162987559-162987581 GATCCTGGTTCCCCATTTTTTGG - Intergenic
1010017493 6:71121992-71122014 GAGGCTGGTACCCCACTGGGTGG - Intergenic
1018374525 6:163198639-163198661 GATGCTGGGACCTCATTAATGGG - Intronic
1020989632 7:15180867-15180889 GATGCTGGTGCCCTGCTCTTGGG - Intergenic
1027785387 7:82573676-82573698 GATGCTGGCACCCTGCTCTTGGG + Intergenic
1028250011 7:88529637-88529659 GATGCTGGCATCCCACTCATCGG + Intergenic
1030853175 7:114516523-114516545 GATGCAGCAATCCCACTATTAGG - Intronic
1031211630 7:118836458-118836480 GATGGTGGCACACCACTATTTGG - Intergenic
1032452231 7:132042931-132042953 GATGCTTGCCCTCCACTATTGGG + Intergenic
1033556716 7:142494617-142494639 TATGCTGGTACACCACAAATTGG + Intergenic
1035811438 8:2494942-2494964 AATGCTGGTAACCCACCATCTGG - Intergenic
1038139778 8:24831548-24831570 GTTGCTGTTATGCCACTATTTGG - Intergenic
1045052415 8:98339433-98339455 TATGCTGGTGCCCCTCTACTGGG - Intergenic
1047188431 8:122656496-122656518 GATGCTGGTACCCCACCTCATGG - Intergenic
1050016175 9:1236753-1236775 GCTGCAGGTACCCCCCTACTTGG + Intergenic
1052698057 9:31904571-31904593 GATCCAGCAACCCCACTATTGGG + Intergenic
1054985184 9:71253679-71253701 GATCCAGACACCCCACTATTGGG + Intronic
1055824022 9:80302514-80302536 GATACTGTTACTCCACCATTGGG + Intergenic
1059743948 9:117182080-117182102 GCTGCTGGCACCCCATTAATCGG - Intronic
1060414740 9:123422181-123422203 GATGCTAGTTCCCCACTCTTGGG - Intronic
1187074211 X:15917814-15917836 AATGCTGTTACCCCAAAATTTGG - Intergenic
1195300752 X:103527810-103527832 GATACTGGTACCTCACTAGCAGG - Intergenic
1195833020 X:109081277-109081299 GATCCTGCAATCCCACTATTGGG + Intergenic
1196865897 X:120070623-120070645 GATGCTAGAACCTCACTATTAGG + Intergenic
1196877199 X:120165657-120165679 GATGCTAGAACCTCACTATTAGG - Intergenic