ID: 953345420

View in Genome Browser
Species Human (GRCh38)
Location 3:42171613-42171635
Sequence ATGAGCCGGGAGAAGTGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 388
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 355}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953345420_953345424 -10 Left 953345420 3:42171613-42171635 CCTTCCCACTTCTCCCGGCTCAT 0: 1
1: 0
2: 2
3: 30
4: 355
Right 953345424 3:42171626-42171648 CCCGGCTCATTCAGAAGCCCTGG 0: 1
1: 0
2: 0
3: 17
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953345420 Original CRISPR ATGAGCCGGGAGAAGTGGGA AGG (reversed) Intronic
900192733 1:1358349-1358371 TTGGGCCAGGAGGAGTGGGAAGG - Intronic
901735079 1:11307011-11307033 AGGAGCCATGAGAAGTTGGAAGG + Intergenic
901902370 1:12376012-12376034 ATGAGCCTGGACAAATGGGCAGG + Intronic
902451001 1:16497135-16497157 ATGAGGTGGGAGAAGTGGAGTGG - Intergenic
902688062 1:18091776-18091798 ATGAGCTGGGAGAGGTGGCAGGG - Intergenic
902695887 1:18140646-18140668 ATGAGCCAGGTGAAGAGGAATGG - Intronic
902922118 1:19672275-19672297 ATGGGACAGGAGAAGGGGGAGGG - Intronic
903360516 1:22774118-22774140 GTGAGCTGGGAGGAGAGGGAAGG - Intronic
903380893 1:22896242-22896264 TTGAGGTGGGAGGAGTGGGAAGG + Intronic
903654315 1:24939796-24939818 GTGGGAGGGGAGAAGTGGGAGGG + Intronic
904490553 1:30856279-30856301 ACGAGCCTGGTGAAGTGGGGAGG + Intergenic
904805070 1:33125393-33125415 ATGAGGTGGGAGAGGTGGGCAGG - Intergenic
905213427 1:36390210-36390232 ATGAGAGTGGAGAAATGGGAGGG - Intergenic
905275724 1:36816752-36816774 AGGGGCCTGGAGAAGTGGGAAGG - Intronic
905479162 1:38249322-38249344 ATGATCCTGGAGAGGTGGGGAGG - Intergenic
905731487 1:40301849-40301871 GTGATCCAGGAGAAGTGGGACGG - Exonic
905746309 1:40421582-40421604 ATGAGGCGGGAGCACTGGGGAGG + Intronic
905862151 1:41358951-41358973 ATGAGCTGGGCAAAGTAGGAAGG + Intergenic
906397355 1:45478076-45478098 ATGAGGCTGGAGATGTGGGTAGG - Intronic
906559816 1:46748261-46748283 ATGAACTTGGAGAAGTAGGATGG - Intergenic
907427905 1:54392680-54392702 CTGAGCCTTGAGAAGTGAGAAGG - Intronic
908182391 1:61618883-61618905 ATGGGCAGGCAGAAGGGGGAGGG + Intergenic
908337979 1:63147019-63147041 ATGAGCCTGGAGAGATGGGCAGG - Intergenic
909879736 1:80859511-80859533 ATGGGCTGAGAGAAGTGGAATGG - Intergenic
910927700 1:92413287-92413309 ATAAGCTGGGAGAAGGAGGAGGG - Intergenic
913483507 1:119312325-119312347 GGGAGCAGGGAAAAGTGGGAAGG + Intergenic
913965645 1:143375332-143375354 ATTAGCCGGGAGTGGTGGCATGG + Intergenic
914060018 1:144200934-144200956 ATTAGCCGGGAGTGGTGGCATGG + Intergenic
914119132 1:144765435-144765457 ATTAGCCGGGAGTGGTGGCATGG - Intergenic
914407756 1:147393166-147393188 ATTAGCCGGGCGTAGTGGGGCGG - Intergenic
914433210 1:147638593-147638615 ATGAGGCTGGAGAGGTGGGCAGG + Intronic
914721473 1:150292678-150292700 ATTAGCCGGGTGTAGTGGCATGG - Intergenic
914918595 1:151832881-151832903 ACGAGACGGCAGAAGAGGGAAGG - Intergenic
915490421 1:156247381-156247403 ATGTGCCGGGAGAGGCGGGCGGG - Intronic
915899064 1:159833470-159833492 ATGAGGTGGGAGAGGTAGGAAGG - Intronic
915967941 1:160328356-160328378 ATGATCCGGGAAAAGGGGAAGGG + Intronic
917975750 1:180236481-180236503 AGGAGCCGGGGGAAGGAGGATGG + Intronic
918024877 1:180733354-180733376 ATGATACGGGAGTACTGGGAAGG - Intronic
918528053 1:185486578-185486600 CAGAGCCTGGAGAAGTGGAATGG + Intergenic
920198612 1:204245524-204245546 GTGAGCTGGCAGGAGTGGGATGG + Intronic
922905006 1:229167639-229167661 AAGAGAAGGGAGAAGTGGGAGGG + Intergenic
922966453 1:229694904-229694926 ATGAGGCTAGAGAGGTGGGAAGG - Intergenic
923419914 1:233802694-233802716 ATCAGACCTGAGAAGTGGGACGG - Intergenic
923513160 1:234670997-234671019 AAGAGCAGGGAGACGTGGCATGG - Intergenic
924089444 1:240487281-240487303 AGGAGCCGGGAGAAGAAGGATGG + Intergenic
924129104 1:240887374-240887396 ATGAGCCGGGCGTGGTGGCAGGG - Intronic
924131371 1:240912001-240912023 ATTAGCCAGGCGAAGTGGCAGGG + Intronic
1063847717 10:10149791-10149813 ATGAAGAGGGAGGAGTGGGATGG - Intergenic
1064198335 10:13263657-13263679 GAAAGCTGGGAGAAGTGGGAAGG + Intergenic
1065328463 10:24570453-24570475 ATGGGCAGGGAGAAGAGGAAAGG + Intergenic
1065735068 10:28743957-28743979 GAGAGCCGGGAGAACTGGGCTGG - Intergenic
1067709822 10:48639099-48639121 CTGAGCTTAGAGAAGTGGGATGG - Intronic
1067784137 10:49230128-49230150 TTGAGCCAGGAGAATGGGGAGGG + Intergenic
1068943019 10:62699372-62699394 AGGGGCTGGGAGGAGTGGGAGGG + Intergenic
1069963890 10:72097595-72097617 ATGATCCAGGAGAGGAGGGATGG + Intronic
1072071428 10:91921812-91921834 ATGAGATGGGAGAAGTAGAAAGG - Intergenic
1072704101 10:97667586-97667608 AAGAGGTGGGAGAATTGGGAGGG - Intronic
1072766831 10:98101464-98101486 AGCAGCCAGGAGAATTGGGAGGG + Intergenic
1073080519 10:100857214-100857236 ATGAGATTGGAGAAGTGGGTAGG - Intergenic
1073403102 10:103275050-103275072 ATGAGCCGGGTGTGGTGGCACGG - Intergenic
1073513879 10:104060315-104060337 ATGTGCCAGGAGAAGGGAGAGGG + Intronic
1073917575 10:108424314-108424336 ATGAGCTGGGAAAATTAGGAAGG + Intergenic
1074562065 10:114543739-114543761 ATGATGCTGGAGAAGTGGGCAGG - Intronic
1075162550 10:120037295-120037317 ATGAGCTGGAAGTTGTGGGAAGG + Intergenic
1076104770 10:127812928-127812950 AGGAGTGGGGAGAACTGGGAAGG - Intergenic
1076379049 10:130012554-130012576 ATGAGGTGGGGGAGGTGGGAGGG + Intergenic
1076838411 10:133032723-133032745 ATGAGGAGGGAGAAGGGGGCAGG - Intergenic
1077282725 11:1752956-1752978 ATGAGCTGGAAGGAGTGAGAGGG - Exonic
1078501223 11:11879568-11879590 ATGAGCCAGGAGGAGGGGGAAGG - Intronic
1078757501 11:14224759-14224781 ATGAGGCCGGAGAAGTAGGTGGG + Intronic
1078983289 11:16562713-16562735 ATTCTGCGGGAGAAGTGGGAGGG - Intronic
1081933138 11:46886338-46886360 ATCAGCAGGGCCAAGTGGGATGG - Exonic
1083241698 11:61393201-61393223 AGGAGCACAGAGAAGTGGGATGG - Intronic
1084025630 11:66447116-66447138 ATGAGCCTGGACAGGTGGGTAGG + Intronic
1085557745 11:77440847-77440869 AGGAGCAGGTAGAGGTGGGAGGG - Intronic
1085848916 11:80097654-80097676 ATGAACCGGCTGAGGTGGGAAGG - Intergenic
1086344106 11:85878333-85878355 ATGAGGGGGCAGAACTGGGAGGG - Intronic
1086609023 11:88731206-88731228 ATGAAGCTGGAGAAGTGGGCAGG - Intronic
1087402333 11:97683866-97683888 AGGAGGAGGGAGGAGTGGGAAGG - Intergenic
1088381172 11:109194513-109194535 AAGAGGAGGGAGAAGAGGGAAGG - Intergenic
1088801184 11:113308645-113308667 ATGAGCCCAGAGATGTGGGTAGG - Intergenic
1088836353 11:113580801-113580823 AGGAGCCAGGAGAACTAGGAGGG + Intergenic
1090260979 11:125319897-125319919 ATGAGGCTGGAAAGGTGGGAAGG + Intronic
1090587238 11:128226476-128226498 GTGAGCTCTGAGAAGTGGGATGG - Intergenic
1090948741 11:131453897-131453919 ATGAGCCTGCAGTAGTGGGCTGG + Intronic
1091829402 12:3538945-3538967 GTGAGCTGGGGGCAGTGGGATGG - Intronic
1093504566 12:19850202-19850224 ATGAGCAGGAAGAATTGGGCTGG + Intergenic
1093647841 12:21609196-21609218 ATGAACCTGGAGAAGTGGGAAGG + Intergenic
1095775855 12:46009265-46009287 TTGAGGAGGGAGAAGTCGGAAGG + Intergenic
1096626224 12:52897674-52897696 ATGAGCAGGGAGAAGGGGCATGG - Intronic
1098145916 12:67497826-67497848 TGGAGGTGGGAGAAGTGGGAAGG - Intergenic
1098236408 12:68422498-68422520 ATCATCAGGGAGAAGGGGGAAGG - Intergenic
1098363876 12:69681931-69681953 ATTAGCCGGGTGTAGTGGTAGGG + Intronic
1098525975 12:71487560-71487582 ATGAGCCGGGTGTGGTGGCATGG - Intronic
1099988543 12:89698016-89698038 ATTAGCCGGGCGTAGTGGCATGG - Intronic
1100598757 12:96094205-96094227 ATAAGCAGGGAGAGGTGAGAAGG + Intergenic
1102788573 12:115624217-115624239 ATGAGCCGGGAGATGCCGGCAGG - Intergenic
1103147327 12:118606933-118606955 ATGAGACAGGAGAAGTTGGCAGG - Intergenic
1103613025 12:122135558-122135580 AAGAGCCGGGAGACGGGGGCAGG - Exonic
1104159556 12:126165177-126165199 ATGAGGCTGGAGATGTGGCAGGG + Intergenic
1104489477 12:129181591-129181613 ATGAGGTGGGAGAGGTGGGAAGG - Intronic
1104915050 12:132260223-132260245 AGGAGCTGAGAGAGGTGGGAGGG + Intronic
1106205167 13:27586400-27586422 CTGAGCTGGGAGAAGAGGGGTGG - Intronic
1108432858 13:50371720-50371742 CTGAGCCTGGAGAGGTGGGGAGG + Intronic
1108645702 13:52425098-52425120 ATTAGCCGGGCGCAGTGGGGTGG + Intronic
1108760762 13:53560986-53561008 AGTTGCAGGGAGAAGTGGGAGGG - Intergenic
1109188591 13:59299188-59299210 AGGAGCAGGGAGAAGAGGGTTGG + Intergenic
1109279693 13:60341817-60341839 ATGAGACTGGGGAAGTGGAAGGG - Intergenic
1109895986 13:68690908-68690930 ATGAGACCTGAGAAGTGGGCAGG + Intergenic
1113966368 13:114155719-114155741 ATGAGGGTGGAGAAGTGGGGAGG + Intergenic
1113991974 14:16035177-16035199 ATGTGACGGGAGAAGTGTCAAGG - Intergenic
1114891192 14:26925857-26925879 AGGTGCCGGGAGAAGTGAGCTGG - Intergenic
1118611151 14:67541323-67541345 GGGAGCTGGGAAAAGTGGGAGGG - Intronic
1118743519 14:68758128-68758150 ATGAGCCAGGGGAAGAGGGGTGG + Intergenic
1119409329 14:74419908-74419930 ATGAGGCAGGAGAGGTGGGAAGG + Intronic
1119806541 14:77485786-77485808 ATGAGACGGGAGGGGTGGCAAGG - Intronic
1121392480 14:93588133-93588155 ATGAGGCTGGAGAAGTAGGTTGG + Intronic
1121740125 14:96246064-96246086 ATGAGCCTGGAGCAGAGAGAGGG - Intronic
1122388183 14:101362964-101362986 GTGGGCTGGGAGAAGTGGGTAGG - Intergenic
1125534496 15:40435669-40435691 ATGAGGCTGGAGAAGTGGGTAGG - Intronic
1128223299 15:65983513-65983535 ATGTTCTGGGAGAAGTTGGATGG + Intronic
1128312128 15:66637367-66637389 AGGAGACAGGAGAGGTGGGAGGG + Intronic
1129144063 15:73632436-73632458 ATGAGCTGGGGGAAGAGGGCTGG - Intronic
1129974751 15:79812836-79812858 ATGAGGCTGGAGAAGTAGGGAGG + Intergenic
1130430479 15:83842219-83842241 ATGAGGAGGCAGAAGGGGGATGG + Intronic
1130651805 15:85766345-85766367 ATGAGCCGGGAGAATGGCCAAGG + Intronic
1132113648 15:99120282-99120304 ATGTGTCGGGTGCAGTGGGAGGG + Intronic
1133431957 16:5745084-5745106 ATGAGGTGGGGGAAGGGGGAGGG - Intergenic
1133805953 16:9126113-9126135 ATGAGCCAGAATAAGGGGGATGG - Intergenic
1135523585 16:23196365-23196387 ATGAGGAGGGAGAAGTAGGCAGG + Intronic
1137005967 16:35274580-35274602 ATGAGCAGAGCCAAGTGGGAGGG + Intergenic
1137055921 16:35746660-35746682 ACAAGCAGGGAAAAGTGGGAAGG - Intergenic
1137056733 16:35749677-35749699 ATCAGCGGGGAAAAGCGGGAAGG - Intergenic
1138154883 16:54693752-54693774 ATGAGGCAGGAGGAGAGGGAGGG + Intergenic
1139652114 16:68367671-68367693 ATGAGGAGGGAGAAGCGGGGCGG - Intronic
1140315633 16:73894054-73894076 ATTAGCCGAGAGAAATAGGAGGG - Intergenic
1140885136 16:79236329-79236351 ATGAGCCTGGAGGAGGGAGAGGG - Intergenic
1141680424 16:85540757-85540779 ATTAGCCAGGTGAAGTGGCATGG + Intergenic
1142583194 17:954468-954490 CTGAGCCTGGAGAATTTGGAAGG - Intronic
1142694030 17:1623590-1623612 AGGAGAGGAGAGAAGTGGGAAGG - Intronic
1144344286 17:14336065-14336087 ACGGGCCAGGAGAAGTGGGTGGG + Intronic
1144589524 17:16512487-16512509 ATGAGCCAGCAGAAGTGGAAGGG - Intergenic
1144753996 17:17668553-17668575 GTGTGCCGGGAGCAGTGGGGAGG - Intergenic
1145239993 17:21235577-21235599 ATGAGACTGGAGAGGTGGGATGG - Intergenic
1146142198 17:30378131-30378153 ATGAGGTGGGAGAAGTGGGCCGG + Intergenic
1146294540 17:31639420-31639442 AAGAGTGGGGAGGAGTGGGAAGG - Intergenic
1146297955 17:31665054-31665076 ATGAGGTGGGAGAAGGGGGAAGG - Intergenic
1146428014 17:32762305-32762327 ATGAGGTGGGAGAGGTGGGCTGG + Intronic
1146561107 17:33871425-33871447 ATGAGCAGGGAGAAGGAGGTGGG - Intronic
1146643230 17:34556691-34556713 AGGAGCCTGGAGAGGTGTGAAGG + Intergenic
1146983216 17:37185714-37185736 ATTAGCCGGGAGTGGTGGCAGGG - Intronic
1147966911 17:44198983-44199005 ATGAGCCGGGGGCACTGGGAAGG + Intronic
1148225169 17:45894365-45894387 ACGAGCCGGGAGACGCCGGACGG + Exonic
1149526695 17:57361724-57361746 ATGAGAAGGAAGAAGAGGGATGG + Intronic
1149995906 17:61405801-61405823 ATGTGCTGGGAGAGGTGGAACGG - Exonic
1150291388 17:63984424-63984446 ATGAGCTGGGAGAAGTTAGTGGG - Intergenic
1150375406 17:64677242-64677264 CTGAGCCAGGAGAACTGGCAGGG - Intergenic
1151296598 17:73190945-73190967 ATTAGCCGGGAGTAGTGGTGTGG - Intergenic
1151910398 17:77079113-77079135 AGGAGGAGGGAGAGGTGGGAAGG - Intergenic
1152318234 17:79593243-79593265 AAGAGCTGGGAGAAGGAGGAAGG - Intergenic
1152753418 17:82077124-82077146 GAGAGCCGGGAGAAGCAGGAGGG + Intergenic
1152807177 17:82361697-82361719 ATGAGCCCGGGGAGGTCGGATGG + Intronic
1153769441 18:8403376-8403398 AAGAGCAGGGAGGAGAGGGAGGG + Intronic
1153794321 18:8609224-8609246 AAGAGCCGGCGGAAGAGGGAGGG + Intergenic
1154101926 18:11483737-11483759 TAGAGTGGGGAGAAGTGGGAAGG + Intergenic
1154441616 18:14393931-14393953 ATGAGCCGGCCGCAGGGGGAGGG + Intergenic
1156447152 18:37245621-37245643 TTGAGCTGGGAGGAGTGGGCTGG - Intronic
1156453086 18:37277584-37277606 AAGAGCTGGGAGAAGAGGGCTGG + Intronic
1156502596 18:37568911-37568933 ATCAGGTGGGAGAAGGGGGAGGG - Intergenic
1158157562 18:54443027-54443049 ATGAGAGTTGAGAAGTGGGATGG - Intergenic
1159585836 18:70282975-70282997 GTGAGCCTGGAGAAGCAGGAGGG + Intergenic
1159618273 18:70607320-70607342 ATGTGCAGGGTGAAATGGGAGGG + Intergenic
1159778850 18:72637741-72637763 AAGATCCAGGAGAGGTGGGATGG - Intronic
1161218839 19:3108517-3108539 GCGAGCCTGGAGAAGTGGGCTGG + Intronic
1161284815 19:3463652-3463674 GTGAGCCGGGCGAGGTGGGGGGG - Intronic
1161841269 19:6682106-6682128 AGGAGCTGGGATAAGTGGAAAGG - Intronic
1162324253 19:9989437-9989459 ATGAGCTGGGAAAAGGAGGAAGG - Intronic
1162699751 19:12505175-12505197 ATTAGCCGGGCGTAGTGGCAGGG + Intronic
1163050494 19:14679718-14679740 ATGAGGCTGGAGAAGTGGAGTGG - Intronic
1163102887 19:15108384-15108406 ATGAGACAGGAGAGGAGGGAGGG + Intronic
1163144747 19:15372957-15372979 ATGGACTGGGAGAAGAGGGACGG + Exonic
1163149236 19:15401289-15401311 ATGTTCTGGGAGAAGAGGGAGGG + Exonic
1163272782 19:16264090-16264112 ATTAGCCGGGCGAAGTGGGGGGG - Intergenic
1164510678 19:28894511-28894533 ATGAAACAGGAGAAGTGGGGTGG + Intergenic
1164704450 19:30309954-30309976 AGGGGCAGGGACAAGTGGGAAGG + Intronic
1165216450 19:34277192-34277214 ATGAGGCTGGAGAGGTGGGCAGG + Intronic
1166812497 19:45522585-45522607 AGGGGCCGGGAGAGGTGGGCAGG + Intronic
1166840855 19:45696089-45696111 ATGAGGCGGGAGCCCTGGGAGGG - Intronic
1167243363 19:48358842-48358864 GTGAGCCGGGAGCCATGGGAGGG - Intronic
1167245566 19:48371093-48371115 ATGAGGCTGGAAAAGTGGGTGGG - Intronic
1167566464 19:50260618-50260640 ATGAGCAGGGAGGGGTGGGGAGG - Intronic
1167666700 19:50826579-50826601 ATCAGGCGGAAGAAGAGGGATGG - Intronic
1202699423 1_KI270712v1_random:152817-152839 ATTAGCCGGGAGTGGTGGCATGG + Intergenic
925414704 2:3661261-3661283 ATGAGCCAGGAGCAGAAGGAAGG - Intronic
925957166 2:8978150-8978172 ATGAGGCTGGAGAGGTGGAAGGG - Intronic
926056015 2:9774471-9774493 TTCTCCCGGGAGAAGTGGGACGG - Intergenic
926689800 2:15725408-15725430 ATGAGCCAGGAGACGGAGGAAGG - Intronic
927848016 2:26481212-26481234 CTGAGCTGGAAGCAGTGGGAAGG + Intronic
927937584 2:27084316-27084338 ATGAACAGGGAGAAGATGGATGG - Intronic
927940929 2:27102353-27102375 CTGAGCCGGGAGCAGGGTGAGGG - Exonic
928511374 2:32007144-32007166 ATGAGCCTGGAGTAGTAGGCTGG - Intronic
929005701 2:37390771-37390793 AGGAACCGGGAGAAGAGAGAAGG - Intergenic
933230774 2:79804956-79804978 ATGAGCTGGGCCAAATGGGAAGG + Intronic
933343641 2:81054209-81054231 GTGAGCAGGGAGGAGTGGAAAGG - Intergenic
935101183 2:99997693-99997715 ATGGGATGGGAGAAGTGGCAGGG - Intronic
935657721 2:105439065-105439087 ATGAGCAGGGAGGATAGGGAGGG - Intergenic
935935749 2:108181408-108181430 ATGAGATGGGAGAAGTGTGAGGG + Intergenic
938784739 2:134616304-134616326 ATGAGCCAGGAGAATTGCCATGG - Intronic
939684774 2:145185573-145185595 ATGAGCCGGGAGGGGAGGGGAGG + Intergenic
939783880 2:146484187-146484209 ATGAGTAGGGAGAAGGGAGAAGG + Intergenic
941006304 2:160250741-160250763 ATGAGGCTGGAAAAGTGGGCAGG + Intronic
941389548 2:164894837-164894859 ATGAGGCTGGAGATGTAGGAGGG - Intergenic
944062688 2:195585741-195585763 ATTAGCCGGGAGTGGTGGCATGG + Intronic
945641084 2:212430816-212430838 ATGAGGTGGGAGATGGGGGATGG + Intronic
946195631 2:218031921-218031943 ATGGGGCGGGAGCAGTGGGGAGG - Intergenic
946934735 2:224708381-224708403 ATGAGGATGGAGAAGTGAGAAGG - Intergenic
947418619 2:229922159-229922181 TCGAGCCGGGAGGCGTGGGAGGG - Intronic
1169112706 20:3044119-3044141 ATGGACCTGGACAAGTGGGAGGG + Intronic
1169776651 20:9262503-9262525 ATGAGACTGGAGGAGTAGGAAGG + Intronic
1170048410 20:12112518-12112540 ATGAGCCGGGTGAAGTGCGATGG - Intergenic
1170175193 20:13460999-13461021 ATGAGCTGGAAGAAGTAGTAAGG - Intronic
1171812603 20:29757242-29757264 ATGTGACGGGAGAAGTGTCAAGG + Intergenic
1171868672 20:30508982-30509004 ATGTGACGGGAGAAGTGTCAAGG + Intergenic
1172523744 20:35585082-35585104 AGGGGCCGGGAGAAGTGGAGTGG - Intergenic
1173446219 20:43121003-43121025 AGGAGCCGGGAGATGTGGACTGG - Intronic
1173823431 20:46032440-46032462 ATGCGGCTGGAGATGTGGGATGG + Intronic
1174727496 20:52878267-52878289 ATGAGCCTGGAGAAGTAAGCTGG - Intergenic
1176454444 21:6897243-6897265 ATGAGCCGGCCGCAGGGGGAGGG - Intergenic
1176832617 21:13762291-13762313 ATGAGCCGGCCGCAGGGGGAGGG - Intergenic
1177006848 21:15684030-15684052 ATGAGACTGGAGAAGTGGGCAGG + Intergenic
1177736207 21:25092926-25092948 AGGAGCCGGGGGAAGAGGGAGGG - Intergenic
1178526092 21:33330713-33330735 GTGAGCAGAGAAAAGTGGGATGG + Intronic
1179037667 21:37773445-37773467 ATGAGTAGGGAGCAGAGGGAAGG + Intronic
1179482009 21:41684487-41684509 AGGAGCCAGGAGAGGTGGGTGGG + Intergenic
1180188730 21:46152864-46152886 ATGAGACGGGAGCAGAGTGAGGG + Intronic
1180315296 22:11272350-11272372 ATGTGACGGGAGAAGTGTCAAGG + Intergenic
1180952848 22:19728531-19728553 ATGAGCAAGGAGCAGTGGCATGG - Intergenic
1182033015 22:27174902-27174924 CAGAGCAGGGAGAAGAGGGATGG + Intergenic
1182271734 22:29158138-29158160 ATGAGGCTGGAGAAGTGGGCTGG + Intronic
1183135361 22:35881809-35881831 ATTAGCCGGGTGTAGTGGCATGG + Intronic
1184276734 22:43412987-43413009 TTGAGCCCGGAGAGGTGGGAGGG - Intronic
1184339927 22:43880581-43880603 ATGAGACGGGGCAAGAGGGAGGG + Exonic
949454752 3:4226868-4226890 AGGGGACGGGAGAAGTGAGAAGG - Intronic
950112763 3:10430640-10430662 AAGAGGTGGGAGAAGGGGGATGG - Intronic
950621633 3:14210476-14210498 ACGAGCCTGGAGAAGGGGGAAGG + Intergenic
950621787 3:14211852-14211874 ACGAGCCAGGAGAACAGGGAGGG + Intergenic
950961985 3:17117161-17117183 ATGAACCTGGAGAAATGGGCAGG + Intergenic
951422126 3:22499153-22499175 ATGACCCTGCAGAAGTGGGCAGG + Intergenic
952515987 3:34105122-34105144 ATGGGCCAGGAGAAGGGGGGGGG + Intergenic
952577681 3:34794608-34794630 ACAAGACTGGAGAAGTGGGATGG + Intergenic
953345420 3:42171613-42171635 ATGAGCCGGGAGAAGTGGGAAGG - Intronic
954081910 3:48217433-48217455 ATGAACAGGGAGCAGTGAGAGGG + Intergenic
954561542 3:51561116-51561138 ATGAGCCTGGAGAAGTAACAGGG - Intronic
954901310 3:54022320-54022342 ATGAGGCTGGCGAGGTGGGAAGG + Intergenic
954959779 3:54554004-54554026 ATGAGGCTGGAGAGGTGGGGAGG - Intronic
955061679 3:55497832-55497854 AAGAGCCAAGAGAGGTGGGAAGG + Intergenic
956232203 3:67029813-67029835 ATTAGCCGGGCGTGGTGGGAGGG + Intergenic
956472498 3:69582149-69582171 ATGAGGTGGGAGAAAGGGGAGGG + Intergenic
959078963 3:101779780-101779802 ATGAGCCGAGAGATATGAGATGG - Intronic
960576881 3:119239176-119239198 ATTAGCCGGGAGTAGTGGCCTGG + Intronic
960902144 3:122564167-122564189 GTGGGCGGGGAGAAGGGGGACGG - Intronic
961001900 3:123379573-123379595 AAGTGCAGGGAGCAGTGGGAAGG + Intronic
961173556 3:124816096-124816118 AGGAGATGGGAGCAGTGGGAAGG + Intronic
961935780 3:130582072-130582094 CTGAGTATGGAGAAGTGGGAAGG + Intronic
962498550 3:135966164-135966186 AGGAGCCCTGAAAAGTGGGAGGG - Intronic
963108279 3:141664783-141664805 ATGAGCGGGGAGACATGGCAGGG - Intergenic
963124381 3:141801753-141801775 AATAGTCAGGAGAAGTGGGAAGG + Intronic
963639412 3:147839787-147839809 ATTGGCGTGGAGAAGTGGGAAGG + Intergenic
964381795 3:156104999-156105021 GTAAGCCTGGAGAAATGGGACGG - Intronic
964924552 3:161939555-161939577 ATGAGACCAGAGAAGTAGGAGGG - Intergenic
966927868 3:184657314-184657336 AGGGGCAGGGATAAGTGGGAGGG - Intronic
968914402 4:3490996-3491018 ATGAGCAGGAAGAAGAAGGAAGG - Intronic
969664054 4:8546926-8546948 AGGAGCAGGGAGAGGCGGGAAGG + Intergenic
970546077 4:17131742-17131764 ATGAGGCCAGAGAAGTGGAAGGG - Intergenic
971219922 4:24695717-24695739 CTGAGCTGGGAGAAGAAGGAGGG + Intergenic
971317940 4:25582977-25582999 ATGAGCAGGAAGCAGTGGAATGG - Intergenic
972350354 4:38231008-38231030 AGGGGCCTGGACAAGTGGGAGGG - Intergenic
972786017 4:42327435-42327457 TTGAGCCTGGTGAGGTGGGAGGG + Intergenic
975010912 4:69349987-69350009 CTGAGCGGGGAGAAGTAGAAAGG - Intronic
977600540 4:98929679-98929701 CTGAGCCAGGGGACGTGGGAGGG - Intronic
977934683 4:102787694-102787716 CTGAGCAGGAAGGAGTGGGATGG + Intergenic
979537180 4:121836349-121836371 ATGAGGAGGCATAAGTGGGATGG - Intronic
980152461 4:129063750-129063772 AGGAGCAGGGAGAACAGGGAGGG - Intronic
981131233 4:141160729-141160751 TAGAGCAGGAAGAAGTGGGAGGG - Intronic
981744011 4:148034463-148034485 ATTAGCCGGGAGTGGTGGCAGGG - Intronic
982175919 4:152705482-152705504 AGGAGCAGGGAGAAGTGGAGGGG - Intronic
983695668 4:170526823-170526845 ATGAGCTGGGAGGAGGGGGAAGG + Intergenic
985774115 5:1831780-1831802 AGGAGCCGGGGGAAGGGGGCTGG - Intergenic
988883349 5:35529494-35529516 ATGAGAAGGGAAAAGTGGAAGGG - Intergenic
993852218 5:93024338-93024360 ATGAGGCTGGAGAAGTGAGCAGG + Intergenic
994657395 5:102610461-102610483 ATGAGGCTGGAGAAGAGGCAGGG - Intergenic
994792358 5:104245528-104245550 GTGAGTGGGGGGAAGTGGGAGGG + Intergenic
996646878 5:125827521-125827543 ATGAGCCAGGGAAAGTGGGATGG - Intergenic
998485109 5:142495110-142495132 ATGAGCCGGGCGCAGTGAGCCGG - Intergenic
999255674 5:150208910-150208932 ATGAACCGGGAGAACTGCGGTGG - Intronic
1002198543 5:177514059-177514081 CTGACCCAGGAGAAGGGGGAAGG - Intronic
1005997544 6:30940577-30940599 CTGATGCGGGAGAGGTGGGAGGG + Intergenic
1006025219 6:31142529-31142551 AGGATCCTGGAGAAGTGGGTGGG - Exonic
1006150522 6:31984488-31984510 ATGAGATGTGAGAAGTGGGGTGG - Intronic
1006156823 6:32017226-32017248 ATGAGATGTGAGAAGTGGGGTGG - Intronic
1006990006 6:38207189-38207211 ATGAGCTGGGGGATGGGGGATGG + Intronic
1007375233 6:41451887-41451909 ACTGGCAGGGAGAAGTGGGAAGG - Intergenic
1008307298 6:49918850-49918872 ATGAGCTGGTGGAAGTGTGATGG - Intergenic
1010577074 6:77544839-77544861 CTGAGCAGGGAGAAGTGAAAGGG + Intergenic
1010748598 6:79592670-79592692 ATGAGGCTGGAGAAGTCGGCAGG + Intergenic
1012390213 6:98729669-98729691 ATGAGCAAGGAGGATTGGGAAGG + Intergenic
1013064897 6:106674243-106674265 AGGAGCTGGGAGGAGTGGAATGG - Intergenic
1013263547 6:108471080-108471102 ATGAGGAGGGAGAAATGTGAGGG + Intronic
1013367709 6:109447827-109447849 CTGAGCAGGGAGGAGTGGGCAGG - Intronic
1015156533 6:130102593-130102615 ATGAACCGGGAGAAGCAGGCAGG - Intronic
1015510435 6:134033094-134033116 GTGAGCCTGGAGAGGTAGGACGG + Intronic
1015786251 6:136923170-136923192 ATTCTCCGGGAGAGGTGGGAGGG + Intronic
1016839669 6:148513746-148513768 AGGAGCCGGGAGAGGCGGAAGGG + Intronic
1017488156 6:154921626-154921648 AGGAGTCGGGTGAAGGGGGAAGG + Intronic
1017725791 6:157275092-157275114 AGGAGCCGGGAGGGATGGGAGGG + Intergenic
1017757310 6:157540259-157540281 ATCAGCCTGGGGAAGTGGGGTGG + Intronic
1018838674 6:167503742-167503764 ATAAGCCGGGAGAGAAGGGATGG - Intergenic
1019497453 7:1347090-1347112 AGGAGCCGGCAGGAGGGGGATGG - Intergenic
1020419577 7:7986362-7986384 ATTAGCCGGGAGCAGGGGGAGGG + Intronic
1020640969 7:10753064-10753086 ATGGGGTGGGGGAAGTGGGAAGG + Intergenic
1020905024 7:14053569-14053591 CTGACCAGGGAGAACTGGGATGG - Intergenic
1021406526 7:20274102-20274124 GAGAGGCGGGAGAAGTGGGGAGG + Intergenic
1021629939 7:22634968-22634990 ATCAGCAGGGAGAAGAAGGAAGG + Intergenic
1022577754 7:31514955-31514977 CTGAACCAGGAGAAGTGAGAGGG - Intronic
1022865415 7:34413680-34413702 TTAAGGAGGGAGAAGTGGGAGGG - Intergenic
1024822377 7:53347910-53347932 ATGGGGTGGGGGAAGTGGGAGGG + Intergenic
1025095030 7:56090070-56090092 ATGAGGAAGGAGCAGTGGGATGG - Intronic
1028649115 7:93130629-93130651 ATGAGCTGGGAGAAGGGCAAGGG + Exonic
1030783094 7:113625780-113625802 AGGAGAGGGGAGAAGGGGGAAGG - Intergenic
1031967525 7:128037764-128037786 ATGAGCCAAGAGAAGGGGGCAGG + Intronic
1031975375 7:128090255-128090277 ATCAGCCCTGAGAAGTGGCAAGG - Intronic
1034537315 7:151733650-151733672 CTGAGCAGGGAGAGGAGGGATGG - Intronic
1037296753 8:17409955-17409977 ACGAGGCTGGAGAAGTAGGAAGG + Intronic
1038486519 8:27939237-27939259 ATGAGCAGGGAGAAGGGGCATGG - Intronic
1039823042 8:41150632-41150654 ATGAGCAGGGAGACCTGGAAGGG + Intergenic
1039984280 8:42435084-42435106 ATGAGGAGGAGGAAGTGGGACGG + Intronic
1040618999 8:49068333-49068355 ACTAGCCAGGAGAGGTGGGATGG + Intronic
1040858698 8:51977024-51977046 ATTAGCCGGGCGTAGTGGCAGGG - Intergenic
1041606059 8:59783614-59783636 ATCAGCAGAGAGAAGTAGGAGGG - Intergenic
1041765409 8:61413497-61413519 ATGATCCAGCAGCAGTGGGATGG + Intronic
1043401092 8:79885065-79885087 AGGAGCCAGGCTAAGTGGGAGGG + Intergenic
1043514391 8:80982590-80982612 ATGAGCCGGGTAAAGAGGAAAGG - Intronic
1044222788 8:89688923-89688945 ATGAGCCAGGTGCAGTGGCATGG + Intergenic
1044410958 8:91882037-91882059 ATAAACTGGGAGAAGTGAGAAGG + Intergenic
1044417716 8:91954883-91954905 GTGTGGCTGGAGAAGTGGGATGG + Intergenic
1045069418 8:98485781-98485803 ATGAGCCTGGAGAAGTAGATGGG + Intronic
1045809185 8:106201564-106201586 ATGTGCCTGGAGGAGTTGGAAGG - Intergenic
1047037230 8:120953297-120953319 ATGAGGGGGGAGGAGAGGGAGGG + Intergenic
1047319958 8:123769430-123769452 ATGAGCCTGGAAAAGTGGTCAGG + Intronic
1049151210 8:141036652-141036674 AGGAGCAGGAAGAAGTGGGGAGG - Intergenic
1049347513 8:142146681-142146703 ATGTGGCTGGAGAAGTGGGAGGG + Intergenic
1050271480 9:3950430-3950452 ATGAGGCTGGAGAAGTAGGCGGG - Intronic
1050458149 9:5853667-5853689 ATGGGCAGGGGGTAGTGGGAGGG - Intergenic
1051065268 9:13094598-13094620 ATGAGCCAGGAGGGGAGGGAAGG + Intergenic
1052684457 9:31737165-31737187 ATGAGCCAGAAGTAGTGGTAGGG - Intergenic
1053111700 9:35466399-35466421 AGGGGAAGGGAGAAGTGGGAAGG + Intergenic
1053311591 9:37024256-37024278 ATGAGCCTGGAATAGTGGGTGGG + Intronic
1055131940 9:72785709-72785731 CTGGGCAGGGTGAAGTGGGAAGG + Intronic
1057455504 9:95206167-95206189 AGGAGGCGGGAGAAGGAGGAAGG + Intronic
1058008752 9:99950697-99950719 ATGAGCCGTGAGAAATGTGTGGG + Intronic
1058164848 9:101607550-101607572 GTGAGCAGGGAGAAGGAGGAGGG + Intronic
1060059822 9:120449114-120449136 AAGAGCAGGGTGAAGTGGAAGGG - Intronic
1060190667 9:121590284-121590306 ATGACAGGGGAGGAGTGGGAAGG - Intronic
1203363583 Un_KI270442v1:238259-238281 ATGTGACGGGAGAAGTGTCAAGG + Intergenic
1185445197 X:254183-254205 AGGAGCCGGGAGAGGCAGGAAGG - Intergenic
1185548470 X:965262-965284 AGGAGCTGGGAGAGGTGGGAAGG - Intergenic
1185579828 X:1203332-1203354 AGGAGCTGGGAGAGGTAGGAAGG + Intronic
1185604832 X:1362655-1362677 AGGAGCTGGGAGAAGCGGGAAGG - Intronic
1185653722 X:1667745-1667767 AGGAGCTGGGAGAAGCAGGAAGG - Intergenic
1185813542 X:3132538-3132560 AGGAGCCGGGAGAGGCAGGACGG - Intergenic
1186513175 X:10146481-10146503 AAGAGCCGGAAGAGGCGGGAAGG - Intergenic
1186862305 X:13685267-13685289 ATGAGCAGGCAGCAATGGGAAGG - Intergenic
1186872904 X:13789991-13790013 ATGAGCTGGGTGCAGTGGCATGG - Intronic
1187031298 X:15491202-15491224 CTCAGCCGGGAGCAGTCGGAAGG - Exonic
1187380442 X:18796961-18796983 AAGAGCCTTAAGAAGTGGGAGGG + Intronic
1188374610 X:29412684-29412706 ATCAGCCTGGAGAAGTGTAAGGG + Intronic
1190009406 X:46771058-46771080 TAGAGCAGGGAAAAGTGGGAAGG + Intergenic
1192380856 X:70614416-70614438 ATGGGCCTGTGGAAGTGGGAGGG + Intronic
1192468216 X:71373313-71373335 ATTAGCTGGGAGAGGTGGCACGG - Intronic
1192553573 X:72072452-72072474 GTGAGGCTGGAGAAGTAGGAGGG - Intergenic
1193656256 X:84201637-84201659 ATGGGAAGGCAGAAGTGGGAGGG - Intergenic
1193869306 X:86777377-86777399 ATGTGCAGGGACAAGTGTGAAGG - Intronic
1196618585 X:117796000-117796022 AAGAGCAGTGGGAAGTGGGAAGG + Intergenic
1197038147 X:121903245-121903267 AGAAGCTGGGAGAAGTGGGAAGG - Intergenic
1198233146 X:134712711-134712733 ATGAACCGGGAGAGGCAGGATGG - Intronic
1198519477 X:137438315-137438337 ATGTGACGGGAGAAGTGTCAAGG + Intergenic
1201274747 Y:12286858-12286880 CTGGGCCGGGAGAAGTCGGCAGG + Intergenic
1201564704 Y:15353914-15353936 AGGAGCTGGGAGAAGCAGGAAGG + Intergenic