ID: 953346148

View in Genome Browser
Species Human (GRCh38)
Location 3:42177689-42177711
Sequence GTTGAAGCTCAGACAGAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 172}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953346147_953346148 -7 Left 953346147 3:42177673-42177695 CCAGTGGGAGGTCAGGGTTGAAG 0: 1
1: 0
2: 1
3: 25
4: 253
Right 953346148 3:42177689-42177711 GTTGAAGCTCAGACAGAAACTGG 0: 1
1: 0
2: 2
3: 9
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953346148 Original CRISPR GTTGAAGCTCAGACAGAAAC TGG Intronic
903583272 1:24388267-24388289 GGTGAAGTGGAGACAGAAACAGG + Intronic
905793100 1:40800670-40800692 GCTGATGCTCAGACAGTATCTGG - Intronic
910144666 1:84065568-84065590 AATGAAGATCAGACAGATACAGG - Intergenic
910680908 1:89863403-89863425 GTTGAAGCAGAGACAGGAAGAGG + Intronic
911430601 1:97781938-97781960 GCTTAAGATCACACAGAAACAGG + Intronic
912801001 1:112719678-112719700 GTTGCAGCTCAGAGGGAAATAGG + Intergenic
917357254 1:174139673-174139695 GGTTAGACTCAGACAGAAACAGG - Intergenic
917752499 1:178066516-178066538 GGTGGAGCTCAGGCAGTAACAGG + Intergenic
920708499 1:208273317-208273339 GGTGAAGCTGGGGCAGAAACTGG - Intergenic
921185255 1:212665015-212665037 GTTGAGGCTCAGAGAGACGCGGG + Intergenic
921254249 1:213325207-213325229 GTAGATGCTCAGAAAGAAAGCGG - Intergenic
921269392 1:213453607-213453629 GTTGGAGCTCAGTCAGAGGCCGG + Intergenic
1063619888 10:7637067-7637089 AATGAAGCTAAGACAGCAACTGG - Intronic
1064188579 10:13185519-13185541 CTAGATGCTCAGACATAAACAGG - Intronic
1066699556 10:38112482-38112504 GTGCAACCTCAGACATAAACGGG + Intronic
1068254131 10:54486219-54486241 CATTAAGCTAAGACAGAAACTGG + Intronic
1068282996 10:54900770-54900792 ATTGAAACTGAGACATAAACTGG - Intronic
1069692837 10:70365031-70365053 GTTGAATCTCAGAGAGGACCTGG - Intronic
1070345127 10:75534219-75534241 ATTGAATCTCAAACAGACACAGG - Intronic
1070736003 10:78864064-78864086 TTTGAAGCACAGACAGAATCTGG + Intergenic
1074755518 10:116621505-116621527 GTTGACTCTCAGGCAGACACAGG + Intronic
1077667209 11:4123244-4123266 ATTGAGTCTCAGACGGAAACAGG + Exonic
1077839977 11:5963624-5963646 GTCAAAGCTCAGACAAAAAGGGG - Intergenic
1078085703 11:8231987-8232009 ATTGAGGCTCAGACAGTTACAGG + Intronic
1079314954 11:19399745-19399767 GGTGAAGCTGAGATTGAAACTGG + Intronic
1081926749 11:46836197-46836219 GTTGAAACACAAACAGAATCTGG + Intronic
1085634151 11:78145164-78145186 AATGAAACTCAGAAAGAAACAGG + Intergenic
1086148831 11:83586092-83586114 GTAGAAGAACAGACAAAAACAGG + Intronic
1087077654 11:94140315-94140337 GTCGAAGTTCAGACAGTAAGAGG + Intronic
1088138004 11:106580574-106580596 CTTAAAGGTCAGACAGAAAAAGG + Intergenic
1089029356 11:115308358-115308380 ATTGAAGCTCAGACATAAAAAGG + Intronic
1090228672 11:125086528-125086550 GTCGCAGCTCAGAGGGAAACTGG - Intronic
1090942574 11:131400494-131400516 GTTGAAGGTCACACAGTAAGTGG - Intronic
1091395460 12:151738-151760 GTTGCAGTGCAGACAGTAACAGG - Intronic
1091966857 12:4750978-4751000 GTTGAAGATCAGATAGTTACAGG - Intronic
1092758685 12:11789454-11789476 GCTGAAGCCCAGACCGAAGCAGG - Intronic
1092764075 12:11836834-11836856 GAAGATGCTCAGGCAGAAACAGG - Intronic
1093452736 12:19334235-19334257 GCTGAAGTAAAGACAGAAACAGG + Intronic
1094532700 12:31291953-31291975 GTGGAGGCTCAGACTGAAACAGG - Intronic
1098662361 12:73111945-73111967 GTTGAAGCTTAGAGAAGAACAGG - Intergenic
1099171179 12:79366566-79366588 GTTGCAACTCAGCCATAAACAGG + Intronic
1100593346 12:96050219-96050241 GCTCAAGCTGAGACAGAAATTGG + Intergenic
1102612026 12:114120730-114120752 GTTGAGGCTGAGTCAGAAAAGGG + Intergenic
1103177383 12:118876564-118876586 GGTGAAGTTCAAGCAGAAACTGG - Intergenic
1103459132 12:121089885-121089907 GTTGAAGCTGTGACAGGAGCTGG - Intergenic
1104342219 12:127961121-127961143 GTTGAATGTAAGACAGAAAGGGG - Intergenic
1104492174 12:129203726-129203748 CTTAGAGCTCAGGCAGAAACAGG - Intronic
1105040766 12:132958914-132958936 GTTGAATCTCAGTTAGAAGCAGG - Intergenic
1107258280 13:38457281-38457303 GCTGAAGCTCACACAGAATTGGG - Intergenic
1107608477 13:42087111-42087133 CTTGAAGCTCATACAGAACTAGG + Intronic
1108614121 13:52114818-52114840 ATTGAAGCTCAGTCAGTAAAAGG + Intronic
1110085507 13:71374164-71374186 GTTGAAACTGAAACAGAACCAGG + Intergenic
1111824502 13:93250798-93250820 GGCAAAGCTCAGAGAGAAACTGG + Intronic
1112926228 13:104678571-104678593 GTTGAAGGCCACACAAAAACAGG - Intergenic
1113271534 13:108680031-108680053 TTCAGAGCTCAGACAGAAACTGG - Intronic
1113384778 13:109838811-109838833 GTAGTAACTCAGACAGAAAGTGG - Intergenic
1114917024 14:27281581-27281603 GTTGAATCTCAGACAATCACAGG + Intergenic
1116384742 14:44316404-44316426 GGAGAAGGTCAGAAAGAAACTGG + Intergenic
1117924509 14:60764247-60764269 GTTGAAGCTCAAAAATAAAAGGG + Intronic
1119659793 14:76442146-76442168 ACTGAAGCACAGAGAGAAACAGG - Intronic
1124704385 15:31950062-31950084 GTTGAAGATCAGATGGATACAGG + Intergenic
1126129911 15:45330474-45330496 GTAGAAACACAGACAGAAAGAGG - Intergenic
1127055725 15:55129195-55129217 CTTCAAACTCAGACAGGAACTGG + Intergenic
1128093405 15:64934294-64934316 GATGAAGCACAGGGAGAAACAGG + Intronic
1130705341 15:86227938-86227960 GTTTAAGCTCAGCAAGAAAGAGG + Intronic
1132435835 15:101801719-101801741 GTTGAATCTAAGACAAAAGCAGG + Intergenic
1135592108 16:23712168-23712190 ATTGAAGCCCAGAAAGAAAGAGG - Intronic
1135952060 16:26923852-26923874 CTTGAAGCTCAGACAGAAATAGG + Intergenic
1135993141 16:27229540-27229562 GTTCAAGCTCAGACTGAGGCAGG + Intronic
1137327608 16:47457580-47457602 GTTGCATCTGAGAGAGAAACAGG + Intronic
1138067244 16:53955042-53955064 GGTCAAGCACTGACAGAAACAGG - Intronic
1142641423 17:1288207-1288229 GATGAAGCTCAGACAGCACGTGG - Intronic
1148890745 17:50805571-50805593 GTTGCTGGTCAGACAGACACTGG + Intergenic
1149230251 17:54525436-54525458 TTTGAGGCACAGACAAAAACAGG + Intergenic
1153008991 18:520847-520869 GTTGAGGCTGAGAGAGAATCAGG - Intergenic
1153600226 18:6773917-6773939 GTTTGAGCTGAGACACAAACAGG + Intronic
1155457495 18:26034097-26034119 GTTGAAACTCAGTCAGATATTGG - Intronic
1157413942 18:47486480-47486502 GTTGCAGTTGAGACAGAGACTGG + Intergenic
1158720651 18:59921413-59921435 GTTCAAACTGAGACAGAAACTGG - Intergenic
1158983977 18:62794778-62794800 GATGAAGCACACACAGGAACTGG + Intronic
1160001407 18:75027727-75027749 GTTCAAGGTCAGACAGAGGCTGG + Intronic
1167478409 19:49713839-49713861 GTTGAAGCTGTGACTGCAACTGG - Intergenic
1168027171 19:53650999-53651021 TTGGAAGCTGTGACAGAAACTGG + Intergenic
925229306 2:2218555-2218577 GATGGAGCTCAGAGAGGAACTGG + Intronic
927193466 2:20532561-20532583 ATTGAAGCTCAGAGAGATAGAGG - Intergenic
929357888 2:41048631-41048653 GTTGAAGATAAGACATAATCAGG - Intergenic
932837322 2:75049705-75049727 CTTGAAGCCCAGACGGAACCTGG + Exonic
934611017 2:95736330-95736352 TTAGAACCTCAGACACAAACTGG + Intergenic
935013623 2:99158743-99158765 ATTGAAGCTGAGACATAAAAGGG - Intronic
935433860 2:103007254-103007276 GTTGAAGTTAAAACAGAATCTGG + Intergenic
935673572 2:105575762-105575784 GCTGAAGCTCACACAGAAAGTGG - Intergenic
938866572 2:135427901-135427923 GTTGAAGATCAGATAGTTACAGG - Intronic
940079071 2:149779668-149779690 CTTAAAGCTCACACAGAAACAGG - Intergenic
942168523 2:173266359-173266381 GTCGATACTCAGACAGAAGCAGG + Exonic
946057530 2:216915058-216915080 GCTGAACCTCAGACAGAATAAGG - Intergenic
948186199 2:236023419-236023441 GCTCCAGTTCAGACAGAAACTGG + Intronic
1169684599 20:8256780-8256802 GTAGGAGCTCAGCCAGAAGCAGG - Intronic
1172766264 20:37352687-37352709 GCTGAAGCTCAGAGAGAGGCGGG + Intronic
1175885688 20:62289220-62289242 GTTGAGGCTCACAGTGAAACTGG - Exonic
1176377786 21:6095367-6095389 GTTGAAGCTCCCACAGGAAATGG + Intergenic
1179745688 21:43442881-43442903 GTTGAAGCTCCCACAGGAAATGG - Intergenic
1182079340 22:27518148-27518170 ACTGAGGCTCAGACAGGAACAGG - Intergenic
1182646617 22:31815221-31815243 GCTGAAGCACAGACAGAGCCAGG + Intronic
1184499171 22:44861594-44861616 GGGGAACCTCAGTCAGAAACAGG - Intronic
949393702 3:3591930-3591952 GTTGAAGATCAGATAGTTACAGG - Intergenic
949663450 3:6308781-6308803 GTTGAAGATCAGATAGCTACAGG - Intergenic
951677550 3:25259257-25259279 GTGGCTGCTCAGACAGAGACTGG + Intronic
952596167 3:35020635-35020657 CTTAAAGCTCAGGCAGGAACTGG - Intergenic
952603810 3:35119083-35119105 GCTGTAGCTGAGAAAGAAACAGG + Intergenic
953346148 3:42177689-42177711 GTTGAAGCTCAGACAGAAACTGG + Intronic
954780470 3:53055478-53055500 GATGAATCTCAGAAACAAACAGG - Intronic
957012483 3:75023974-75023996 GTGGAAGCTCAGTGATAAACTGG - Intergenic
957182510 3:76898613-76898635 TTTGAAGTTCAGACAAAAAATGG + Intronic
962335205 3:134523679-134523701 GTTGAAGATCAGATAGTTACAGG + Intronic
964150054 3:153513213-153513235 TTTTCAGCTCAGACAGAAACTGG + Intergenic
965632003 3:170742707-170742729 GCTGAGGCTCACACAGAACCAGG - Intronic
966732283 3:183161307-183161329 TTTGTAGCTCAGAAAGGAACCGG + Intronic
967292009 3:187930361-187930383 GCTGAAGGTCAGAAAGAATCTGG + Intergenic
967476581 3:189928275-189928297 GTTGAAGGACAGAAAGAAAATGG - Intergenic
968910019 4:3472882-3472904 GCTGAAGCTCAGCCACAACCTGG + Intronic
970468120 4:16348355-16348377 GTGGAAGCTCAGGCAGACTCAGG - Intergenic
970535914 4:17029615-17029637 CTTGAAGCTCTGGCAGAACCAGG + Intergenic
974191113 4:58505062-58505084 GTTAAAACTCAGACAGAAGTCGG + Intergenic
975164835 4:71166738-71166760 TCTGAAGCTCAGACATAAATTGG - Intergenic
979824339 4:125215018-125215040 GGTGAAGCACAGACAGCAGCTGG + Intergenic
980498766 4:133620473-133620495 GTTGCAGATGAGCCAGAAACTGG + Intergenic
982810289 4:159817325-159817347 GTTGAAGATCAGATAGTTACAGG - Intergenic
984514287 4:180719414-180719436 GTTGAGGCTCAGTCAGCAGCAGG - Intergenic
985628416 5:1002182-1002204 GCTGCAGCTCAGGCAGAAGCAGG + Intergenic
988467741 5:31506942-31506964 GTTGAATTTCTGATAGAAACAGG + Intronic
988574774 5:32410997-32411019 GTTGTATATGAGACAGAAACTGG - Intronic
988829023 5:34969656-34969678 GTCAAAGCTGAGAGAGAAACGGG - Intergenic
990144276 5:52741541-52741563 CTTGAAGAAGAGACAGAAACTGG - Intergenic
990969777 5:61492414-61492436 CTTGAAGTTAAGACAGATACGGG + Intronic
992638738 5:78750336-78750358 TTTGATCCTCAGACAGAAACTGG - Intronic
994047850 5:95329485-95329507 GCAGAAGCTCAGACAGCAGCAGG - Intergenic
995985517 5:118166271-118166293 GTTGAATGTCAGAGAGAAAAGGG - Intergenic
996353634 5:122573479-122573501 GTTGAAACACAAACAGTAACTGG + Intergenic
996562290 5:124843765-124843787 TTTGACTCTCAGACATAAACCGG + Intergenic
998954786 5:147427915-147427937 GTCTCAGTTCAGACAGAAACTGG - Intronic
1000303214 5:159973452-159973474 GATGAAGCTCAGGCAGAGAGAGG + Intergenic
1000837369 5:166172499-166172521 GTTGAAGCTTAGACAGAAATAGG - Intergenic
1001070928 5:168584482-168584504 TTTGAAGCCCAGAGAGAAAAAGG - Intergenic
1003360199 6:5418528-5418550 GTTGGAGCTCACACAGGACCAGG - Intronic
1004051683 6:12087253-12087275 GTTGAAGTGCAAACAGAAAGTGG + Intronic
1004843195 6:19610776-19610798 GTTGAAGGACAGACAGAGATAGG - Intergenic
1006265355 6:32917384-32917406 GTTGAAGATCAGACAGTCATAGG + Intergenic
1007623678 6:43229945-43229967 GCTCAAGGTCAGACAGAACCAGG + Intergenic
1015176014 6:130310006-130310028 TGTTATGCTCAGACAGAAACAGG - Intronic
1017459829 6:154638461-154638483 TTGGAAGTTCAGACAGAAAAGGG - Intergenic
1018310925 6:162507741-162507763 GTTGAAGCTCACACTCCAACAGG - Intronic
1019701981 7:2478453-2478475 GTTGAAGCTCAGAGAGGAGTGGG - Intergenic
1021117046 7:16755312-16755334 TTTGAAGGCAAGACAGAAACAGG + Intronic
1024005984 7:45225082-45225104 GTTGCAAATCAGACAGAAAGGGG - Intergenic
1025254514 7:57374545-57374567 GTTGATGCCCAGACAGCAGCAGG + Intergenic
1026376609 7:69757731-69757753 GTTGAAACTCATACTGAAGCAGG - Intronic
1027701173 7:81471719-81471741 GTGGAAGCTGAGACAAAAAGGGG + Intergenic
1027960664 7:84941422-84941444 TTTGGAGTTGAGACAGAAACTGG + Intergenic
1028458829 7:91068874-91068896 GTGGAGGCTGAGACAGAGACAGG - Intronic
1029968940 7:104770348-104770370 GTGGAATCACAAACAGAAACAGG + Intronic
1030633197 7:111918112-111918134 CTTTAGGCTCAGAGAGAAACTGG + Intronic
1035332640 7:158106313-158106335 GATGAAGCTCAGAAAGGAGCTGG - Intronic
1036576152 8:10029427-10029449 TCCGAAGCTCAGACAGGAACAGG - Intergenic
1038441465 8:27573542-27573564 GCTTAGGCTCTGACAGAAACAGG - Intergenic
1039567602 8:38562585-38562607 GCTGAAGGACAGAGAGAAACTGG + Intergenic
1039567770 8:38563732-38563754 GCTGGAGCTCAGAAAGAAAAGGG - Intergenic
1040809508 8:51435957-51435979 TTTGAAGCTAAGAAAAAAACAGG + Intronic
1043784494 8:84380930-84380952 CTGGCAGCTCAGACAGAAGCTGG + Intronic
1045101969 8:98853708-98853730 GGGGAAGCTCAGACAGAATCAGG + Intronic
1047573272 8:126125084-126125106 TTTAAAGTTCAGATAGAAACTGG + Intergenic
1047593906 8:126356947-126356969 CTTTAAGATCAGGCAGAAACAGG + Intergenic
1047752454 8:127892018-127892040 GTTGCAGCTCAAACAGCAAGTGG + Intergenic
1050282005 9:4060256-4060278 GTTGAAGTAAAGACAGAAATGGG - Intronic
1054931111 9:70636309-70636331 CTTGCAGCCCATACAGAAACAGG + Intronic
1055991927 9:82115630-82115652 CTTGCAGCTCAGAGAGAAGCTGG + Intergenic
1060464126 9:123887484-123887506 GTTGAAGCACAGGCAGAATGAGG + Intronic
1062324310 9:136004979-136005001 CTTGCAGCCCCGACAGAAACCGG - Intergenic
1188404186 X:29786473-29786495 CTTCAAGCTCCAACAGAAACAGG - Intronic
1188512719 X:30953914-30953936 GTGGAAGATCAGTGAGAAACTGG + Intronic
1188731869 X:33657894-33657916 TTTGAAAGACAGACAGAAACCGG + Intergenic
1189616634 X:42790432-42790454 GCTGCAGCTCAGAAAGAAAAGGG - Intergenic
1194697988 X:97079472-97079494 GTTGTAGCCCTGACACAAACAGG + Intronic
1197214192 X:123852803-123852825 GTTGGAGCTTAGTCAGAAAGAGG + Intergenic
1198320536 X:135515134-135515156 GATGAAGCTGAGGCAGAAAGAGG + Intergenic