ID: 953346925

View in Genome Browser
Species Human (GRCh38)
Location 3:42183808-42183830
Sequence GCTACCAGTCAGATTCAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 122}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953346925_953346928 24 Left 953346925 3:42183808-42183830 CCAAGTTGAATCTGACTGGTAGC 0: 1
1: 0
2: 2
3: 17
4: 122
Right 953346928 3:42183855-42183877 ATGGCGTCTGTCCACTATCAGGG 0: 1
1: 0
2: 0
3: 18
4: 246
953346925_953346926 5 Left 953346925 3:42183808-42183830 CCAAGTTGAATCTGACTGGTAGC 0: 1
1: 0
2: 2
3: 17
4: 122
Right 953346926 3:42183836-42183858 GCTAAGTCTGCATTTGCTGATGG 0: 1
1: 0
2: 3
3: 17
4: 181
953346925_953346929 25 Left 953346925 3:42183808-42183830 CCAAGTTGAATCTGACTGGTAGC 0: 1
1: 0
2: 2
3: 17
4: 122
Right 953346929 3:42183856-42183878 TGGCGTCTGTCCACTATCAGGGG 0: 1
1: 0
2: 1
3: 3
4: 53
953346925_953346927 23 Left 953346925 3:42183808-42183830 CCAAGTTGAATCTGACTGGTAGC 0: 1
1: 0
2: 2
3: 17
4: 122
Right 953346927 3:42183854-42183876 GATGGCGTCTGTCCACTATCAGG 0: 1
1: 0
2: 0
3: 7
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953346925 Original CRISPR GCTACCAGTCAGATTCAACT TGG (reversed) Intronic
904503351 1:30930616-30930638 GATTCCAGTCAGATTGACCTGGG - Intergenic
905628808 1:39507236-39507258 GCTCCCTGTCAGATTCAGATAGG - Intronic
907954923 1:59218929-59218951 GATACCAGTCATATTGGACTAGG + Intergenic
908601387 1:65743963-65743985 GCTGCCAGTAAGTTTGAACTGGG - Intergenic
908877755 1:68697320-68697342 CTTACCAGTCAGATTGAACTAGG - Intergenic
909662947 1:78104201-78104223 GCTCAAAGTCAGATTCAATTAGG + Intronic
910175427 1:84425267-84425289 GCTACCACCCAAATCCAACTGGG - Intergenic
911535403 1:99093975-99093997 GGTACCAGTCATATTGAATTTGG - Intergenic
911866950 1:103039472-103039494 GAGACCAGTCAGATTCAATCAGG - Intronic
912461891 1:109839883-109839905 GCTGCCAGTCAGATTCTCCCAGG + Intergenic
913041918 1:115035322-115035344 GCCACCAGTTAAATTCAGCTAGG + Intergenic
920252988 1:204634515-204634537 GATACCAGTCATATTGAATTAGG - Intronic
920765821 1:208832747-208832769 GCTGCAAGACAGAGTCAACTTGG + Intergenic
924060282 1:240167212-240167234 ACTACCAGTGAGATACAAATTGG - Intronic
924265694 1:242279442-242279464 GCTGCCAGTCAGAGTCACCTGGG - Intronic
1063868357 10:10391303-10391325 GCTACCAGTTAGATGCTACTTGG - Intergenic
1066719153 10:38319212-38319234 GCTGCCAGTCAGAGTCACGTGGG + Intergenic
1067718705 10:48710061-48710083 GCAACCAATCAGAGTCCACTTGG - Intronic
1068906397 10:62329089-62329111 GATACCAGTCATATTGAATTAGG + Intergenic
1073523629 10:104158474-104158496 GAAACCAATCAAATTCAACTTGG + Intronic
1075979477 10:126724449-126724471 GCTGCCAGTAAGTTTCAACAAGG + Intergenic
1076057918 10:127390503-127390525 GACACCAGTCAGATTCGATTAGG - Intronic
1076817402 10:132921665-132921687 GACACCAGTCAGATTGGACTAGG - Intronic
1078023750 11:7674805-7674827 GACACCAGTCATATTCAATTAGG + Intronic
1078313940 11:10275809-10275831 CCTACCAGTGAGAGTCTACTAGG + Intronic
1078439642 11:11353662-11353684 TGTCCCAGTCAGATTCAAATTGG + Intronic
1080149485 11:29033180-29033202 GACACCAGTCATATTCAATTAGG + Intergenic
1083859961 11:65415001-65415023 GACACCAGTCAGATTAGACTAGG + Intergenic
1087249243 11:95877646-95877668 GATACCAGTCATATTGAATTAGG - Intronic
1087723648 11:101694683-101694705 GCTACCACTCAATTTCAACTTGG + Intronic
1090661771 11:128887547-128887569 GATACCAGTCAGATTGGATTAGG + Intergenic
1092185833 12:6477821-6477843 GCTCCCAGCCAGCTTCAGCTTGG - Intergenic
1093721734 12:22450974-22450996 GCTACCACTTATATTAAACTGGG + Intronic
1094277898 12:28699590-28699612 GCTACCAGTCAGATTGGATTAGG - Intergenic
1098763624 12:74456637-74456659 TTTAGAAGTCAGATTCAACTTGG - Intergenic
1100164717 12:91903284-91903306 GACACCAGTCATATTGAACTAGG - Intergenic
1100432475 12:94542977-94542999 GATACCAGTCATATTGAATTAGG - Intergenic
1101115285 12:101525552-101525574 GATACCAGTCATATTTAATTAGG + Intergenic
1101187423 12:102293651-102293673 GATACTAGTCAGATTGGACTAGG - Intergenic
1101332204 12:103766215-103766237 GCCACCAGAAAGATTCAACTAGG + Intronic
1103318329 12:120074848-120074870 TCTACCAGTCAGATTAACTTTGG - Intronic
1105423733 13:20275762-20275784 GATACCAGTCAGATTAGAATAGG + Intergenic
1105998789 13:25699584-25699606 GCTTCCAGTCACATTCACCATGG + Intronic
1108207035 13:48100851-48100873 GACACCAGTCAGATTGAATTAGG - Intergenic
1108526622 13:51291084-51291106 GCTTCCAGTCAGAATTAATTTGG + Intergenic
1112165086 13:96909661-96909683 GCTGTGAGTCAGAATCAACTGGG - Intergenic
1113515560 13:110894027-110894049 GCTAAAACTCAGATTCAAGTAGG + Intronic
1114271845 14:21105042-21105064 TCTATCAGTCAGATTAAGCTAGG + Intergenic
1116112498 14:40604763-40604785 GCTACCAGTCATATGGAATTAGG + Intergenic
1121555263 14:94831696-94831718 GCTAGCAGTCAGGTCCAGCTGGG + Intergenic
1122364303 14:101185394-101185416 GCTTCCAGAGATATTCAACTGGG + Intergenic
1122692150 14:103536518-103536540 GCCCCCAGTCAGGTTCAACATGG + Exonic
1122767777 14:104083686-104083708 CATACCAGTCAGATTGAATTTGG - Intergenic
1126939578 15:53752380-53752402 ACTACCAGTCAGATTGGATTAGG - Intronic
1137063274 16:35811372-35811394 GCTACCACTCTGATCCCACTGGG + Intergenic
1139241987 16:65402609-65402631 GTTACCAGTTGCATTCAACTGGG + Intergenic
1139280291 16:65764752-65764774 GATACCAGTCAGATTAGATTTGG - Intergenic
1141870842 16:86784447-86784469 GACACCAGTCATATTCAATTAGG - Intergenic
1143028940 17:3956780-3956802 GGTATCAGTCAGGTTCAGCTTGG - Intronic
1144457526 17:15431235-15431257 GCAGCCACTCACATTCAACTTGG + Intergenic
1153046101 18:856973-856995 GCTGCCAGGCATACTCAACTTGG - Intergenic
1157145092 18:45154350-45154372 GACACCAGTCAGATTGAATTAGG + Intergenic
1157894553 18:51452540-51452562 GATACCAGTCAGATTGAATTAGG - Intergenic
927816510 2:26222127-26222149 GATACCAGTCAGATTAGATTAGG - Intronic
936351542 2:111716516-111716538 GCAACCAGTCAGCTTACACTGGG - Intergenic
936763341 2:115813447-115813469 GGCACCAGTCAGATTGAATTAGG + Intronic
936892912 2:117393051-117393073 GACACCAGTCAGATTTGACTAGG + Intergenic
937953162 2:127403757-127403779 GGCACCAGTCAGATTTAACTTGG - Intergenic
938161285 2:128986801-128986823 CCTTCCAGTGAAATTCAACTGGG + Intergenic
939042704 2:137209917-137209939 GATACCAGTCAGATTCAAACAGG - Intronic
939194550 2:138955948-138955970 GACACCAGTCATATTCAATTAGG + Intergenic
941005110 2:160239880-160239902 GCTTCGAGAAAGATTCAACTCGG - Intronic
942245771 2:174006443-174006465 GATACCAGTCATATTGGACTAGG + Intergenic
947070423 2:226282050-226282072 GACACCAGTCAGATTTGACTAGG - Intergenic
947415682 2:229892924-229892946 GCTACCACTCATCTTCAAATGGG + Intronic
1169845297 20:9984417-9984439 GCTACTAGACAGATTAAACATGG - Intergenic
1170967445 20:21087526-21087548 GCTACCATTGAGATGTAACTGGG - Intergenic
1172669991 20:36628437-36628459 GCTACCCATCAGAATCACCTGGG + Intronic
1176523379 21:7844692-7844714 GACACCAGTCAGATTGAATTAGG + Intergenic
1178657399 21:34474704-34474726 GACACCAGTCAGATTGAATTAGG + Intergenic
1179715535 21:43285537-43285559 GACACCAGTCAGATTCAATTAGG - Intergenic
949600939 3:5597095-5597117 GATACCAGTCATATTGAATTAGG + Intergenic
949756314 3:7414814-7414836 CCTACCTGTCAGATTGAACTAGG + Intronic
952579216 3:34811274-34811296 GATACTAGTCAGATTAAATTAGG - Intergenic
953346925 3:42183808-42183830 GCTACCAGTCAGATTCAACTTGG - Intronic
955404345 3:58616490-58616512 GACACCAGTCAGATTCAATTAGG - Intronic
957713296 3:83891988-83892010 GACACCAGTCAGATTGAATTAGG - Intergenic
960420578 3:117440410-117440432 GACACCAGTCAGATTGAATTAGG - Intergenic
961709769 3:128819170-128819192 GACACCAGTCAGATTCGATTAGG + Intergenic
962254089 3:133858594-133858616 GACACCAGTCATATTGAACTAGG + Intronic
963907129 3:150782004-150782026 GATACCAGTCAGATTAGATTAGG - Intergenic
965561382 3:170064885-170064907 GCTTCCATTCAGATTTACCTGGG - Intronic
966208021 3:177424522-177424544 TCTACCAGTCACATTCATGTGGG - Intergenic
967723142 3:192836495-192836517 ACTACCAGTCAGATTGAATTAGG - Intronic
976108424 4:81644287-81644309 GACACCAGTCAGATTGAATTAGG - Intronic
976323719 4:83747455-83747477 GATACCAGTCAGATTGGATTAGG - Intergenic
979312431 4:119219430-119219452 GCTACCAGTCACATTGGATTAGG + Intronic
983968985 4:173848246-173848268 GATACCAGTCATATTAGACTAGG + Intergenic
988455518 5:31383995-31384017 GCTTCCTGCCAGATTCCACTGGG + Intergenic
989364512 5:40640594-40640616 GATACCAGTCAGATTGGATTAGG - Intergenic
989433347 5:41381419-41381441 GATACCAGTCATATTGAATTAGG - Intronic
991218476 5:64184015-64184037 GATACCAGTCAGATTGGATTAGG - Intronic
995172562 5:109134568-109134590 GCTCCCACACAGATTTAACTTGG + Intronic
998666619 5:144305423-144305445 GACACCAGTCAGATTGAATTAGG - Intronic
1003706305 6:8535124-8535146 GGTACCACTGAGATTCAACTTGG + Intergenic
1004816392 6:19315893-19315915 GACACCAGTCAGATTAAATTAGG - Intergenic
1007270484 6:40632420-40632442 GATACCAGTCACATTGCACTAGG - Intergenic
1008773912 6:55011326-55011348 GCTTCCAATCAGATTGAATTAGG + Intergenic
1009054348 6:58316851-58316873 GCTACCAGGAAGTTTGAACTGGG + Intergenic
1009236788 6:61133728-61133750 GCTACCAGGAAGTTTGAACTGGG - Intergenic
1010057038 6:71578509-71578531 GCACCCAGTGATATTCAACTAGG - Intergenic
1010236348 6:73578073-73578095 GCTACCACTAAGATTCAACTTGG - Intergenic
1010647488 6:78408697-78408719 GACACCAGTCAGATTGAATTAGG - Intergenic
1015462692 6:133510972-133510994 ACTTCCAGTCAGATTAAATTTGG + Intronic
1017582506 6:155881824-155881846 GCTGCCAGTGAGATTCAACTTGG - Intergenic
1020389331 7:7641462-7641484 GCCAAAAGTCAGAGTCAACTGGG - Intronic
1021092362 7:16498918-16498940 GCCTAAAGTCAGATTCAACTTGG + Intronic
1021566552 7:22022417-22022439 GACACCAGTCAGATTCGATTAGG - Intergenic
1022998868 7:35786920-35786942 GATACCAGTCAGATTGGACTGGG - Intergenic
1030869170 7:114734137-114734159 ATTACCAGTCAGATTGAATTAGG + Intergenic
1031201359 7:118690812-118690834 GCTCCCCGTGAGAATCAACTAGG - Intergenic
1031990623 7:128196577-128196599 GACACCAGTCAGATTAAATTAGG + Intergenic
1033221902 7:139532490-139532512 GCAACTAGTCAGATTCAAGCAGG + Intronic
1034997585 7:155587813-155587835 GATACCAGTCATATTAGACTGGG + Intergenic
1036059089 8:5294865-5294887 GAAACCAGTCAGATTAAATTAGG - Intergenic
1036186008 8:6622792-6622814 GATACCAGTCAGATTGGATTAGG + Intronic
1037531377 8:19777508-19777530 GATACCAGTCAGATTAGATTAGG + Intergenic
1038432011 8:27507907-27507929 GATACCCGTCAGATTGCACTAGG + Intronic
1043351432 8:79365617-79365639 GCTACCCATTAGAATCAACTAGG + Intergenic
1045615952 8:103911468-103911490 TCTCCCATGCAGATTCAACTGGG + Intronic
1046504372 8:115117911-115117933 GCAACCAGTCATATTCAAAGAGG - Intergenic
1046971706 8:120230317-120230339 ACTAGCTGTCAGAGTCAACTTGG + Intronic
1050308212 9:4327492-4327514 GAGACCAGACAGATTCAAGTGGG + Intronic
1051650446 9:19318756-19318778 GCTACCAGTCTTACTGAACTAGG + Intronic
1052752151 9:32502871-32502893 GACACCAGTCATATTGAACTAGG + Intronic
1056048245 9:82741385-82741407 GACACCAGTCAGATTGAATTAGG - Intergenic
1056937417 9:90926940-90926962 ACTACCAGGAAGATGCAACTAGG + Intergenic
1056957823 9:91096617-91096639 GAGACCAGTCAGATTGAGCTAGG + Intergenic
1059808329 9:117828651-117828673 GCTCCCAGTGAGTTTCCACTTGG - Intergenic
1061671978 9:132193987-132194009 GCCACCAGTCAGATTGGACTAGG + Intronic
1195007536 X:100701159-100701181 GCTACCAGTCAGAATACACTAGG + Intronic
1197153334 X:123244030-123244052 GCTAGCAGTTACATTCAAGTAGG + Intronic