ID: 953349296

View in Genome Browser
Species Human (GRCh38)
Location 3:42202627-42202649
Sequence CAGGGACATGATGCTCTCAG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 195}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953349296_953349304 18 Left 953349296 3:42202627-42202649 CCACTGAGAGCATCATGTCCCTG 0: 1
1: 0
2: 1
3: 18
4: 195
Right 953349304 3:42202668-42202690 TCCGAGTTCACCGGCTTCTCTGG 0: 1
1: 0
2: 0
3: 1
4: 47
953349296_953349301 9 Left 953349296 3:42202627-42202649 CCACTGAGAGCATCATGTCCCTG 0: 1
1: 0
2: 1
3: 18
4: 195
Right 953349301 3:42202659-42202681 TCCCGCTTCTCCGAGTTCACCGG 0: 1
1: 0
2: 0
3: 4
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953349296 Original CRISPR CAGGGACATGATGCTCTCAG TGG (reversed) Exonic
900707924 1:4091996-4092018 GAGGAACATGAGGCTCTGAGGGG - Intergenic
901056265 1:6449926-6449948 CAGGGAGATGAAGCTTTGAGGGG - Intronic
901072980 1:6532355-6532377 CAGGGACCTGAAGATCTTAGAGG + Intronic
901871728 1:12142459-12142481 CAGCGATGTCATGCTCTCAGTGG + Exonic
901931595 1:12599401-12599423 GAGGGATGTGATGCTCTCTGAGG - Intronic
902478089 1:16698567-16698589 CAGGGAGATGAAGCTTTGAGGGG + Intergenic
902621645 1:17654300-17654322 CAGGGAAATGAGGGTCACAGAGG - Intronic
902802641 1:18839898-18839920 CCTGGACCTGCTGCTCTCAGTGG - Exonic
904002711 1:27347937-27347959 TAGGGAGAGGACGCTCTCAGAGG - Intronic
905377531 1:37533472-37533494 CAGGGACATTATGGTCACAGTGG - Intergenic
906776706 1:48536307-48536329 GAGGGACAGGGTGCTCACAGGGG + Intronic
906796490 1:48700298-48700320 CATGGACAGGATACTGTCAGAGG - Intronic
907493948 1:54829405-54829427 CTGGGGCATGATTCTCTCAGAGG + Intronic
907563607 1:55413634-55413656 CAGAGTCATGATGTGCTCAGGGG + Intergenic
908130748 1:61073012-61073034 CAGAAACATGAGGCTCTCAATGG + Intronic
908495533 1:64690670-64690692 CAGGGAAATGATGATCAGAGAGG - Intronic
909685378 1:78342221-78342243 CAGGGACATGTGGTTCTCAATGG + Intronic
909784929 1:79599563-79599585 CAGGGTCTTGATCCTCTAAGTGG - Intergenic
914890020 1:151613314-151613336 CAGGGAAGGGATGCTCTCAGAGG - Intronic
916162693 1:161934768-161934790 CATGGATTTAATGCTCTCAGTGG - Intronic
916663672 1:166946624-166946646 CAGGGATCTGAGGCTCTGAGAGG + Intronic
917964126 1:180167822-180167844 CAGGGACATGGTGCTATCTTTGG + Intronic
918219914 1:182427433-182427455 GAGGGACTTCATGTTCTCAGAGG + Intergenic
919188015 1:194179929-194179951 CAGGGACATGGTGAAGTCAGAGG - Intergenic
920039070 1:203084384-203084406 CAGGGACATTGTCCTCTCTGTGG + Intronic
920214909 1:204355362-204355384 CAGTGATATGATGCTAACAGTGG - Intronic
921095526 1:211884264-211884286 AGGGGACATGTTGCTCTCTGGGG + Intergenic
921113603 1:212064305-212064327 CAGGCACAGGATGTTGTCAGTGG - Intronic
1066262119 10:33739059-33739081 CTGGGTCAAGATGCTTTCAGTGG + Intergenic
1069054549 10:63831202-63831224 TAGAAGCATGATGCTCTCAGAGG - Intergenic
1069240300 10:66130029-66130051 CAGGGGCAGGATGCTGGCAGAGG - Intronic
1071562807 10:86656622-86656644 CAGGGGGAGGATGCTCTCTGGGG - Intronic
1072555698 10:96512632-96512654 CAGGGAGATGCTGGGCTCAGAGG - Intronic
1074104069 10:110375939-110375961 CAGGGTCAGGCTGCTCTCACTGG - Intergenic
1075308777 10:121393107-121393129 CAGGGACCAGATGCTCTCAGAGG - Intergenic
1076380329 10:130020907-130020929 CAGGAACACCATGCTCTCAGAGG - Intergenic
1076673868 10:132137685-132137707 CAGGGTCCTGCTGCTCTCCGGGG - Intronic
1076881148 10:133239809-133239831 CAGGGAGATGCAGCTCTCAGAGG + Exonic
1078935425 11:15945357-15945379 GAGGGACATGATGTCCTCACTGG - Intergenic
1079190122 11:18270113-18270135 CAAGGACATGATGAGTTCAGTGG + Intergenic
1079252164 11:18794179-18794201 CATGGTGATGATGCTCTCGGGGG - Intergenic
1079552688 11:21719751-21719773 CAGAAACATGATGAGCTCAGTGG - Intergenic
1080215622 11:29836687-29836709 CAGGTACATGATGGGTTCAGAGG + Intergenic
1081033889 11:38117608-38117630 CAGGTGCATGGTGCTGTCAGTGG - Intergenic
1083373738 11:62203011-62203033 CAGGGACCTGTGGCTCTCCGTGG - Intergenic
1085126509 11:74005982-74006004 CTGGGACATGCTGTTCTCTGCGG + Intronic
1088377925 11:109161895-109161917 CATGGACATTTTTCTCTCAGTGG + Intergenic
1089214135 11:116825464-116825486 TTGGGACCTGAGGCTCTCAGGGG + Intergenic
1089710280 11:120309624-120309646 GAGGGACATGATGCTTGGAGGGG + Intronic
1090532823 11:127608864-127608886 CAGGGTTATCATGCTCTCTGTGG + Intergenic
1094104904 12:26800966-26800988 CAGGGACAGGAGGTACTCAGAGG + Intronic
1100228728 12:92585714-92585736 CAGGTACATGGTGCTATGAGAGG - Intergenic
1102347270 12:112168122-112168144 CAGGGACATCTTGCCCTCCGTGG - Intronic
1103921230 12:124400280-124400302 CAGGGTCCTCATGTTCTCAGTGG - Intronic
1104857540 12:131909137-131909159 CTGGGACATGATGACCTCGGGGG - Exonic
1104941906 12:132399225-132399247 GAGGGACGGGATGCGCTCAGCGG - Intergenic
1105790162 13:23790678-23790700 CAGGGACTGGATGCTCTTAGGGG + Intronic
1110568081 13:76976282-76976304 CAGCGACATGAGACTCTCCGGGG - Intergenic
1114530564 14:23392950-23392972 CAGGTCCATGATGCTCTCCTGGG + Exonic
1114535889 14:23422218-23422240 CAGGTCCATGATGCTCTCCTGGG + Exonic
1115345332 14:32336871-32336893 CAGGGAGATGAGGGCCTCAGGGG - Intronic
1115612458 14:35061855-35061877 CAGGGCCCTGGTGTTCTCAGTGG + Intronic
1116802715 14:49459982-49460004 CAGGACCATGAGGCTATCAGTGG + Intergenic
1117514121 14:56483410-56483432 CAGGGACATGATGGACTAACTGG - Intergenic
1117963240 14:61182717-61182739 CAGAGACATGATGGGCTCAGAGG - Intergenic
1121691726 14:95882914-95882936 CTTGCACGTGATGCTCTCAGGGG - Intergenic
1121931045 14:97972469-97972491 GAAAGACATGATGCTGTCAGAGG - Intronic
1122421410 14:101579782-101579804 CAGGGACATCAGGCTCTCCAGGG - Intergenic
1122454934 14:101842659-101842681 CACGGCCACGCTGCTCTCAGGGG - Intronic
1124360179 15:29030958-29030980 AAGGTACATGATGCTCTTGGTGG + Intronic
1125311201 15:38379788-38379810 AAGGGACATGTTCTTCTCAGTGG - Intergenic
1126907522 15:53384033-53384055 CAGGGACATGATCTGCTCAGTGG - Intergenic
1127046927 15:55035855-55035877 CATGGAAATGATGGTCTCTGGGG + Intergenic
1128267316 15:66278258-66278280 AAGGGACTTGATGCTCAAAGGGG + Intergenic
1128729604 15:70011997-70012019 CAGAGACAGTCTGCTCTCAGGGG + Intergenic
1128879301 15:71228368-71228390 CAGGGCCATGCTCCTTTCAGAGG - Intronic
1129105185 15:73302253-73302275 CAGGTACAGGATTCTCTAAGCGG + Intronic
1129927394 15:79376911-79376933 CAGGTACGTGATGTGCTCAGTGG + Intronic
1131261755 15:90891328-90891350 CAGGGACAGGGTGGTCTCTGTGG - Intronic
1132083579 15:98887823-98887845 AAGGGACATGATGATCAGAGAGG - Intronic
1133109913 16:3541866-3541888 CGGGGCCAGGATGATCTCAGAGG - Exonic
1138237095 16:55393291-55393313 CAAGGACTTGCTGCTTTCAGGGG - Intronic
1139114254 16:63930115-63930137 CAGAGACTAGATTCTCTCAGGGG + Intergenic
1140507042 16:75479953-75479975 CATGAACATGATGGTCTCAGTGG + Intronic
1141376240 16:83533417-83533439 CAGGGACCTGCTGCCCACAGAGG - Intronic
1141698595 16:85632247-85632269 CATGGGCATGGGGCTCTCAGGGG + Intronic
1146660441 17:34662116-34662138 TACGGACATGGTGCCCTCAGTGG + Intergenic
1147910409 17:43852881-43852903 AAGGGAAAGGCTGCTCTCAGGGG - Intronic
1147967529 17:44200844-44200866 CAGGGACACGCTGCACCCAGGGG - Intergenic
1148218350 17:45846102-45846124 CTGCGCCATGATGCTCTCACCGG - Exonic
1149045972 17:52246052-52246074 CAGAAACATGATGCTGTCATCGG - Intergenic
1149353414 17:55814734-55814756 CAGGGAAATGGGGCTCACAGGGG + Intronic
1151850100 17:76684994-76685016 CAGGAACATGAAGGGCTCAGAGG + Intronic
1152301552 17:79497907-79497929 CAGGGCCTTGTTGCTGTCAGAGG - Intronic
1153658650 18:7307135-7307157 CAGGGCCTAGGTGCTCTCAGGGG - Intergenic
1157683176 18:49622769-49622791 CAGGGACCTGGTGCTCTCCCAGG + Intergenic
1159489795 18:69116963-69116985 AATGGACATGATGCTTTAAGAGG + Intergenic
1160891240 19:1379787-1379809 CAGGGACATGGGGGTCTCTGCGG - Intergenic
1161595757 19:5150332-5150354 CAGGGGGATGTGGCTCTCAGGGG - Intronic
1162040645 19:7968921-7968943 CAAGGACATGATGGAGTCAGGGG + Intronic
1163171241 19:15532715-15532737 CAGGAAACTGATGCTCTGAGGGG - Intronic
1164873651 19:31667845-31667867 CAAGCACCTGAGGCTCTCAGCGG + Intergenic
1164931967 19:32182891-32182913 TAGGGACTGGGTGCTCTCAGAGG - Intergenic
1166390937 19:42408474-42408496 CACGGACCTGATGTTCTCAAAGG + Intronic
1166527494 19:43521574-43521596 CAGGGAACTGAGGCTCCCAGAGG + Intronic
1166732789 19:45068194-45068216 GAGGGACATGGTTCTCACAGGGG - Intronic
1166749158 19:45156514-45156536 GAGGGAAATGAGCCTCTCAGAGG - Intronic
1167006401 19:46778881-46778903 CAGGAACATGATGCCCACAGGGG + Exonic
1168269925 19:55244258-55244280 GAAGGACATGTTGCTCCCAGTGG + Intronic
1168326228 19:55539812-55539834 CAGGGGGAAGATGCTCTCGGTGG + Intergenic
1202712109 1_KI270714v1_random:24394-24416 CAGGGAGATGAAGCTTTGAGGGG + Intergenic
925056929 2:863436-863458 AAGGGACCTGATGCTCCCAGAGG - Intergenic
925182288 2:1825094-1825116 CAGCTCCATGTTGCTCTCAGGGG - Intronic
925285829 2:2715238-2715260 CAGGGACATGCTGCATACAGAGG - Intergenic
925310294 2:2876885-2876907 CAGGGACATGATTATTACAGAGG - Intergenic
926305904 2:11637095-11637117 CAGGGACAGGATGCCTTCAGTGG + Intronic
928437368 2:31263581-31263603 TTGGGACGTGATGCTCTGAGGGG + Intronic
929606585 2:43238844-43238866 CAGGGACATCAGGTGCTCAGTGG + Intronic
929608761 2:43254101-43254123 CAGGAATATGATGCCCTCACTGG + Intronic
935261244 2:101357772-101357794 CAGGGCCATGGAGCTCACAGGGG + Intronic
939864431 2:147456973-147456995 CAGGCTCAGCATGCTCTCAGGGG - Intergenic
941863995 2:170314454-170314476 GAGGGACAGAATGCTTTCAGTGG - Intronic
942225732 2:173814202-173814224 TAAGGAGATGATGCTGTCAGAGG - Intergenic
942814331 2:180034105-180034127 CAGGAACTTGCTGCTTTCAGAGG - Intergenic
944993072 2:205260300-205260322 CACTGACATGATGCTATAAGTGG - Intronic
946313254 2:218894573-218894595 CAGAGACAGGAGGCACTCAGAGG + Intronic
946336236 2:219038521-219038543 CAAGGACATGATGCTCACCCAGG - Exonic
948977134 2:241470658-241470680 GAGGGAGATACTGCTCTCAGGGG + Intronic
948977169 2:241470825-241470847 CAGGTGGATGCTGCTCTCAGGGG + Intronic
1170445615 20:16424358-16424380 CAGGGACATTATGCTTTTGGAGG - Intronic
1171145346 20:22776514-22776536 CAGTGACATGATGCAAGCAGAGG - Intergenic
1173078400 20:39843017-39843039 CAGGGTCATGATGGTGCCAGGGG - Intergenic
1178442352 21:32609090-32609112 CAAGGACATGCTTCTCTCTGGGG - Intronic
1179178083 21:39022973-39022995 CCGGTACCTGATGCTATCAGAGG + Intergenic
1181286499 22:21756234-21756256 CAGGCACATTATGCTATCTGTGG + Exonic
1181639002 22:24187149-24187171 AGGGGACAAGATGCTCACAGCGG + Intronic
1182066515 22:27435212-27435234 CGGGGACTTGATGGTCTCTGAGG - Intergenic
1183074053 22:35415598-35415620 CATGGATGTGATGCCCTCAGCGG + Intronic
1184364066 22:44038140-44038162 CAGGGACATGATGGTGCCAATGG - Intronic
950138242 3:10598124-10598146 AAGGGACAGGATTCTCTGAGAGG + Intronic
951334628 3:21406108-21406130 CAGGGAGATGCAGCTCTCAGAGG + Intergenic
951460694 3:22948531-22948553 GAGTGACATGTTGATCTCAGAGG - Intergenic
951465954 3:23000717-23000739 AAGGGACAGGATGCTGTCCGCGG + Intergenic
952287587 3:31982996-31983018 CCGGGACATGCTGCTCTCCTGGG - Intronic
953349296 3:42202627-42202649 CAGGGACATGATGCTCTCAGTGG - Exonic
954333826 3:49904698-49904720 CAGCGACAAGATGGTGTCAGAGG + Intronic
955041274 3:55320075-55320097 CAGGGAAATGAAGTTCTGAGAGG + Intergenic
955617599 3:60825600-60825622 CAGGGACATTAGGTTCTCATAGG + Intronic
958666060 3:97139171-97139193 CAGGGCCCTGGTGCTCTCTGAGG - Intronic
960230337 3:115219045-115219067 CAGTGACATGATGTCATCAGAGG - Intergenic
960230521 3:115220712-115220734 CAGTGACATGATGTCATCAGAGG - Intergenic
965576963 3:170227309-170227331 CAGGCACATGATGCTGTCGTAGG + Intronic
965639153 3:170814536-170814558 CAGGGACTTTATGCCCTCCGTGG + Intronic
967833851 3:193944350-193944372 CTGGGTCCTGACGCTCTCAGGGG - Intergenic
967979669 3:195058362-195058384 CTGGGACATGACGGTCTCTGCGG - Intergenic
969427605 4:7134823-7134845 AGGGGAAATGATGCACTCAGAGG - Intergenic
969897100 4:10315653-10315675 CAGGGACAATAGGCTTTCAGGGG + Intergenic
983980886 4:173995734-173995756 GATGGACATGATGCCCTGAGAGG + Intergenic
984642043 4:182177397-182177419 CGGGGACATGCTCCTCTGAGTGG - Intronic
984852346 4:184165036-184165058 CAAGGACAGGATGCATTCAGAGG + Intronic
986232271 5:5877197-5877219 GAGGGACATAAGGCTCTCCGTGG - Intergenic
986625730 5:9722219-9722241 CAGAGACATGGTGGCCTCAGGGG - Intergenic
989203540 5:38789280-38789302 CACTGACATGATGCACTAAGAGG + Intergenic
989642183 5:43593566-43593588 GAGGGACTTGATGTTCACAGAGG + Intergenic
996631868 5:125642685-125642707 CAGGGTCATAAAGCTCTCAAGGG - Intergenic
997567720 5:134902485-134902507 CAGGGAAATGATGACATCAGTGG - Intergenic
997646088 5:135482999-135483021 CAGGGACAGGATGCTCACACAGG - Intergenic
998799381 5:145853726-145853748 CAAGGACATCATGGTCTCACAGG - Intergenic
999285212 5:150390605-150390627 CATGGACTTCATCCTCTCAGTGG - Intronic
1002087859 5:176786870-176786892 GAGGGACCTGAAGCTCTGAGAGG + Intergenic
1002421471 5:179151485-179151507 CAGGGCCAAGGTGGTCTCAGTGG + Intronic
1002829895 6:810371-810393 CAGGGACATCCTTCTCTCACAGG + Intergenic
1003080283 6:3016015-3016037 CAGGCACATGATGCTCAAGGGGG - Intronic
1003398830 6:5775208-5775230 CAGGGTCTTGATGCTCCCAGCGG + Intergenic
1004639045 6:17496192-17496214 CAGGGAGATGCTGCTATAAGAGG - Intronic
1005503410 6:26449849-26449871 CAGGGTCAGGAGTCTCTCAGAGG - Intronic
1008877610 6:56346888-56346910 GAGGGACAAGATCCTCGCAGAGG - Intronic
1008941256 6:57047831-57047853 CCGTAACATGATGATCTCAGAGG - Intronic
1008945445 6:57091329-57091351 CCGTAACATGATGATCTCAGAGG - Intronic
1010047525 6:71463701-71463723 CAGAGACATGATTCTGTCATTGG + Intergenic
1010144885 6:72656757-72656779 CAGAGATAAGATGCTCTCAGTGG - Intronic
1018723040 6:166588415-166588437 CAGGTGCATGATGCTCTGTGTGG - Intronic
1019405975 7:884303-884325 CAGGGACATGACTGACTCAGAGG - Intronic
1019440889 7:1046156-1046178 GAGGGACATGCTGCTCACTGGGG + Intronic
1020094252 7:5359468-5359490 GAGGAACATGATGCCCTCATCGG - Exonic
1021147280 7:17104562-17104584 GAGAAACATGAGGCTCTCAGGGG + Intergenic
1022477756 7:30722915-30722937 CAAGGCCATGATGGTATCAGAGG + Intronic
1022686005 7:32597096-32597118 CAGGCACATGATGCTCGAGGGGG - Intergenic
1023138565 7:37078073-37078095 CAGGCCCATGATGCTTTCAGAGG + Intronic
1029956556 7:104646126-104646148 CTGGGAAATGAGGCTCACAGAGG - Intronic
1030130163 7:106193141-106193163 CAAGGGCATGATGCTATCAGTGG + Intergenic
1032766214 7:134996389-134996411 GGGGGACATGAAACTCTCAGGGG + Intronic
1036800809 8:11789509-11789531 CAGGGACAGGCTGGTCTTAGAGG + Intergenic
1038692804 8:29778570-29778592 TAGGGACCTGATGCTGTCTGTGG + Intergenic
1039058334 8:33554173-33554195 CAGGGACAGGGAGCTCACAGCGG + Intronic
1042943135 8:74127630-74127652 AAAAGACTTGATGCTCTCAGTGG - Intergenic
1044275002 8:90289203-90289225 TAGGGACATGATCCTCTGACAGG + Intergenic
1044435541 8:92158357-92158379 CAGGGACATAATGTTCCCATCGG + Intergenic
1044842155 8:96345655-96345677 CAGGGATAAAATGTTCTCAGTGG - Intergenic
1048277050 8:133074608-133074630 CAGGGGCAGGATGCTGCCAGAGG - Intronic
1053411439 9:37918545-37918567 CAGGGACATAGAGCCCTCAGTGG - Intronic
1055130034 9:72764835-72764857 CAGGGACATTATGATCTAATTGG + Intronic
1055499339 9:76887699-76887721 CTGGGATATGCTGCTCTCATGGG - Intronic
1057996123 9:99822729-99822751 CATGGTAATGATGCTCTCGGCGG + Intronic
1060204516 9:121674693-121674715 CTGGGCCAGGAAGCTCTCAGAGG - Intronic
1060404258 9:123365444-123365466 CAGGGCCATGATGCCCTAGGCGG - Intronic
1061618976 9:131798568-131798590 AAGGGAAGAGATGCTCTCAGTGG + Intergenic
1062331189 9:136045646-136045668 CAGGGAAATGGAGCTCGCAGAGG - Intronic
1187562842 X:20418722-20418744 CAGGGACAGGCTGCTCCCACGGG - Intergenic
1189829762 X:44959521-44959543 CAGCCATATGAAGCTCTCAGAGG + Intronic
1192315433 X:70047879-70047901 CAGGGACAAAATGGACTCAGAGG - Intronic
1193492461 X:82166169-82166191 CAGGGGCATGGTGCTGGCAGAGG - Intergenic
1193492480 X:82166297-82166319 CAGGGACATGCTTCTGGCAGAGG - Intergenic
1197827236 X:130602787-130602809 CAGGAACATGGTTCTCTCTGGGG + Intergenic
1199672617 X:150159707-150159729 CAGGGTCAAGATGCTCTCTTTGG - Intergenic