ID: 953349783

View in Genome Browser
Species Human (GRCh38)
Location 3:42206871-42206893
Sequence CCTCACCCGCTCCCAAGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 95}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953349783_953349792 12 Left 953349783 3:42206871-42206893 CCCATCCTTGGGAGCGGGTGAGG 0: 1
1: 0
2: 0
3: 11
4: 95
Right 953349792 3:42206906-42206928 GGGGCAGCCTGTTGAACAGTTGG 0: 1
1: 0
2: 0
3: 12
4: 132
953349783_953349789 -9 Left 953349783 3:42206871-42206893 CCCATCCTTGGGAGCGGGTGAGG 0: 1
1: 0
2: 0
3: 11
4: 95
Right 953349789 3:42206885-42206907 CGGGTGAGGAGAGGGAGTGATGG 0: 1
1: 0
2: 5
3: 86
4: 924
953349783_953349791 -7 Left 953349783 3:42206871-42206893 CCCATCCTTGGGAGCGGGTGAGG 0: 1
1: 0
2: 0
3: 11
4: 95
Right 953349791 3:42206887-42206909 GGTGAGGAGAGGGAGTGATGGGG 0: 1
1: 0
2: 11
3: 125
4: 1061
953349783_953349790 -8 Left 953349783 3:42206871-42206893 CCCATCCTTGGGAGCGGGTGAGG 0: 1
1: 0
2: 0
3: 11
4: 95
Right 953349790 3:42206886-42206908 GGGTGAGGAGAGGGAGTGATGGG 0: 1
1: 0
2: 8
3: 99
4: 978
953349783_953349795 22 Left 953349783 3:42206871-42206893 CCCATCCTTGGGAGCGGGTGAGG 0: 1
1: 0
2: 0
3: 11
4: 95
Right 953349795 3:42206916-42206938 GTTGAACAGTTGGAGGAGAAAGG 0: 1
1: 2
2: 1
3: 32
4: 270
953349783_953349793 15 Left 953349783 3:42206871-42206893 CCCATCCTTGGGAGCGGGTGAGG 0: 1
1: 0
2: 0
3: 11
4: 95
Right 953349793 3:42206909-42206931 GCAGCCTGTTGAACAGTTGGAGG 0: 1
1: 0
2: 0
3: 10
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953349783 Original CRISPR CCTCACCCGCTCCCAAGGAT GGG (reversed) Intronic
900656853 1:3762833-3762855 CCTCACCTGCTCCCCTGGAGTGG - Intronic
902875835 1:19340175-19340197 TCTTACCCACTCCCAAGGGTGGG - Intronic
904884518 1:33726267-33726289 CCTCCCCAGCCCCCAAGGAGGGG - Intronic
906023815 1:42655986-42656008 CCTCAGCCTCTCCCAAGTACAGG + Intergenic
906536597 1:46554307-46554329 CCTCCACCCCTCCCAAGGATTGG + Intergenic
907288511 1:53397421-53397443 CCTCCCCCACTCCCAGGCATTGG + Intergenic
910892223 1:92030032-92030054 GCTCACCCGCTCCCGAGGAAGGG + Exonic
917329633 1:173868327-173868349 CCCCACCCCCTCCCACGGAGCGG - Intronic
917977591 1:180250434-180250456 GCTCACCCGACCCCAAGGCTAGG - Intronic
919745532 1:201006194-201006216 GCCCACCCGCTGCCAAGCATAGG - Intronic
919919722 1:202160765-202160787 CCTCACCCATTCCCAGGGAACGG - Exonic
920263966 1:204708159-204708181 CCCCACCTGCTCACAGGGATGGG + Intergenic
921171891 1:212558223-212558245 CCCCACCCCCACCCAAGGACAGG + Intergenic
922350627 1:224732243-224732265 CCTCACCTGCACCCAATTATGGG - Intronic
1063297142 10:4818002-4818024 CCTCTCCTGGACCCAAGGATGGG - Intronic
1065279504 10:24120333-24120355 CCTCCCCGTCTCCCAAGGGTGGG - Intronic
1075183464 10:120233204-120233226 ACTCACCAGCATCCAAGGATGGG - Intergenic
1075731967 10:124641713-124641735 CCTCTCTGGCTCCCAAGGAAGGG - Intronic
1076519709 10:131073867-131073889 GCACACACGCTCCCAAGGAAAGG - Intergenic
1079409223 11:20171445-20171467 CCACACTCACTCACAAGGATGGG + Intergenic
1081173263 11:39893929-39893951 CCACACCCCCTCCCAAGTCTAGG + Intergenic
1083271378 11:61574616-61574638 CCTGACCCCCATCCAAGGATGGG - Intronic
1083406152 11:62458709-62458731 CCTCCACTGCTCCCAAGGACAGG + Intronic
1083648338 11:64185995-64186017 CCTCCCCCGCACCTCAGGATTGG - Intronic
1091154661 11:133361742-133361764 CCGCAGCCGCTCCCAAGGGCTGG + Intronic
1105271050 13:18875510-18875532 CCCAACCCGCTCCCCACGATGGG + Intergenic
1106807563 13:33326240-33326262 CCTCACCCACTCCCTATGCTAGG + Intronic
1111937674 13:94573225-94573247 CCCCACCCTCTCCCATAGATAGG - Intergenic
1112020623 13:95368080-95368102 CCACACCCGCTCCCAGAGCTAGG + Intergenic
1118949596 14:70422558-70422580 CCTCAGCCCCTGCAAAGGATTGG + Intergenic
1121238311 14:92409628-92409650 CCTAACATGCTCCCCAGGATAGG + Intronic
1121576844 14:94995754-94995776 CATCTTCCGCTGCCAAGGATCGG + Intergenic
1123062335 14:105599905-105599927 CCCTGCCCGCTCCCAAGAATGGG + Intergenic
1126319637 15:47408108-47408130 CCACACCAGGTCACAAGGATGGG - Intronic
1132760642 16:1507115-1507137 CCTCACCTGCGCCCAGGGATGGG + Intronic
1136219971 16:28822818-28822840 CCTTACCCACTCCCAGGGCTAGG + Intergenic
1142145739 16:88492293-88492315 CCCCACCCAATCCCAAGGGTGGG + Intronic
1143135393 17:4709940-4709962 ACTCACCCGCTCCCATCCATCGG - Intergenic
1145916474 17:28576961-28576983 CCACACCCCCTCCCCAGGACTGG + Exonic
1148738679 17:49879825-49879847 CCTCACCCTCGCCCCAGGTTAGG - Intergenic
1148969598 17:51468268-51468290 TCTCACTCTCTCCCCAGGATGGG + Intergenic
1154171615 18:12056844-12056866 CAGAACCCGCTCCCCAGGATTGG + Intergenic
1154416528 18:14178517-14178539 CCCAACCCGCTCCCCACGATGGG - Intergenic
1158897913 18:61932470-61932492 CATCATCCTCTCACAAGGATAGG + Intergenic
1162301552 19:9847819-9847841 CCTCACCCACACCCAAGAAGAGG - Intronic
1163226405 19:15964449-15964471 CCTCACCTGCTCCCATGGCCTGG + Intergenic
1163612815 19:18309909-18309931 CCTCCCGCGCTCCCAGGGCTGGG - Intronic
1163821769 19:19500104-19500126 CCTCTCCTGTTGCCAAGGATAGG + Intronic
1164769703 19:30799224-30799246 GTTCACCAGCTCCCCAGGATGGG + Intergenic
1165712656 19:38023226-38023248 CCTCACCCTCTCCAGAAGATAGG - Intronic
1168267104 19:55229076-55229098 CCTCTCCCGCTTCCCATGATGGG - Exonic
925065553 2:926998-927020 CCCCACACCCTCACAAGGATGGG + Intergenic
926628694 2:15117724-15117746 TATCACCAGCTCCAAAGGATGGG - Intergenic
926990702 2:18676860-18676882 CCTCACCCTCCCCCAATGAGAGG - Intergenic
927240298 2:20915075-20915097 CCTCACCCACCCACAAGGAGAGG - Intergenic
927884477 2:26710119-26710141 CCGCACCCTCTGCCAAGGGTGGG + Intronic
931491587 2:62754042-62754064 CCTCTCCCCCTCCAAAGGAACGG - Intronic
934529273 2:95075075-95075097 CGTCACCTGCTCCCAGGGTTGGG - Intergenic
935653318 2:105399780-105399802 ACGCACCCTCTCCCAGGGATGGG - Intronic
935956487 2:108381871-108381893 ACTCACCAGATCCTAAGGATGGG - Exonic
936152783 2:110030799-110030821 CCTCACACTCTCCCATGGCTGGG + Intergenic
936191897 2:110340613-110340635 CCTCACACTCTCCCATGGCTGGG - Intergenic
946230341 2:218287341-218287363 ACACACCCTCTCCCAAGGAGGGG + Intronic
948591568 2:239053956-239053978 GCTCACCTGCTCCCAGAGATAGG - Intronic
1172032607 20:31992439-31992461 GCTCACACGCTCCCCAGGACAGG - Intronic
1176856800 21:13980741-13980763 CCCAACCCGCTCCCCACGATGGG + Intergenic
1176867780 21:14063472-14063494 CCCAACCCGCTCCCCACGATGGG - Intergenic
1181802325 22:25355761-25355783 CCTGACCTGCTCCCATGGGTAGG + Intronic
951217551 3:20039941-20039963 CCTCACCCACACCCAGGGATTGG + Intergenic
953349783 3:42206871-42206893 CCTCACCCGCTCCCAAGGATGGG - Intronic
959165231 3:102768670-102768692 CCTCACCCTCTCCCCTTGATAGG + Intergenic
960994537 3:123332275-123332297 CACCACCCGCTTCCAAGGATGGG + Intronic
963032133 3:140988645-140988667 CCTCTCCCCCTCCAAAGGAATGG + Intergenic
964250536 3:154711212-154711234 CCTCATCAGATCCCATGGATGGG + Intergenic
969244944 4:5925806-5925828 CATCCCCCGCTGCCAAGGGTGGG - Intronic
969666455 4:8560213-8560235 CCTCCCTCGCTCCCATGGACAGG + Intronic
981454681 4:144939594-144939616 CCACATAGGCTCCCAAGGATGGG - Intergenic
986616711 5:9624821-9624843 CCTCTCTCCCTCCCATGGATCGG - Intergenic
989146631 5:38257315-38257337 CCTCCCGCGCTCCCAAACATAGG + Intergenic
992456598 5:76922162-76922184 CTCCACCCCCTCCCAAGCATAGG + Intergenic
992995106 5:82324721-82324743 CCTCACCCGCCCCCAAGAAGGGG - Intronic
997251173 5:132389765-132389787 AGTCACCCGCTTCCAAGGAATGG + Intronic
998007225 5:138665132-138665154 CCTCAGCTGCCCCCAAGGATGGG - Intronic
999364023 5:151009676-151009698 CCTAACCTGGTCCCCAGGATAGG - Intergenic
1001400608 5:171444230-171444252 ACTCACTCGCTCCCCAGGAAAGG + Intronic
1001693686 5:173653600-173653622 TCTCCCCTTCTCCCAAGGATAGG + Intergenic
1002837375 6:876352-876374 CCTGACCCTCTCCCAGGGATGGG + Intergenic
1004202414 6:13561439-13561461 CCTCAGCCTCTCCCGAGTATAGG - Intergenic
1006923431 6:37640863-37640885 CCTCACCAGCCCCAAAGGAACGG - Intronic
1007367777 6:41406909-41406931 CCTCGCCCGCCCCCAAGCCTAGG - Intergenic
1011802754 6:91036418-91036440 CCCCACCTTCTCCCAAGGATGGG - Intergenic
1019734708 7:2644966-2644988 CCCCAGCAGCTCCCAAGGCTGGG + Intronic
1031435148 7:121724385-121724407 CCTCTCCCCCTCCAAAGGAACGG - Intergenic
1034424325 7:151006754-151006776 CCTCAGCCCCTCCCAAGGGCAGG + Intronic
1036629281 8:10499264-10499286 CCTCTCCCCCTCCCCAGGAGTGG + Intergenic
1038033199 8:23662631-23662653 CCTCACGGGCCCCCAAGGATTGG - Intergenic
1040839633 8:51771540-51771562 CCTTACTTGCCCCCAAGGATAGG - Intronic
1044299089 8:90563002-90563024 CCTCACCTGATCCCACGAATTGG - Intergenic
1047723211 8:127661638-127661660 CCTCCCCCCATCCAAAGGATGGG + Intergenic
1052981522 9:34453422-34453444 CCTCACCCTCTCCCAAAGCAGGG + Intronic
1057996309 9:99823893-99823915 CCGCCCCCGCTCCCCAGGGTTGG + Intronic
1062111896 9:134786316-134786338 TCACACACGCCCCCAAGGATGGG - Intronic
1186219684 X:7336244-7336266 CCCCACCCGCCCCAAAGGAGGGG + Intronic
1189328703 X:40129708-40129730 CCACTCCTGCTCCCAAGGAAAGG - Intronic
1190501474 X:51082891-51082913 CCTCACTCGCACCAAAGCATTGG - Intergenic
1192175605 X:68883172-68883194 CCTCAGCCCCTCCCAAAGGTCGG - Intergenic
1200408321 Y:2837455-2837477 CCTCACCCTCTCCAAAGGAGAGG - Intergenic