ID: 953349789

View in Genome Browser
Species Human (GRCh38)
Location 3:42206885-42206907
Sequence CGGGTGAGGAGAGGGAGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1016
Summary {0: 1, 1: 0, 2: 5, 3: 86, 4: 924}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953349783_953349789 -9 Left 953349783 3:42206871-42206893 CCCATCCTTGGGAGCGGGTGAGG 0: 1
1: 0
2: 0
3: 11
4: 95
Right 953349789 3:42206885-42206907 CGGGTGAGGAGAGGGAGTGATGG 0: 1
1: 0
2: 5
3: 86
4: 924
953349776_953349789 21 Left 953349776 3:42206841-42206863 CCCTTTGTAGCCTCATTTCTTTC 0: 1
1: 1
2: 6
3: 87
4: 640
Right 953349789 3:42206885-42206907 CGGGTGAGGAGAGGGAGTGATGG 0: 1
1: 0
2: 5
3: 86
4: 924
953349785_953349789 -10 Left 953349785 3:42206872-42206894 CCATCCTTGGGAGCGGGTGAGGA 0: 1
1: 0
2: 2
3: 17
4: 182
Right 953349789 3:42206885-42206907 CGGGTGAGGAGAGGGAGTGATGG 0: 1
1: 0
2: 5
3: 86
4: 924
953349777_953349789 20 Left 953349777 3:42206842-42206864 CCTTTGTAGCCTCATTTCTTTCT 0: 1
1: 0
2: 2
3: 61
4: 655
Right 953349789 3:42206885-42206907 CGGGTGAGGAGAGGGAGTGATGG 0: 1
1: 0
2: 5
3: 86
4: 924
953349778_953349789 11 Left 953349778 3:42206851-42206873 CCTCATTTCTTTCTCTTCAGCCC 0: 1
1: 0
2: 9
3: 78
4: 679
Right 953349789 3:42206885-42206907 CGGGTGAGGAGAGGGAGTGATGG 0: 1
1: 0
2: 5
3: 86
4: 924

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953349789 Original CRISPR CGGGTGAGGAGAGGGAGTGA TGG Intronic
900129031 1:1079911-1079933 GGCGTGAGGAGACCGAGTGAAGG - Intergenic
900166190 1:1245150-1245172 TGGGGGAGGAGGGGGAGTGGGGG - Intronic
900175896 1:1291228-1291250 CGGGTGGGGTGCGGGTGTGAGGG - Intronic
900411174 1:2513375-2513397 CGTGTGAGGGGAGGGAGGCATGG + Intronic
900437744 1:2639609-2639631 CGGGTGAAGACAGGGAGGGAAGG + Intronic
900558972 1:3294341-3294363 CTGGTGAGAAGATGGAGAGAAGG - Intronic
900687037 1:3955293-3955315 TGGGAGTGGAGAGGGAGTGGAGG - Intergenic
900805362 1:4763909-4763931 GGTGTGGGGAGAGGGAGAGAAGG - Intronic
900948484 1:5844439-5844461 AGGATGAGGCGAGGGAGAGAGGG + Intergenic
900964242 1:5946714-5946736 AGGGGGAGGAGAGTGACTGAAGG + Intronic
901167277 1:7229573-7229595 AGGGTGAGGAGAGGAGGGGAGGG + Intronic
901309755 1:8260074-8260096 GAGGTGAGGAGAGGGAGAGAGGG - Intergenic
901379200 1:8861680-8861702 GGGGAGAGGAGAGGAAGAGAAGG - Intronic
901896741 1:12319990-12320012 CAGGTGAGGAGAGGGATGCAGGG - Intronic
902326517 1:15704358-15704380 TGGGTCAGAAGAGGGGGTGAGGG - Intronic
902335259 1:15750866-15750888 CGGGTCAGGGGACAGAGTGACGG + Intergenic
902364085 1:15959499-15959521 AGAGGGAGGAGAGGGAGGGAGGG + Intronic
902728038 1:18350271-18350293 TGGGTGGGGAGCAGGAGTGAGGG + Intronic
902800008 1:18823511-18823533 GGAGGGAGGATAGGGAGTGAGGG + Intergenic
902975545 1:20085583-20085605 GGTGTGAGGGGAGGGAGTGGTGG + Intronic
903007251 1:20306982-20307004 CAGGGGAGAAGAGGGAGGGAGGG - Intronic
903540475 1:24093564-24093586 GGGGTCAGGTAAGGGAGTGAGGG + Intronic
903541034 1:24096449-24096471 CGGGTGGGCAGAGGGAGGCAGGG + Intronic
903766793 1:25740281-25740303 TGGAGGAGGAGAGGCAGTGAGGG + Intronic
904013094 1:27401287-27401309 CTGGTGGGGATAGGGAGTGATGG + Intergenic
904245033 1:29181626-29181648 CGGGTGAGGAGGGCGAAAGAGGG - Exonic
904322725 1:29707577-29707599 CAGGAGAGGAGAGGGAGGGGAGG + Intergenic
904941391 1:34166588-34166610 AGGGTGTGGAGAGGGACTGTAGG + Intergenic
905317457 1:37092514-37092536 AGGCTGCAGAGAGGGAGTGATGG - Intergenic
905892730 1:41527417-41527439 GGGGTGTGGAGTGTGAGTGAAGG - Intronic
906008250 1:42498270-42498292 TGGCTGGGGAGAGGGAGTAACGG + Intronic
906065788 1:42979316-42979338 CAGGGGAGCAGAGGGAGTGGAGG + Intergenic
906279474 1:44543324-44543346 GGGGGGAGGGGAGGGGGTGATGG + Intronic
907255114 1:53173369-53173391 GGGGAGAGGAGAGGGAGGGGAGG - Intergenic
907441600 1:54481954-54481976 CGGGTGGGGCGGGGGAGGGAAGG - Intergenic
908057433 1:60304808-60304830 TGGGTGGGGAAAGGGAGAGAAGG - Intergenic
908395450 1:63721294-63721316 GGGTAGAGGAGAGGGAGGGAGGG - Intergenic
908800006 1:67870371-67870393 CGGGTGGGGGGAGGGGGGGAGGG - Intergenic
908872897 1:68635057-68635079 GGGTGGAGGAGAGGGAGTTATGG + Intergenic
909595884 1:77405762-77405784 CTGGTAGGGGGAGGGAGTGAGGG - Intronic
910715275 1:90223515-90223537 AGGGAGGGGAGAGAGAGTGAAGG - Intergenic
911058782 1:93730264-93730286 CGGGTAAGGGGAGTCAGTGAAGG - Intronic
911073659 1:93851947-93851969 GGAGGGAGGAGAGGGAGGGAGGG + Intergenic
911116898 1:94255257-94255279 CATGTGAAGACAGGGAGTGATGG + Intronic
911995695 1:104763181-104763203 CGGGTTAGAAGAGGGAGGAAGGG - Intergenic
912133607 1:106632612-106632634 TGTGTGAGGACATGGAGTGAAGG - Intergenic
912516642 1:110220477-110220499 AGGGTGAGCAGAGGGAGGGAGGG - Intronic
913084098 1:115419057-115419079 GGGGTGGGGAGAGGGGGGGAGGG + Intergenic
913314070 1:117535260-117535282 AGGGAGAGGCGAGGGAGAGAGGG - Intergenic
913378411 1:118182280-118182302 GGGGTGAGGAGAGGGAAGGATGG + Intronic
914815215 1:151058123-151058145 AGGGGGAGGAGAAGGAGAGAGGG + Exonic
915283186 1:154836649-154836671 TGGGTGAGGAGAGTGAGACAAGG - Intronic
915309747 1:155001118-155001140 CCGGCGCGGAGAGGGAGAGAGGG + Intergenic
915734969 1:158078730-158078752 GGGGTGAGGGGTGGGAGGGATGG + Intronic
916322834 1:163523634-163523656 CTGGAGAGGAGAGTGAGAGATGG - Intergenic
917137691 1:171803314-171803336 GGGGTGGGGTGGGGGAGTGATGG + Intronic
917570999 1:176265501-176265523 CAGGAGGGGAGAGGGAATGAAGG + Intergenic
917739367 1:177947701-177947723 GAGGTGAGGAGAGGGAGGGGAGG + Intronic
918070215 1:181128889-181128911 GGGGAGAGGAGGGGAAGTGAAGG + Intergenic
918345658 1:183605030-183605052 TGGATGTGGAGAGGAAGTGATGG + Intergenic
918818644 1:189225026-189225048 AGGGAGACGAGAGGGAGAGAGGG - Intergenic
919266210 1:195269843-195269865 CTTGTGAGGAGAGGTAGTGATGG + Intergenic
919754928 1:201060856-201060878 TGGGTGTGGAGAGGGAGGGAGGG - Intronic
920181234 1:204132927-204132949 GGGGTGGGGAGAGGGAGCAATGG - Intronic
920454227 1:206086055-206086077 AGGCTGAGGAAAGGGAGGGATGG - Intronic
920501927 1:206490929-206490951 CGCCAGAGGAGAGGCAGTGAAGG + Intronic
920558009 1:206918356-206918378 CGAGTGAGGGGAGAGAGGGAGGG - Intronic
920748000 1:208647182-208647204 AGGGAGAGGGGAGGGAGGGAAGG - Intergenic
920808263 1:209255530-209255552 GGGCTGTGGAGAGGGAGTAATGG - Intergenic
920830468 1:209460438-209460460 CTGGAGAGGAAAGGGAGTTAAGG + Intergenic
921800217 1:219394485-219394507 GGGGTTAGGAGAAGGGGTGATGG - Intergenic
921875026 1:220186216-220186238 GGGGTGGGGAGAGGGAGGTAGGG - Intronic
922549052 1:226480651-226480673 AGGGTGAGGTGGGGGAGTGGAGG - Intergenic
922552559 1:226506876-226506898 GGGGAGAGGGGAGGGTGTGATGG - Intergenic
922804633 1:228378905-228378927 TTGGGGAGGAGAGGGAGTGAGGG + Intergenic
923482232 1:234396455-234396477 AGGGTGAAGAGAGGGACGGAGGG - Intronic
923482613 1:234397801-234397823 CGGGGGAAGAGGGGGAGGGAGGG + Intronic
923918051 1:238530566-238530588 AGGGAGAGGCCAGGGAGTGAGGG + Intergenic
924581848 1:245330416-245330438 TGGGTGGGGGGAGGGAGTGGGGG + Intronic
1062834686 10:627906-627928 TGGGTGAGGTGGGGGACTGATGG - Intronic
1062900022 10:1137083-1137105 GGGGTGAGGAGGGGCAGTGCAGG - Intergenic
1063134214 10:3202144-3202166 CGGGTCAGGGGAGGGAGGGCGGG + Intergenic
1063486911 10:6428737-6428759 GTGGTGGGGAGAGGGAGTGAGGG + Intronic
1063796103 10:9515682-9515704 GGGGAGAGGGGAGGGAGGGAGGG + Intergenic
1063984139 10:11483486-11483508 GGGGGGAGGGGAGGGAGAGAGGG + Intronic
1064114824 10:12568513-12568535 AAGGTGAGGGGAGGGAGGGAGGG - Intronic
1064503873 10:16008594-16008616 CGGTTGGGGAGAGGGAGGGAGGG + Intergenic
1064980167 10:21158569-21158591 CGGATGTGGTGGGGGAGTGAAGG - Intronic
1065549835 10:26860089-26860111 CGGGTGTGGGGAGTGAGGGAGGG - Intronic
1065750531 10:28882672-28882694 CGGGTGAGGAGAGAGTTGGAAGG - Intergenic
1065991791 10:31017634-31017656 GGGTTGAAGAGAGGGAGCGATGG - Intronic
1067258580 10:44666563-44666585 GGGGTGGGGAGGGGGAGTGGTGG + Intergenic
1067395235 10:45909645-45909667 TGGGTGACCAGAGGCAGTGAAGG + Intergenic
1067522707 10:47020311-47020333 GGGGTGAGGAGAGGAGGTGAAGG + Intergenic
1067527356 10:47046701-47046723 CGGCTGAGGAGGGGGCATGACGG - Intergenic
1067802750 10:49370446-49370468 CAGATGAGGAAAGGGAGCGACGG - Intronic
1067807897 10:49405863-49405885 GGGGTGAGGAGAGAGGGAGAGGG - Intergenic
1067863557 10:49878769-49878791 TGGGTGACCAGAGGCAGTGAAGG + Intronic
1068119511 10:52771601-52771623 AGGAGAAGGAGAGGGAGTGATGG + Exonic
1068255080 10:54498919-54498941 CAGAGGAGGAGAGAGAGTGAAGG + Intronic
1068575700 10:58682007-58682029 GGGGTGGGGGGAGGGAGGGAGGG - Intronic
1068807831 10:61219495-61219517 GGGCTAAGGAGAGGGAGGGAAGG - Intergenic
1069057733 10:63862390-63862412 AGGGTGTGGTGAGTGAGTGAAGG + Intergenic
1069255745 10:66330209-66330231 GGGGTGGGGAGAGGGGGGGAGGG - Intronic
1069625792 10:69867022-69867044 GGGGTGGGGAGCGGGAGGGAAGG - Intronic
1069886228 10:71625464-71625486 CGGGTGGGGGTAGGCAGTGATGG + Intronic
1070018454 10:72559263-72559285 TGGGGGAGGAAAGGGACTGAAGG + Intronic
1071788469 10:88929522-88929544 CTGGGGGGGAGAGGGAGGGAAGG - Intronic
1071902072 10:90131427-90131449 CGGAGGAGGAGAGAGAGTGAGGG - Intergenic
1071955303 10:90751280-90751302 CAGAAGAAGAGAGGGAGTGAAGG + Intronic
1072079203 10:92012081-92012103 AGGGGGAGGGGAGGGAGGGAGGG - Intronic
1073036276 10:100566341-100566363 GGGGTAGGGAGAGGGAGTAATGG + Intergenic
1073043752 10:100624098-100624120 CGGGTGGGGCTTGGGAGTGATGG + Intergenic
1073054014 10:100687460-100687482 TGGGTGAGGACAGGGAAGGAGGG + Intergenic
1073084959 10:100882421-100882443 CTGGTGGGGAGGGGCAGTGAGGG + Intergenic
1073122502 10:101131375-101131397 AGGGGGAGGGGAGGGAGAGAGGG - Exonic
1073135034 10:101215722-101215744 GGGGTGAGGAGTGGCAGGGATGG - Intergenic
1073136694 10:101224365-101224387 CGGGGGAGGAGAGAGGGGGAAGG + Intergenic
1073149908 10:101304600-101304622 CGGGTGAGGGAATGGAGGGACGG - Intergenic
1073190713 10:101648945-101648967 TGGTAGAGGAGAGGGAGAGATGG - Intronic
1073284143 10:102377154-102377176 CAGGGGAGGAGAGGAAGTAAAGG - Intronic
1073317416 10:102592788-102592810 GGCTTGAGGAGGGGGAGTGAAGG + Intronic
1073334614 10:102696692-102696714 GGAGTGAGGAGAGGGAGCCAAGG + Intronic
1073337997 10:102725192-102725214 GTGGTGAGGTGAGGGAGTGGAGG + Intronic
1073935098 10:108621591-108621613 AGGATGAGGAGAGAGAGAGAGGG - Intergenic
1074002439 10:109386722-109386744 AGGGAGGGGAGAGGGAGGGAGGG + Intergenic
1074199476 10:111222110-111222132 AGGATGAGGGGAGGGAATGATGG - Intergenic
1074377533 10:112951722-112951744 CGGGGGAGGGGAGGGAGGGAGGG - Intronic
1074386453 10:113020350-113020372 GGGGTGAGGAGAGGGGGAGGTGG - Intronic
1074399222 10:113128073-113128095 CGCGTGAATAGAGGGAGAGAAGG + Intronic
1074886634 10:117699213-117699235 AAGGTGGGCAGAGGGAGTGATGG + Intergenic
1075451828 10:122557057-122557079 GGGGTGGGGGGAGTGAGTGAAGG + Intergenic
1075727570 10:124618305-124618327 GGGGTGAGGGGAGGGTGTGCTGG + Exonic
1075932917 10:126314338-126314360 GGGGTGAGGATATGGTGTGAGGG + Intronic
1075947806 10:126453428-126453450 GAGGAGAGGAGAGGGAGTGAAGG + Intronic
1076411106 10:130251623-130251645 GGGGTGAGGAGAGAGAGGAAGGG - Intergenic
1077801532 11:5543689-5543711 ACAGTGAGGAGAGGGAATGAGGG - Intronic
1077889074 11:6405721-6405743 GGGGTGAGGAGAGGCGGTGATGG - Intronic
1078083491 11:8220202-8220224 CAGGAGAGGAGAGAGAGGGAGGG - Intergenic
1079104923 11:17564438-17564460 TGGGTAAGGAGAGGGAGGGAGGG + Intronic
1079470623 11:20774152-20774174 GGGGAGGGGAGAGGGAGGGATGG - Intronic
1079892876 11:26079946-26079968 AGGGAGAGGAGAGGGAGAGGGGG + Intergenic
1080283868 11:30586297-30586319 GGGGCGAGGAGAGGGAGCGAGGG + Intronic
1081489545 11:43556846-43556868 TGGGGGAGGTGAGGGAATGAGGG - Intronic
1081565243 11:44256774-44256796 CGGGGGTGGGGAGGCAGTGAGGG - Intergenic
1081636286 11:44724456-44724478 CTGGTGAGGAGTGGGAGTGGAGG + Intergenic
1081636738 11:44726904-44726926 CGGGGGAGGGGAGGGACGGACGG + Intronic
1081663265 11:44901448-44901470 TGGGTGGGCAGAGGGAGGGATGG + Intronic
1082242132 11:49885160-49885182 AGAGGGAGGAGAGAGAGTGAGGG - Intergenic
1083182914 11:60999494-60999516 GGGGTGAGGACGGGGACTGAAGG + Intronic
1083321091 11:61847373-61847395 TGGGGTAGGGGAGGGAGTGAGGG - Intronic
1083804540 11:65066175-65066197 TGGGTGAGCTGAGGGAGTGGGGG + Intergenic
1083894799 11:65614400-65614422 CGGGCCAGGAGAGGCAGAGAGGG + Intronic
1084089342 11:66870055-66870077 TGGCTGAGAAGAGGGAGGGAAGG - Intronic
1084181860 11:67450884-67450906 CGGAGGAGGAGAGGGAGGGAAGG + Intergenic
1084360276 11:68664620-68664642 CAGGTGAGGAGAGGTGGTTATGG + Intergenic
1084372614 11:68753880-68753902 CAGCAGAGGAGAGAGAGTGAGGG - Intergenic
1084541311 11:69788785-69788807 GGGGATAGGAGAGGGGGTGAGGG - Intergenic
1084599010 11:70133831-70133853 CAGGTGAGGTGAGGGAGGGGAGG + Intronic
1084761481 11:71274801-71274823 GGCCTGAGGAGAGGGAGAGAGGG - Intergenic
1084793476 11:71489628-71489650 CGGGACAGGACAGGGAGCGATGG + Intronic
1085037184 11:73307731-73307753 CGGGCGGGGAGGGGGAGGGAAGG + Intergenic
1086148364 11:83580791-83580813 CGGGGCAGGGGAGGGAGGGAGGG - Intronic
1086303816 11:85459043-85459065 CTGGTGATGAGAGGGTGTCAGGG + Intronic
1086500615 11:87449291-87449313 GGGGAGAGGGGAGGGAATGAGGG + Intergenic
1087479809 11:98684986-98685008 CTGGTGAGGACAGGGAGAAAAGG - Intergenic
1088609092 11:111560136-111560158 CTGGTGAGGAGAGGGCCAGATGG - Exonic
1088925021 11:114293338-114293360 GGGGTGGGGAAAGGGAGTAAAGG - Intronic
1088961905 11:114676613-114676635 ATGGTGAGGAGAGGGAGAAAGGG + Intergenic
1089611317 11:119671081-119671103 CGAGTGAGGATACTGAGTGAGGG + Intronic
1089622474 11:119729552-119729574 CGGTGGAGGAGAGGGCGGGATGG + Intergenic
1089931806 11:122320409-122320431 GGGGTGAGTCCAGGGAGTGATGG - Intergenic
1090433603 11:126667514-126667536 CGGGGGAGAATAGGGAGAGAAGG + Intronic
1090435701 11:126684815-126684837 CGGGAGGGGAGAGGTAGTGTTGG + Intronic
1090702971 11:129312878-129312900 GGGATGAGGAGAGGGTGTGGCGG + Intergenic
1090733383 11:129590721-129590743 AAGGTAAGGAGTGGGAGTGAAGG + Intergenic
1091229819 11:133981045-133981067 GGGGTGAGGAGAGGGGATGAAGG + Intergenic
1091408925 12:226525-226547 GGGGTGAGGAGAGGGCGGAATGG + Intronic
1091681770 12:2532626-2532648 GGGGTGAGGAGTGGGAGTGTCGG - Intronic
1091754476 12:3042598-3042620 CAGGGGAGGGGAGAGAGTGAAGG - Intergenic
1091800660 12:3322739-3322761 GGGGTGGGGAGAGGGAGGGATGG + Intergenic
1091846591 12:3660737-3660759 GGGGAGAGGATAGGGAGTAAGGG - Intronic
1092106511 12:5925407-5925429 CTTGTGGGGAGAGGGAGAGAAGG - Intronic
1092199356 12:6570511-6570533 TGGGGGAGGGGAGGGAGTGAGGG - Exonic
1092205608 12:6612977-6612999 GGGGTGGGGAGGGGGAGGGAAGG - Intergenic
1092287213 12:7135627-7135649 AGGGTGAGGTGAGGGTCTGAGGG - Intronic
1092798204 12:12135324-12135346 GGGGAGAGGAGGGGGAGTGGAGG + Intronic
1094023790 12:25941564-25941586 CAGGTGCAGAGAGGGAGTGGAGG - Intergenic
1094819094 12:34211149-34211171 CGGGGGAGGACAGGCAGAGATGG - Intergenic
1095251844 12:39988633-39988655 AGGGGGAGGAGAGGGAGAAAAGG + Intronic
1095468982 12:42516812-42516834 GGGGTGGGGAGAGGGGGTGTGGG - Intronic
1095517703 12:43024849-43024871 CAGGGGAGGAGAGTGAGTGCAGG + Intergenic
1095653760 12:44645181-44645203 CAAGTTAGGAGAGGGAGGGAGGG + Intronic
1095735389 12:45550669-45550691 CGGGTAAGGAGAGGGAAAGAAGG + Intergenic
1095928009 12:47598560-47598582 AGGGAGAGGAGAGGAAGAGAAGG - Intergenic
1096024780 12:48351012-48351034 AGGGAGAGGAGTGGGAGGGAGGG + Intronic
1096124594 12:49110218-49110240 TGGGTGAGGGGTGGGAGGGAGGG + Intronic
1096264335 12:50111478-50111500 CGGGAGGGGAGAGAGAGGGATGG - Intergenic
1096267450 12:50135096-50135118 AGAGAGAGGAGAGGGAGGGAGGG + Intronic
1096405990 12:51344683-51344705 TGGGGGAGGAGAGGGGGCGATGG - Intronic
1096512831 12:52141196-52141218 CGGGTGGGGAGGAGGAGTGGAGG - Intergenic
1096530952 12:52242661-52242683 CAGGTGAGGAGAGTGAGTCTTGG - Intronic
1096786953 12:54022287-54022309 GGGCTGAGGAGAGGGAGTGTGGG - Intronic
1096846035 12:54407609-54407631 CAGGGGAGGAGAGGAAGTGAGGG + Intronic
1097744084 12:63280528-63280550 AGGAGGAGGAGAGGGAGAGAGGG + Intergenic
1098391176 12:69971488-69971510 CGGGTGGTGAGAGGGACTGGTGG - Intergenic
1099285539 12:80710427-80710449 GGGGTGGGGGAAGGGAGTGAAGG - Intergenic
1099817868 12:87671425-87671447 CTAGAGAGGAGAGGGAGTGGTGG - Intergenic
1099896394 12:88653189-88653211 TGGTTCAGGAGAGGGATTGATGG + Intergenic
1100128175 12:91456213-91456235 GGGATGAGGAGAGGGAGAGCGGG - Intergenic
1100418725 12:94407694-94407716 GGGGATAGGAGAGGGAGAGATGG - Intronic
1100569855 12:95837400-95837422 AGAGGGAGGAGAGGGAGAGAGGG + Intergenic
1100574399 12:95876282-95876304 AGGGCTAGGAGAGGGAGGGATGG + Intronic
1101575390 12:105992565-105992587 AGGCTGTGGTGAGGGAGTGAGGG - Intergenic
1101581932 12:106049469-106049491 GGGGAAAGGAGAGGGAGAGAGGG - Intergenic
1101685033 12:107010880-107010902 GGCCTGAGGAGAGGGAGAGAGGG - Intronic
1101952153 12:109185672-109185694 CGGGCGAGGGGAGGGTTTGAGGG - Exonic
1102501015 12:113352488-113352510 CAGGGGAGGGGAGGGAGAGAGGG - Intronic
1102682268 12:114698775-114698797 GAGGTCAGGAGAGGGAGAGATGG - Intergenic
1102745208 12:115243887-115243909 AGAGTGGGGAGAGGGAGGGAAGG + Intergenic
1102983724 12:117262449-117262471 AGAGAGAGGAGAGGGAGGGAGGG + Intronic
1103021812 12:117540338-117540360 GGGGTGAGGAGAGGCAGTGCTGG - Intronic
1103201839 12:119094203-119094225 CGCCTGTGGAGAGGGAGTGGTGG + Intronic
1103364425 12:120370901-120370923 GGGGTGGGGAGAGGGAAGGAGGG - Intergenic
1103505100 12:121437420-121437442 CGGGTGGGGAGTGGGAGGGAAGG + Intronic
1103594925 12:122019083-122019105 GGGATGAGGAGAAGGAGAGAGGG - Intergenic
1103614424 12:122143163-122143185 AGGGTGAGGAGAGGCAGGGAGGG - Exonic
1104189329 12:126463884-126463906 GGAGTGAGGAGGGGGAGTGATGG + Intergenic
1104215379 12:126728390-126728412 TAGGTGAGGAGACAGAGTGACGG + Intergenic
1104882883 12:132084521-132084543 CGGGTGATGGGACGGAGAGAGGG - Intronic
1105299431 13:19118907-19118929 AGGGTGGGGAGCGGGAGGGAGGG + Intergenic
1105386164 13:19931474-19931496 GGGGTTGGGAGAGGGAGGGACGG - Intergenic
1105514166 13:21075957-21075979 GGGGTGAGGAGAGTGGGGGACGG - Intergenic
1105725596 13:23159905-23159927 GGGGTGCGGGGAGGGAGTGCAGG + Intergenic
1105928699 13:25032545-25032567 CGGAGGAGGAGAGGCTGTGAAGG - Intergenic
1106229716 13:27812420-27812442 CTGGTGGGGAGAGGTAGGGATGG + Intergenic
1107375173 13:39796612-39796634 CGGGGGCAGAGAGGGAGGGAGGG + Intergenic
1107407310 13:40126917-40126939 AGGGTGGGGACAGGAAGTGAGGG + Intergenic
1109024346 13:57140545-57140567 CGGGTTGGGAGAGGCAGGGAGGG - Intergenic
1109025333 13:57147115-57147137 CGGGTTGGGAGAGGCAGGGAGGG - Intronic
1109026323 13:57153688-57153710 CGGGTTGGGAGAGGCAGGGAGGG - Intronic
1109027315 13:57160259-57160281 CGGGTTGGGAGAGGCAGGGAGGG - Intergenic
1109028301 13:57166824-57166846 CGGGTTGGGAGAGGCAGGGAGGG - Intergenic
1109029288 13:57173395-57173417 CGGGTTGGGAGAGGCAGGGAGGG - Intergenic
1110703462 13:78577305-78577327 GGGGTTAGGAGAGGAAGTGGTGG - Intergenic
1110754479 13:79155827-79155849 TGGGTGAGGAAAGGGAGGGGAGG + Intergenic
1112015210 13:95325893-95325915 GAGGGGAGGAGAGGGAGGGAGGG - Intergenic
1113084904 13:106558903-106558925 GGGTTTAGGGGAGGGAGTGAGGG + Intronic
1113940618 13:114016838-114016860 CAGGTGAGGAGTGGGTGTGCGGG + Intronic
1114050936 14:18919469-18919491 AGGGTGGGGAGCGGGAGGGAGGG - Intergenic
1114111623 14:19482453-19482475 AGGGTGGGGAGCGGGAGGGAGGG + Intergenic
1114155591 14:20099498-20099520 CGGGTGAGTGGGGGGAGTGGGGG - Intergenic
1114307399 14:21436821-21436843 AGGGCGAGGTGAGGAAGTGAGGG + Intronic
1114405695 14:22453936-22453958 TGGAGGAGGGGAGGGAGTGATGG + Intergenic
1114525799 14:23366266-23366288 CGGGAGAGGAGAGGGCCTGAGGG - Intergenic
1114530065 14:23389896-23389918 AGGGTGAGGAGAGCCAGAGAGGG + Intronic
1115106078 14:29763388-29763410 AGGGAGAGGGGAGGGAGGGAGGG + Intronic
1115358005 14:32470084-32470106 GGGTGGAGGAAAGGGAGTGATGG - Intronic
1115420104 14:33184319-33184341 CTGGAGAGGAGAGTGAGAGAAGG + Intronic
1115727861 14:36236836-36236858 CCTGTGGGGAGGGGGAGTGAGGG + Intergenic
1116142498 14:41016425-41016447 GGGGAAAGGAGAGGGAGAGAGGG + Intergenic
1117327963 14:54686192-54686214 TGGGTGAGGATGGGGAGTGCTGG + Intronic
1117648917 14:57882100-57882122 GGGCTGATGAGAGGGAGGGAGGG - Intronic
1117741077 14:58819944-58819966 CAGGGGAAGAGAGGAAGTGAGGG + Intergenic
1117863426 14:60118515-60118537 AGGGTGAAAAGAGGGAGTAAGGG - Exonic
1118444585 14:65839827-65839849 TGGGAGAGGAGAGGAAGAGATGG + Intergenic
1118820520 14:69342433-69342455 GAGGTGAGGGGAGGGAGGGAGGG + Intronic
1118992346 14:70808725-70808747 CGGGCGGGGAGGGGGAATGACGG - Intronic
1119539412 14:75428539-75428561 CGGGGGAGGAGAGCGCGGGAGGG - Intronic
1119568327 14:75647562-75647584 CAGGTGAGGAGAGGGGTTGGTGG - Exonic
1119685532 14:76628032-76628054 GGGGTTAGGAGAAGGAGAGAGGG - Intergenic
1119778674 14:77264072-77264094 CTGGAGAGGAAAGGAAGTGAGGG + Intergenic
1121210760 14:92206732-92206754 CGGGTGAAGGGTGGAAGTGAGGG + Intergenic
1121210963 14:92207660-92207682 CGGGTGAAGGGTGGAAGTGAGGG - Intergenic
1121292026 14:92783703-92783725 CAGCTGAGGATAGGGAGAGAGGG + Intergenic
1121680826 14:95791490-95791512 CGGCTGAGGAGATGGAGAGCAGG - Intergenic
1122149009 14:99714228-99714250 CGGGTGAGGATAGAGAGAAATGG + Intronic
1122156546 14:99753538-99753560 GGAGGGAGTAGAGGGAGTGAAGG - Intronic
1122254173 14:100464596-100464618 GAGATGAGGAGAGGGAGAGATGG - Intronic
1122298661 14:100719613-100719635 CGGGTGGGGTGAGGAGGTGAGGG + Intergenic
1122603165 14:102931054-102931076 AGGGTGAGGAGCTGGAGGGAGGG + Exonic
1122706341 14:103624397-103624419 CGGGAGTGGAGTGGGTGTGAAGG + Intronic
1122772322 14:104102910-104102932 TGGGTGTGGGGAGGGGGTGATGG + Intronic
1122793958 14:104196483-104196505 AGGGTGGGGAGAGGGTGTGTAGG + Intergenic
1122825748 14:104369652-104369674 GGGGTGAGGGGAGGGAGAGATGG - Intergenic
1122929154 14:104925543-104925565 CTGGTGAGGGCAGGGAGTGTGGG + Intronic
1123059125 14:105586482-105586504 CAGGAGTGGCGAGGGAGTGAGGG - Intergenic
1123083454 14:105706713-105706735 CAGGAGCGGCGAGGGAGTGAGGG - Intergenic
1124617265 15:31250584-31250606 GGGGTGAGGAGAGGGGGGGAGGG + Intergenic
1124887795 15:33702952-33702974 AGGGTGAGGAAAGAGAGAGAGGG + Intronic
1124957859 15:34371221-34371243 AGGGGGAGGAGAGGGGGAGAAGG - Intergenic
1125267579 15:37900846-37900868 AGGATGAGGTGAGGGAGAGAAGG - Intergenic
1125867282 15:43064199-43064221 CGGGGGAGGAGGTGGAGAGAAGG + Intronic
1126681726 15:51208745-51208767 AGGGTGGGGGGTGGGAGTGAGGG - Exonic
1126987857 15:54334830-54334852 GGAGTGAGGAATGGGAGTGAGGG + Intronic
1127534637 15:59878817-59878839 CTGGTGGGGAGGGGGAGGGAAGG - Intergenic
1127871355 15:63076492-63076514 GGGGTGAGGTGGGGGAGTGGAGG - Intergenic
1127900683 15:63338799-63338821 AAGGTGAGGAGAGGCAGTGCTGG - Exonic
1128419040 15:67474097-67474119 TGTGTGTGGAGAGGGAGAGAGGG + Intronic
1128826041 15:70718262-70718284 AGGGGGAGGAGGGGGAGAGAGGG + Intronic
1129219761 15:74125051-74125073 CGGGTGAGGCAGGGGAGTGGGGG - Intronic
1129440760 15:75579316-75579338 AGGGAGTGGAGAGGGAGCGAGGG + Intergenic
1129589948 15:76905982-76906004 CGGGTGGGGAGGGAGAGGGAAGG - Intergenic
1129752469 15:78076011-78076033 CGGAAGAGGAGTGAGAGTGAGGG + Intronic
1130368888 15:83266249-83266271 GGGGTGTGGGGAGGGAGGGAGGG + Intronic
1130393371 15:83479394-83479416 CTGGTGAGTAGGGAGAGTGACGG + Intronic
1130877584 15:88028023-88028045 AAGGAAAGGAGAGGGAGTGAGGG + Intronic
1130962990 15:88676747-88676769 CTGGAGAGGAGCTGGAGTGATGG - Intergenic
1131019610 15:89087509-89087531 CGGATGAGGTGAGTGGGTGATGG + Intronic
1131050941 15:89347393-89347415 GGGGGGAGGGGTGGGAGTGAGGG - Intergenic
1131390927 15:92048315-92048337 CAGGAGAGGAGAGAGAGGGACGG - Intronic
1131537529 15:93249995-93250017 GGGGAGGGGAAAGGGAGTGAGGG + Intergenic
1131537541 15:93250034-93250056 GGGGAGGGGAAAGGGAGTGAGGG + Intergenic
1131541587 15:93279575-93279597 GGGGTGAGGGGTGGGGGTGAGGG - Intergenic
1131549870 15:93348080-93348102 CGGGAGAGGAGAGGCAAAGAAGG - Intergenic
1131617206 15:94029019-94029041 CAGGGGAAGAGAGGGAGAGAGGG + Intergenic
1131771953 15:95747554-95747576 AGGGTGGGGAGAGGGAAGGATGG - Intergenic
1132291401 15:100706165-100706187 CTGGTGAGGAGATTGAGTGGGGG - Intergenic
1132299525 15:100767435-100767457 CGGGAGGGGAGATGGAGAGAGGG - Intergenic
1132333863 15:101030636-101030658 GGGGTGAGGAGTGGGTGTCAGGG - Intronic
1132344643 15:101100950-101100972 CTGGTGAGGTGAGGCCGTGAGGG - Intergenic
1132344656 15:101101009-101101031 CTGGTGAGGTGAGGCCGTGAGGG - Intergenic
1132379213 15:101354785-101354807 GGGGTGAGGAGTGGGAGAGTAGG - Intronic
1132379844 15:101358799-101358821 AGGGTGAGGGAAGGGAGTGATGG - Intronic
1132551173 16:554391-554413 CGGGGTAGGAGGGGGAGTGGGGG - Exonic
1132567931 16:631677-631699 GGTGGGAGGAGAGGCAGTGACGG - Intronic
1132568020 16:632020-632042 GGTGGGAGGAGAGGCAGTGAAGG - Intronic
1132568692 16:634804-634826 AGGGTGGGGAGATGGAGTCATGG + Intronic
1132878302 16:2149851-2149873 CAGGTGAGGAGCAGGAGTGGAGG - Intronic
1133224674 16:4335191-4335213 CAGGTGAGGTGGGGGAGAGAGGG + Exonic
1133485335 16:6214410-6214432 GGAGTGGGGAGAGGGAGAGAGGG + Intronic
1134133823 16:11667312-11667334 AGGCTGAGTGGAGGGAGTGAGGG + Intergenic
1134238548 16:12486744-12486766 CGGGTGAGGAGGGGCTCTGATGG + Intronic
1134337747 16:13316984-13317006 CAGCTGAGGAAAGGGAGAGAAGG - Intergenic
1134710893 16:16326528-16326550 GGGGAGAGGAGAGGGAGGGGAGG - Intergenic
1134748038 16:16602940-16602962 CAGGGGAGGGGAGGGAGGGAGGG - Intergenic
1134997424 16:18750687-18750709 CAGGGGAGGGGAGGGAGGGAGGG + Intergenic
1135293887 16:21262999-21263021 AGGGTGAGGAATGGGAATGATGG - Intronic
1136344688 16:29667048-29667070 TGGGAGAGGAGACGGAGGGAGGG + Exonic
1136469003 16:30465911-30465933 CTGGTGAGGAGAGGGCCAGAGGG + Intergenic
1136548220 16:30967088-30967110 AGGGTGGGGAGAGGGAGAGGGGG + Intronic
1136913640 16:34162584-34162606 CGGGGGAGGCGAGGGAGGGGCGG - Intergenic
1137431005 16:48417601-48417623 CGGGGAGGGAGAGGGAGAGAGGG + Intronic
1137811848 16:51359916-51359938 GAGGTGAGGAGAGGCAGGGAGGG - Intergenic
1138281140 16:55773071-55773093 CGGGTGAGAGGAAGGAGGGATGG + Intergenic
1138482888 16:57315686-57315708 AGGGTGAGAAGAGGAAGTTAGGG - Intergenic
1139264211 16:65623957-65623979 CTGGTGGGGAGAGGGAGGAAAGG - Intergenic
1139343392 16:66286598-66286620 TGGGTGTGGAGAGGGTGTGGGGG + Intergenic
1139494231 16:67304361-67304383 AGGGTGAGGAGAGGGAAAGTTGG + Intronic
1139853921 16:69965875-69965897 CTGCAGAGGGGAGGGAGTGAGGG - Intergenic
1139882899 16:70188788-70188810 CTGCAGAGGGGAGGGAGTGAGGG - Intergenic
1140337209 16:74118743-74118765 GGGGAGAGGAGAAGGAGGGAGGG + Intergenic
1140354212 16:74291117-74291139 CGGGTGAGGGGAGCCAGGGATGG - Intergenic
1140369610 16:74406731-74406753 CTGCAGAGGGGAGGGAGTGAGGG + Intergenic
1140478554 16:75250893-75250915 CGGGAGCGGAGCGGGAGTGGGGG - Intronic
1140625067 16:76783719-76783741 CGGATTAGGAGAGGGAATCAAGG - Intergenic
1140724356 16:77798871-77798893 CGAGAGAGGGGAGGGAGTAAGGG - Intronic
1140818986 16:78645979-78646001 GGGGAGAGGAGGGGGAGAGAAGG - Intronic
1140914601 16:79482916-79482938 GGGGAGAGGAGAGGGAGGGAGGG - Intergenic
1140914717 16:79483208-79483230 AGGGGGAGGGGAGGGAGGGAAGG - Intergenic
1141533221 16:84661085-84661107 GGGGAGAGGGGAGGGAGGGATGG - Intronic
1141727061 16:85796662-85796684 CGGGAGAGGAGAGCGAGTGGGGG - Intronic
1141786111 16:86201881-86201903 CGGGTGAGGAGAGGCTGGGTGGG + Intergenic
1141927529 16:87179027-87179049 TGGGTGAGGAGGGGGGCTGATGG + Intronic
1142044275 16:87914982-87915004 CGGGTGAGGGGTGTGAGCGATGG + Intronic
1142250013 16:88987040-88987062 GGGCTGGGGAGAGGGAGGGACGG - Intergenic
1142314256 16:89333522-89333544 GGGCTGGGGAGAGGGAGGGACGG - Intronic
1142323375 16:89399494-89399516 GGGCTGGGGAGAGGGAGGGACGG + Intronic
1142665332 17:1459821-1459843 TTGATGAAGAGAGGGAGTGATGG - Intronic
1142681489 17:1551777-1551799 CTGGTGAGGAGACTGAGTGATGG + Intronic
1142684854 17:1571865-1571887 CTAGTGAGGAGAGGGACTGGGGG + Intronic
1142748745 17:1974769-1974791 CAGGTGAGCAGAGTGAGAGAGGG - Intronic
1142889272 17:2932424-2932446 AGGGAGAGGAGAGGGAGGAAGGG + Intronic
1143096485 17:4481040-4481062 AGGGTGAGGAGGGTGAGGGAGGG + Intronic
1143181369 17:4986391-4986413 AGGATGAGGAAAGGGAGGGAGGG + Intronic
1143255492 17:5554575-5554597 CAGCGGAGGAGACGGAGTGAGGG - Intronic
1143823188 17:9581537-9581559 AGAGAGAGGAGAGGGAGGGAGGG + Intronic
1143963386 17:10738891-10738913 GGAGGGAGGAGAGGGAGGGAGGG - Intergenic
1143998760 17:11032871-11032893 ATGATGAGGAGAGGGAGTAATGG + Intergenic
1144661248 17:17072357-17072379 CAGGTGTGCAGAGGGAGTGGAGG - Intronic
1144724961 17:17497063-17497085 CGGGTGGGGAGCGGCAGGGATGG + Intergenic
1144754668 17:17671829-17671851 TGGGTGAGCAGAGGCAGTGGAGG + Intergenic
1145092872 17:20000396-20000418 CCAGTGAGGGGAGGGATTGATGG + Intergenic
1145193702 17:20868848-20868870 AGGGTGGGGAGCGGGAGGGAAGG + Intronic
1145279762 17:21458508-21458530 AGAGTGAGGAGAGGAAGGGAAGG + Intergenic
1145285164 17:21500267-21500289 GGGGAGACGAGAGGGACTGAAGG - Intergenic
1145298319 17:21612256-21612278 AGGGTGGGGAGCGGGAGGGAAGG - Intergenic
1145351929 17:22091072-22091094 AGGGTGGGGAGCGGGAGGGAAGG + Intergenic
1145392362 17:22465476-22465498 GGGGAGAGGAGAGGGACTGAAGG + Intergenic
1145398122 17:22511974-22511996 AGAGTGAGGAGAGGAAGGGAAGG - Intergenic
1145722770 17:27088907-27088929 AGGGTGGGGAGCGGGAGGGAAGG - Intergenic
1146064556 17:29623930-29623952 CTGGGGAGGAAAGGGAGGGAAGG + Intergenic
1147168140 17:38604262-38604284 CAGGTGAGGCTTGGGAGTGAGGG - Intronic
1147254768 17:39175131-39175153 CAGGGGAGGGGAGGGAGCGAGGG - Exonic
1147306293 17:39566698-39566720 TAGGTGGGGAGAGGGAGTAATGG - Intergenic
1147382512 17:40063746-40063768 CTGGGGAGGAGAGGGAGAAATGG + Intronic
1147392861 17:40121414-40121436 CTGGGGAGGAGAGGGGGTGGAGG + Intergenic
1147427376 17:40352307-40352329 TGGGGGAGGAGGGAGAGTGAGGG - Intronic
1147445727 17:40474287-40474309 TGGGAGAAGAGAGGGAGGGAGGG + Intergenic
1148189480 17:45668512-45668534 CCGGTGAGGGGATGGAGTGCAGG + Intergenic
1148462300 17:47845797-47845819 CGGGTGAAGAAAGGGAGCGAGGG + Exonic
1148466113 17:47866255-47866277 AGGATGAGGAGAGGGAGGGCAGG + Intergenic
1148825468 17:50390240-50390262 TGGCTGAGGAAAAGGAGTGAGGG + Intronic
1148853156 17:50564506-50564528 CGGGGGAGGAGAGGGGGGGGAGG + Intronic
1149078682 17:52629134-52629156 CGGGTGAGGGAAGGGACAGAGGG + Intergenic
1149630400 17:58117062-58117084 GGGGTGGGGAGTGGGAGAGATGG + Intergenic
1149642617 17:58213745-58213767 CAGGTGAGGAGAGGAAGAAAGGG - Exonic
1150207240 17:63418405-63418427 CAGGTGAGGAGAGAGAGAGAGGG + Exonic
1150410476 17:64937258-64937280 GGGGTGGGGAGAAGGAGGGAAGG + Intergenic
1150537790 17:66061779-66061801 CAGGGGAGGAGAGGGAGGAAAGG + Intronic
1150764762 17:67994019-67994041 TGGGGGAGGAGAAGCAGTGAGGG + Intergenic
1151221307 17:72615145-72615167 AGGGTGATGGGAGGGAGGGAGGG - Intergenic
1151319093 17:73342159-73342181 GGGGTGAGGAGAGGGAGGGGAGG - Intronic
1151480515 17:74367853-74367875 AGAGCGAGGAGAGGGAGAGATGG - Intronic
1151723148 17:75869715-75869737 CCTGGGAGGAGAGGGGGTGAAGG + Intergenic
1152035820 17:77871975-77871997 CGGGTGTGGAGATGGGGTGGGGG + Intergenic
1152441513 17:80312779-80312801 CGGGAGAAAAGAGGGAGGGAGGG - Intronic
1152612562 17:81322889-81322911 CGGGTGAGGATGGGGGGTCAGGG - Intronic
1153230953 18:2935469-2935491 CGGGTGTAGAGAGGGCATGAGGG + Intronic
1153590450 18:6669087-6669109 CAGGAGAGGAGAGGGAGGGAAGG + Intergenic
1155074685 18:22344066-22344088 CGGATGTGGAAAGGGACTGAGGG - Intergenic
1155488572 18:26373787-26373809 TGGGTGAACAGAGGGAGGGAGGG - Intronic
1155573279 18:27218459-27218481 CTGGTGAGGAGATGGGGTTAAGG + Intergenic
1155966067 18:32036620-32036642 GGGGAGAGGGGAGGGAGGGAGGG + Intronic
1156310621 18:35918755-35918777 CGGGTGAGGGAAGGGAGTGATGG - Intergenic
1156316500 18:35973568-35973590 TGGGGGAGGAGAGAGAGTTAGGG - Intronic
1156387814 18:36622170-36622192 GGGCTAAGGAGAGGGGGTGAAGG + Intronic
1156463575 18:37335004-37335026 GGGGGGAGCAGAGGGAGGGAGGG - Intronic
1156501957 18:37565864-37565886 AGAGAGAGGAGAGGGAGGGAGGG - Exonic
1157119475 18:44895300-44895322 AGGGGGGAGAGAGGGAGTGAAGG + Intronic
1157239677 18:45997635-45997657 AGGGGGAGGGGAGGGAGGGAAGG - Intronic
1157528633 18:48404399-48404421 AGGGTGGGCACAGGGAGTGAAGG + Intronic
1157591576 18:48839277-48839299 GGGGTGAGGAGAGGAAGAGAGGG - Intronic
1157965730 18:52206165-52206187 CAGGTGAGCAGAGGGAGCAAGGG + Intergenic
1158441543 18:57479105-57479127 AGGGGAAGGAAAGGGAGTGAGGG + Exonic
1159071706 18:63630038-63630060 CGGGTGGGGGGAGGCAGGGAGGG + Intergenic
1160472110 18:79145562-79145584 CCGGTGTGGAGAGTGACTGAAGG + Intronic
1160472182 18:79145994-79146016 CCGGTGTGGAGAGTGACTGAAGG + Intronic
1160671952 19:369548-369570 CGGGTGGGGAGAGGGAGCTCAGG - Intronic
1160682618 19:418697-418719 GGGGAGGGGACAGGGAGTGACGG + Intronic
1160705819 19:529799-529821 CAGGAGTGGAGAGGGAGGGAGGG - Intergenic
1160711068 19:551134-551156 GGGGTGGGGACGGGGAGTGACGG - Intergenic
1160769978 19:826472-826494 CGGGGGAGGGCAGGGGGTGATGG - Intronic
1160771565 19:834300-834322 GGGGAGGGGACAGGGAGTGACGG - Intergenic
1160923168 19:1529919-1529941 GGGGTGAGGAGTAGGGGTGAGGG + Intronic
1160940514 19:1618518-1618540 AGAGTGAGGAGAGGGAGAGAGGG - Intronic
1160950440 19:1664376-1664398 GGGGGGAGGGGAGGGAGGGAAGG - Intergenic
1161243057 19:3233665-3233687 AGAGTGAGGAGGGGGAGAGAGGG + Intronic
1161253094 19:3291737-3291759 AGAGTGAGGAGGGGGAGAGAGGG + Intronic
1161262335 19:3344957-3344979 GGAGGGAGGAGAGGGAGAGAGGG + Intergenic
1161273099 19:3401138-3401160 AGAGTGAGGAGAGGAAGAGAAGG + Intronic
1161286452 19:3471005-3471027 AGAGTGAGGAGAGGGATGGAGGG + Intergenic
1161404593 19:4084386-4084408 CTGGCGAGGAGTGGGAGGGAGGG - Intergenic
1161415636 19:4145171-4145193 CGGGAGAGGAGAGGAAGGGGAGG + Intergenic
1161427158 19:4210029-4210051 AGGGAGGGGAGAGAGAGTGAAGG - Intronic
1161442605 19:4300813-4300835 AGAGTGAGGACAGGGAGAGAGGG + Intronic
1161619996 19:5292842-5292864 TGGGGGAGGAGAGGGGGTGGGGG + Intronic
1161642946 19:5435705-5435727 AGAGTGAGGAGGGGGAGAGAGGG - Intergenic
1161754163 19:6119424-6119446 GAGGAGAGGAGAGGGAGGGAGGG - Intronic
1161981824 19:7633934-7633956 CAGGTGCAGAGAGGGAGGGAGGG - Intronic
1162453028 19:10766133-10766155 GAGGTGAGGAGAGGGAGAGAGGG - Intronic
1162578528 19:11513592-11513614 GGGGGGAGGAGAGGGAGGGAGGG + Intronic
1162799575 19:13103233-13103255 TGGGTGAGGAGAGGAGGTGGGGG - Intergenic
1162890903 19:13732343-13732365 AGGGTGGGGAGAAGGAATGAAGG + Intronic
1163472700 19:17506570-17506592 GAGGAGAGGAGAGGGAGGGAGGG + Intergenic
1163547888 19:17950275-17950297 GGGGTGAGGAGAGCCAGGGAAGG + Intergenic
1163560952 19:18019125-18019147 AGAGATAGGAGAGGGAGTGATGG - Intergenic
1163598082 19:18231975-18231997 AGGGTGGGGTGAGGGAGTGGGGG + Intronic
1163670861 19:18627681-18627703 CGCCAGAGCAGAGGGAGTGAGGG - Intergenic
1164441222 19:28282166-28282188 ACTGTGGGGAGAGGGAGTGAGGG - Intergenic
1164527473 19:29022599-29022621 TAGGTGTGGAGAGGGGGTGAGGG + Intergenic
1164581625 19:29438692-29438714 TGGGAGGGGAGAGGGAGAGAGGG + Intergenic
1164740545 19:30572459-30572481 CAGGTGAGGTTAGGGAGTGGAGG - Intronic
1164834548 19:31349265-31349287 GGGCTGAGGACAGGGAGGGAGGG + Exonic
1164998723 19:32743366-32743388 GCGGTGGGGAGAGGGAGTGGGGG - Intronic
1165225441 19:34351551-34351573 GTGGTGAGGAGAGGTGGTGAGGG - Exonic
1165593551 19:36991637-36991659 AGGGTCAGAAGAAGGAGTGAGGG - Intronic
1165994512 19:39834195-39834217 GGGGAGCGGAGAGGGAGGGATGG - Intronic
1166030793 19:40125629-40125651 GGGGTGAGGAAATGGAGGGAGGG + Intergenic
1166161776 19:40959447-40959469 AGGGGAAGGAGAGGGAGGGAGGG - Intergenic
1166214307 19:41325567-41325589 GTGGGGAGGAGAGGGAGGGAGGG - Intronic
1166510938 19:43408217-43408239 CGGGGGTGGAGAGGCGGTGAGGG + Intronic
1166580662 19:43895806-43895828 TGGAGGAGGAGAGGGAGGGAGGG + Intronic
1166898639 19:46040724-46040746 CAGGTGAGGAAAGGCAGGGAGGG + Intronic
1166948038 19:46409139-46409161 AGGGAGAGGGGAGGGAGAGAGGG + Intergenic
1166977143 19:46611298-46611320 CGGGTGAAGAGAGGAAGGCAGGG + Intergenic
1167005813 19:46775778-46775800 CGGGAGGGGAGAGGGTGAGAGGG + Intronic
1167240802 19:48342106-48342128 GAGGTGGGGAGAGGGAGGGAAGG + Intronic
1167443871 19:49525990-49526012 GGGCTGAGGAGAGAGAGAGAGGG - Exonic
1167513786 19:49910867-49910889 CTGGTGAGGAAAGGGTGAGAGGG + Intronic
1167566675 19:50261398-50261420 GTGGTGAGGAGGGGGAGTAATGG - Intronic
1167598366 19:50439230-50439252 CGGGTGAGTGGATGGATTGATGG - Intronic
1167798162 19:51724211-51724233 AGGGAGAGGAGGGGGAGTGATGG - Intergenic
1168265694 19:55222916-55222938 CGGGTAAGGAAAGGAAGGGAAGG + Intergenic
1168287346 19:55341283-55341305 CGGGTGACGGGAGGGAGGGCAGG - Intronic
1168527915 19:57103521-57103543 TGGGTGAGGAGAGGCAGTTTGGG - Intergenic
1168543310 19:57230810-57230832 AGGGTGCGGAGAGGTGGTGATGG - Intronic
925348051 2:3184092-3184114 CGGGTGATGGGAGGGAGGGTTGG - Intergenic
925615863 2:5744052-5744074 AGGGTGAGGAGAGCCACTGAAGG + Intergenic
925705277 2:6678878-6678900 AGGAAGAGGAGAGGGAGAGAGGG + Intergenic
925781469 2:7386006-7386028 AGAGTGAGGAGAGAGAGAGAAGG + Intergenic
925900485 2:8505765-8505787 GGGGTGAGGACAGGGAGGGAAGG + Intergenic
925969572 2:9096931-9096953 CGGGTGTGGAGCGGGAGGGTGGG + Intergenic
926276370 2:11406136-11406158 GGGGTCTGGAGAGGGAGAGAAGG + Intergenic
926774814 2:16411616-16411638 CAGGTGAGGAAAAGGAGTAAAGG - Intergenic
926801636 2:16665230-16665252 TGGGGGAGGAGAGAGGGTGACGG + Intronic
927251066 2:20995223-20995245 CTGGTGGGGAGAGGCAGGGAAGG - Intergenic
927513530 2:23658980-23659002 GTGGTGGGGAGAGTGAGTGAAGG - Intronic
927667891 2:25044801-25044823 AGGGTGAGGAGGGGGAGGGATGG - Intronic
927997444 2:27495524-27495546 CAGGAGAGGGGAGAGAGTGAGGG + Intergenic
928022588 2:27715946-27715968 GGGGGGAGGTGAGGGAGTGTGGG - Intergenic
928353190 2:30582181-30582203 GGGGTGAGGAGAGGGGGAAAGGG - Intronic
928536288 2:32244832-32244854 AGGAGGAGGAGAGGGAGAGAGGG + Intronic
928861939 2:35868902-35868924 GGAGTGAGGGGAGGGAGGGAAGG + Intergenic
929406624 2:41649917-41649939 AGGAGGAAGAGAGGGAGTGAGGG + Intergenic
929525622 2:42700222-42700244 CTGATGAGGAGAGTGAGGGAAGG + Intronic
929977309 2:46647365-46647387 GGGGGAAGGAGAGAGAGTGAAGG - Intergenic
930589330 2:53308705-53308727 AGAGAGAGGAGAGGGAATGAAGG - Intergenic
930639528 2:53840607-53840629 AGGGGGAGGGGAGGGAGTGGAGG + Intergenic
930886517 2:56332690-56332712 AGGGAGAGAAGAGGGAGAGAGGG - Intronic
931617590 2:64175979-64176001 CTGGGGAGGAGAGGGTCTGAAGG + Intergenic
932597738 2:73104662-73104684 TGGGCCAGGAGAGGGAGTGAGGG - Intronic
933067677 2:77818543-77818565 GAGGAGAGGAGAGGGAGGGAAGG - Intergenic
933109508 2:78379248-78379270 CGGGGGGAGAGAGGGAGGGAGGG + Intergenic
933123810 2:78577073-78577095 GGGGTGGGGAGAGGGGGGGAGGG + Intergenic
933869336 2:86550372-86550394 ACGGAGAGGAGAGGGAGAGAGGG + Intronic
934114041 2:88766498-88766520 GGGGTGGGGAGATGGGGTGAGGG + Intergenic
934501764 2:94866857-94866879 CATGTGGGGAGAGGGAGAGAGGG - Intergenic
934635988 2:95991196-95991218 GGGGTGGGGAGATGGGGTGAGGG - Intronic
934769358 2:96898183-96898205 CTGATGAGGAAAGGGAGGGACGG + Intronic
934797660 2:97114238-97114260 GGGGTGGGGAGATGGGGTGAGGG + Intronic
934835754 2:97589201-97589223 GGGGTGGGGAGATGGGGTGAGGG - Intronic
935542884 2:104370054-104370076 GGGCTGAGGAGAGGGAGGAATGG + Intergenic
936245217 2:110820540-110820562 GGTCTGAGGAGAGGGAGTGGGGG + Intronic
936859100 2:116994731-116994753 GGGGAGAGGAGAGAGAGTAAAGG - Intergenic
937010503 2:118558690-118558712 AGGATCAGGAGTGGGAGTGATGG + Intergenic
937249565 2:120515024-120515046 CTGGGGAGGAGGGTGAGTGAGGG - Intergenic
937294256 2:120800134-120800156 TGGGTGAGGAGGGGCCGTGAGGG + Intronic
937845452 2:126574094-126574116 GGGTTGCTGAGAGGGAGTGAAGG + Intergenic
937985902 2:127637989-127638011 CGGGTGGGGAGAAGGACAGAAGG - Intergenic
938014811 2:127858288-127858310 TGGGAGAAGAGAGGGAGTGCAGG - Intergenic
938253736 2:129836687-129836709 CTGGTGAGGATAGGGAGAAAAGG + Intergenic
938287529 2:130129959-130129981 GGGGTGGGGAGCGGGAGGGAGGG + Intergenic
938701646 2:133885133-133885155 CTGGTGCTGAGTGGGAGTGAAGG + Intergenic
939039553 2:137171819-137171841 AGGATGAAGAGAGGGAGGGAGGG - Intronic
941347581 2:164389346-164389368 GAGGAGAGGAGAGGGAGGGAGGG - Intergenic
941800426 2:169653306-169653328 CAGGTGAGAAGAGGGAGAGGAGG + Intronic
941844878 2:170122499-170122521 CAGGGGAGGAGGGGGAGGGAGGG - Intergenic
942211774 2:173678300-173678322 AGGAGGAGGAGAGGGAGGGAGGG + Intergenic
942526284 2:176856399-176856421 CTAGGGAGGAAAGGGAGTGATGG - Intergenic
943367983 2:186983352-186983374 CGGGGAAGGTGAGGAAGTGAAGG - Intergenic
943699260 2:190972054-190972076 GGGGTAAAGAGAGGGAGGGAGGG + Intronic
944094057 2:195946725-195946747 CGGGTGAAGAGAAGGAGGAAGGG - Intronic
944533252 2:200684771-200684793 GGGGGGAGGAGAGGGAGAGGGGG + Intergenic
944925425 2:204459092-204459114 TGGGAGAGGAGAGGGTGGGAGGG - Intergenic
945090937 2:206174913-206174935 TGGGAGGGGAGAGGGAGGGAGGG + Intergenic
945624688 2:212188254-212188276 AGGGAGAGAAGAGGGAGGGAGGG - Intronic
945768299 2:214007963-214007985 GGGGTGAAGAGAAGGAGGGAGGG - Intronic
945918122 2:215726152-215726174 AGGGAGAGGGGAGGGAGGGAGGG + Intergenic
946060130 2:216934400-216934422 AGGGGGAGGAGAGGGAGAGCAGG - Intergenic
946074771 2:217064689-217064711 AGGGTGAGGAGAGGGTGGGGAGG - Intergenic
946079651 2:217106557-217106579 GGGGAGAGGAGAGGAAGGGAGGG - Intergenic
946124898 2:217553934-217553956 TGGGTGAGGAGATGGGGTGAGGG - Intronic
946131258 2:217608718-217608740 TGAGTGAGGAGAGAGAGAGAAGG - Intronic
946679599 2:222199399-222199421 AGGATCAGGAGAGGGAGGGAAGG + Intergenic
947049086 2:226021905-226021927 TGGTAGAGGAGAGGGAGTCAGGG + Intergenic
948458373 2:238117770-238117792 AGGGTGAGCAGAGGAAGGGATGG + Intronic
1169002304 20:2176928-2176950 CGGGGCATGAGAGGGAGAGAGGG - Intronic
1169110942 20:3033328-3033350 GGGGTGAGGAGAGGGGAGGAAGG - Intronic
1169726293 20:8736670-8736692 AGGGAGAAGAGAGAGAGTGAGGG + Intronic
1169792747 20:9428761-9428783 GGGGTGGGGAGGGGGAGTGTAGG + Intronic
1169951873 20:11053680-11053702 CTGGGGAGGAGAGGAAGAGAAGG + Intergenic
1170545675 20:17433970-17433992 GGAGAGAGGAGAGGGAGAGAGGG - Intronic
1170545687 20:17434039-17434061 AGAGAGAGGAGAGGGAGAGAGGG - Intronic
1170630245 20:18058819-18058841 CTGGAGGGGAGAGGGAGAGAAGG + Intronic
1170759453 20:19236861-19236883 CAAGTGTGGAGATGGAGTGAGGG + Intronic
1170967261 20:21084578-21084600 TGGGAGAGCAGTGGGAGTGAGGG + Intergenic
1171302280 20:24073769-24073791 GGGGTGGGGAGAGGGGGTGTGGG + Intergenic
1171393833 20:24818188-24818210 TGGGTGGGGACAGCGAGTGAGGG - Intergenic
1171869394 20:30513419-30513441 AGGGGGAGGACAGGGAGAGAGGG + Intergenic
1172013051 20:31857572-31857594 TGGGGGAGGAGAGGGAGTGGAGG - Intronic
1172083124 20:32358306-32358328 AGAGTGAGGAGGGGGAGTGTGGG - Intergenic
1172133653 20:32673116-32673138 CGGGTGAGGAGAGGAAGTGGAGG + Intergenic
1172201024 20:33125999-33126021 CTGGTGAGGAAAGGCAGTGTTGG + Intergenic
1172596222 20:36153039-36153061 CTGGTGAGCAGGGGGAGTGAAGG + Intronic
1172870373 20:38132003-38132025 AGGGTGGGGTGGGGGAGTGAAGG - Intronic
1172894032 20:38286947-38286969 TGGGTGCGGAGAGGAAGAGAGGG + Intronic
1172978567 20:38924361-38924383 GGGGAGAGGAGAGGTAGAGAGGG + Intergenic
1172980218 20:38935980-38936002 AGAGTTAGGAGAGGAAGTGAAGG + Intronic
1173251522 20:41366427-41366449 CGGGCGGGAAGAGGGAGGGATGG - Intronic
1173401716 20:42731757-42731779 TGGGTGAGTAGTGGGAGTGGAGG - Intronic
1173681105 20:44882640-44882662 GGGGTGAGGGGAGGGAGTGAGGG + Intergenic
1173727621 20:45308341-45308363 CGGGTGGGGAGGGGAAGTGCAGG + Intronic
1173900783 20:46587415-46587437 CGGGTGAGGAAAGGTAGGGGAGG - Intronic
1173930762 20:46816274-46816296 CCTGTGGGGAGAGGGAGTGGAGG + Intergenic
1174137585 20:48391129-48391151 GGAGTGAGGGGAGGGAGAGAAGG + Intergenic
1174144154 20:48439270-48439292 GGGGTGAGGAGAGGCATGGAAGG - Intergenic
1174329549 20:49807284-49807306 CAGGTGAGGAGAGGGAAAGAGGG - Intergenic
1174424712 20:50423747-50423769 GGAGTGAGGAGAGGGAGGGAAGG + Intergenic
1175392521 20:58636151-58636173 GGGAGGAGGAGAGGGAGGGAGGG + Intergenic
1175772535 20:61632752-61632774 TGGGTGAGTAGAGGGATGGATGG - Intronic
1175852293 20:62100099-62100121 CGGGTGAGCAGAGGAAGTGCAGG - Intergenic
1175891639 20:62318382-62318404 CCGGAGAGGAGAGGGATTGCAGG + Intronic
1175969058 20:62674744-62674766 AGGGTGAGATGAGGGGGTGAGGG + Intronic
1175990292 20:62785325-62785347 CGGGTGGGGAGATGGAGGGTGGG + Intergenic
1176125431 20:63472756-63472778 AGGGAGGGGAGAGGGAGGGACGG + Intergenic
1176125532 20:63472985-63473007 GGGGAGAGGAGGGGGAGTGGGGG + Intergenic
1176181564 20:63752001-63752023 TGTGTGAGGAGAGGCAGTGGAGG - Intronic
1176248853 20:64110453-64110475 GGTGTGGGGTGAGGGAGTGATGG + Intergenic
1176384010 21:6127976-6127998 AGGGAGAGAAGAGGGAGGGAAGG + Intergenic
1176612916 21:9002077-9002099 GGGGTGGGGAGAGGGGGGGAGGG + Intergenic
1176649062 21:9529296-9529318 AGGGTGGGGAGTGGGAGGGAAGG - Intergenic
1176803474 21:13456468-13456490 GGCGTTAGGAGAGGAAGTGATGG + Intergenic
1176956281 21:15107888-15107910 AGGGTGAGGCAAGGGACTGATGG + Intergenic
1177618707 21:23558882-23558904 CGAGTGGAGAGAGGGAGGGAAGG - Intergenic
1178365804 21:31987877-31987899 TGGATGGGGAGAGGGAGTGGTGG + Intronic
1178421185 21:32444682-32444704 AGGGAGAGGAGAGGAACTGAAGG - Intronic
1178880259 21:36444263-36444285 AGGGTGAGGGGAGGGAATTAGGG - Intergenic
1178913641 21:36695137-36695159 CAGGAGAGAAGAGGGAGGGATGG - Intergenic
1179646987 21:42782105-42782127 GGAGAGAGGAGAGGGAGAGAAGG - Intergenic
1179673205 21:42964202-42964224 GGGGAGAGAAGAGGGAGGGACGG - Intergenic
1179739464 21:43410262-43410284 AGGGAGAGAAGAGGGAGGGAAGG - Intergenic
1179835098 21:44026198-44026220 GGGGTGGGGGCAGGGAGTGAAGG - Intronic
1179912251 21:44456456-44456478 AGGGAGCGGAGAGGGAGGGAGGG - Intronic
1180140909 21:45892954-45892976 CTGGGGAGGGGAGGGAGTGCTGG + Intronic
1180186889 21:46144631-46144653 AGGGGGAGGAGAGGGAGAGGGGG - Intronic
1180187385 21:46146232-46146254 GGGGTGAGAAGAGGGCGGGAGGG + Intronic
1180321774 22:11328540-11328562 CTGGTGAGTATATGGAGTGAAGG - Intergenic
1180469413 22:15641844-15641866 AGGGTGGGGAGCGGGAGGGAGGG - Intergenic
1181085224 22:20436712-20436734 GGGGTGAGGAGCGGGCGTGTGGG - Intronic
1181293237 22:21814335-21814357 TGGCTGAGGAGAGGGAGAAATGG + Intronic
1181432375 22:22889155-22889177 GGAGGGAGGAGAGGGGGTGATGG + Intronic
1181473269 22:23153649-23153671 AGGCTGGGGAGAGGGAGTGAAGG - Intronic
1181544668 22:23595110-23595132 AGGGTGAGGAGAGGGAGAGAAGG + Intergenic
1181582731 22:23837027-23837049 AGGGTGGGGAGAGGGAGGGAGGG + Intronic
1181728410 22:24827380-24827402 CAGGTGGGGAGAGGGAGGGAGGG + Intronic
1181742765 22:24934487-24934509 GGGGTGGGGAGAAGGAGTTAAGG - Intergenic
1181815645 22:25434785-25434807 AGGGTGAGGAGAGGGAGAGAAGG - Intergenic
1181988529 22:26819065-26819087 CTACTGAGGGGAGGGAGTGAAGG - Intergenic
1182890872 22:33817912-33817934 AGGGGGAGGAGAGGGAGGAAAGG + Intronic
1183398610 22:37587895-37587917 TGGGTGAGGAGGTGGAGGGAGGG + Intergenic
1183616329 22:38948042-38948064 GGGGTGAGAAGTGGGGGTGAGGG + Intergenic
1183751493 22:39723601-39723623 CGGGAGAGGAGAGGGAGGGCAGG - Intergenic
1183805208 22:40203487-40203509 TGGGTGGGGAGATGGAGAGAAGG + Intronic
1183805254 22:40203958-40203980 TGGGTGGGGAGATGGAGAGAAGG - Intronic
1184081053 22:42220613-42220635 TGGGTGAGGAGAGGCTGTGGGGG - Intronic
1184172833 22:42769590-42769612 GGGGTGAGGTGAGGAGGTGACGG + Intergenic
1184652006 22:45923769-45923791 AGGGTGGGGAGCGGGAGAGATGG - Intronic
1184858274 22:47158414-47158436 GGGGAGAGGAGAGGCACTGAGGG + Intronic
949371856 3:3343900-3343922 AGGCAGAGGAGAGGGAGAGAAGG - Intergenic
949668567 3:6370568-6370590 GGGGTGATGAGAGACAGTGACGG - Intergenic
949987269 3:9551316-9551338 TGGGGGAGGAGAGCTAGTGAAGG - Intronic
950282645 3:11720330-11720352 CGGGTGCCGAGAGGGGGCGACGG - Intronic
950668025 3:14509116-14509138 CGGGTGGGGAGAGGATGGGAGGG - Intronic
950916955 3:16655842-16655864 TGGCTGAGCAGAGTGAGTGAGGG + Intronic
952142385 3:30494350-30494372 AGGGTAAGGAGAGAGAGTGGTGG - Intergenic
952615144 3:35262145-35262167 CAGGAGAGAAGAGTGAGTGAGGG - Intergenic
952697371 3:36283246-36283268 CAGGTGAGGAAAGGCAATGAGGG - Intergenic
953349789 3:42206885-42206907 CGGGTGAGGAGAGGGAGTGATGG + Intronic
953526245 3:43691650-43691672 AGGGAGGGGAGAAGGAGTGAGGG + Intronic
953545250 3:43859688-43859710 CAGGTCAGGTGAGGGTGTGAGGG - Intergenic
953706939 3:45238299-45238321 GGTGTGAAGAGAGGAAGTGAAGG - Intergenic
953930370 3:47002885-47002907 GGGGTGAGGCCAGGGAGGGATGG + Intronic
954078853 3:48200814-48200836 CCTGTGGGGAGAGGCAGTGAGGG - Intergenic
954313828 3:49790171-49790193 GGGGCGGGGAGAGGGAGAGAGGG - Intergenic
954666847 3:52258803-52258825 AGAGGGAGGAGAGGCAGTGAAGG + Intronic
956050101 3:65238604-65238626 GGGGTGAAGACAGGGAGGGAGGG - Intergenic
957050202 3:75405857-75405879 AGGGAGAGGAGAGGAACTGAAGG + Intergenic
957053248 3:75426237-75426259 CGGCTCAGCAGAGGGAGGGAGGG - Intergenic
957078776 3:75620308-75620330 TGGGTGGGGGGAGGGAGGGAGGG - Intergenic
957715581 3:83926385-83926407 CGGAGGAGGAGAGGGGGTGGGGG - Intergenic
958949692 3:100402838-100402860 CAGCTGAGGACAGGGACTGAAGG - Intronic
959032536 3:101317070-101317092 GGGGTAAGGAGAGGTAGTGAGGG + Intronic
959759862 3:109947988-109948010 CATGTGAGGACAGGGAGAGAAGG + Intergenic
960051253 3:113241413-113241435 CGGGAGAGCAGAGGGGGAGAGGG - Intronic
960595472 3:119404140-119404162 AGGGATAGGGGAGGGAGTGAAGG + Intronic
960883237 3:122367158-122367180 AGGGTGAAGAGAAGGAGAGAGGG + Intronic
960990016 3:123304196-123304218 CAGGGGTGGAGAGGGAGGGAGGG + Intronic
961069495 3:123908739-123908761 GGGGAGGGGAGAGGTAGTGATGG + Intronic
961368880 3:126417785-126417807 CTGGAGAGGAAAGGGTGTGAGGG + Intronic
961393535 3:126570607-126570629 TGTGTGAGGGGAGGCAGTGAGGG - Intergenic
961448731 3:126992867-126992889 AGTGTGAGGAGAGGGAGTGCAGG - Intronic
961458093 3:127034145-127034167 CGGGTGAGGCAGGGGAGGGAGGG - Exonic
961492201 3:127263838-127263860 CGGGTAAGGAGAGGAAGCAAAGG - Intergenic
961882517 3:130072294-130072316 AGGGAGAGGAGAGGAACTGAAGG + Intergenic
962350496 3:134652284-134652306 AGGGTGAGGAAAGGGAAAGATGG + Intronic
962652994 3:137514941-137514963 GGGTTAAGGAGAGGGTGTGAGGG + Intergenic
963200292 3:142579063-142579085 CGGGGGAGGATAGGGCTTGAGGG + Intergenic
963339090 3:144012567-144012589 GGGGTGAGGAGAGGCAGGTAGGG + Intronic
963939831 3:151086814-151086836 CGAGCGAGGAGGGGGAGAGAGGG + Intronic
964583823 3:158272872-158272894 TGGATGAGGAGAGGGAGGAAAGG - Intronic
964719550 3:159757581-159757603 CGGGTGAGGTAAATGAGTGAAGG - Intronic
965080550 3:164025646-164025668 CGGGAGAAGAGGGGGAGGGAAGG + Intergenic
965308162 3:167094351-167094373 CTGGTCAGTAGAGGGAGTGTAGG - Intergenic
965542831 3:169887643-169887665 TGTGTGTGGAGAGGGAGTGAGGG - Intergenic
965550996 3:169965118-169965140 TGGGTGGGTAGAGGGATTGAAGG + Intergenic
965765926 3:172129982-172130004 TGGTTGGGGAGAGGGAGGGAGGG + Intronic
966818561 3:183908089-183908111 TGCGTGGGGAGAGGGGGTGAGGG + Intergenic
966826631 3:183970415-183970437 TGGGTGAGGAGAGAGTGTGCTGG - Intronic
966862266 3:184237073-184237095 GGGGTCAGGAGAAGGAATGAGGG - Intronic
967000600 3:185330551-185330573 TGGTTGAGGAGAAGGAGTGGAGG + Intronic
967033630 3:185631445-185631467 GGGGAGGGGAGAGGGAGGGAGGG - Exonic
967135860 3:186512108-186512130 CAGATGAAGAGAGGGAGAGAGGG + Intergenic
967265436 3:187687245-187687267 TGGGAGAGGAGAGGGGCTGAAGG + Intergenic
967909306 3:194528029-194528051 GGGGTGTGGAGAGAGAGGGAAGG - Intergenic
968456726 4:704187-704209 CGGGGGAGGGGAGGCAGGGAGGG - Intergenic
968647851 4:1749111-1749133 CAGGTGGGGAGGGGGCGTGATGG - Intergenic
968686030 4:1959385-1959407 TGGGTAAGGAGAGGCAGTGGTGG + Intronic
969626806 4:8309743-8309765 CGGGTGAGCAGTGGGAGGCAGGG - Intergenic
969632957 4:8349059-8349081 CAGGTGAGGACACGGAGGGAAGG - Intergenic
970323513 4:14899032-14899054 GGAGGGAGGAGAGGGAGGGAGGG + Intergenic
970488125 4:16544644-16544666 TGGGAGATAAGAGGGAGTGAGGG + Intronic
970518366 4:16857908-16857930 GGGCTGAGGGGAGGGAGGGAGGG - Intronic
970610656 4:17722090-17722112 TGGGTGTGGAGAGGGGGAGACGG + Intronic
970828512 4:20307198-20307220 GGGGTGGAGAGAGGGAGTCAGGG - Intronic
971034140 4:22675069-22675091 GGGGGGAGGGGAGGGAGGGAGGG - Intergenic
971063100 4:22994428-22994450 CAGGTGTGGAGAGGGGGTGGGGG + Intergenic
971528807 4:27658790-27658812 TGGCTCAGGAGAGGAAGTGATGG - Intergenic
972278984 4:37585218-37585240 GGGGAGAGGAGAGGTATTGAGGG + Intronic
972278994 4:37585247-37585269 GGGGAGAGGAGAGGTATTGAGGG + Intronic
972279110 4:37585624-37585646 GGGGTGAGGAGAGGTGTTGAGGG + Intronic
972335885 4:38106946-38106968 AGGGTGGGGAGAGGCAGGGATGG - Intronic
972388682 4:38592221-38592243 CATGTGAGGTGAGGGCGTGAGGG + Intergenic
972572622 4:40324682-40324704 GGGGTGAGGTGAGGATGTGAAGG + Intergenic
973554742 4:52071858-52071880 GAGGAGAGGGGAGGGAGTGAAGG - Intronic
973634836 4:52852272-52852294 CTGGAGTGGGGAGGGAGTGATGG - Intergenic
973865470 4:55108699-55108721 AGGGAGTGGAGAGGGAGGGAGGG - Intronic
975356432 4:73411080-73411102 CAGGTGAGGAGTGTGGGTGACGG - Intronic
975607236 4:76167661-76167683 CGGGGGGGGGGAGGGAGGGAGGG - Intronic
975983753 4:80184989-80185011 GGGGTGGGGAAAGGGAGGGAAGG + Intronic
976478309 4:85510494-85510516 GGGGAGAGGGGAGGGAGAGAAGG - Intronic
976514282 4:85946476-85946498 CAAGAGAGGAGAGGGAGAGAGGG - Intronic
976597590 4:86908620-86908642 AGGTTGAGGAGGGGGAGGGAGGG - Intronic
977094034 4:92715643-92715665 CGAGTGAAGAGAGCGAGTGCAGG + Intronic
978072720 4:104491884-104491906 GGGGGGAGGGAAGGGAGTGATGG + Exonic
978735217 4:112077114-112077136 AGGGTGAGGCCAGGGTGTGAGGG + Intergenic
979536563 4:121827622-121827644 GAGGTGAGGAGAGGGAAAGAAGG - Intronic
979933033 4:126656080-126656102 GGGGTGATGGGAGGGGGTGAAGG - Intergenic
980131350 4:128819080-128819102 CTGGGGAGGCCAGGGAGTGATGG - Intronic
980469530 4:133233756-133233778 TGGGTGAGTAAAGGGAGTGTGGG + Intergenic
980892455 4:138830173-138830195 TGGATGAGGAAAGGGGGTGAGGG - Intergenic
981099009 4:140810735-140810757 AAGGTGGGGAGAGGGAGAGAGGG - Intergenic
981099017 4:140810759-140810781 AAGGTGGGGAGAGGGAGAGAGGG - Intergenic
981379524 4:144056907-144056929 AGAGAGAGGAGAAGGAGTGAGGG + Intergenic
984717327 4:182938033-182938055 CTGGTCAGGACAGGGAGGGAAGG - Intergenic
984763885 4:183384883-183384905 CAGGTGATGAGAAGGAGAGAAGG + Intergenic
984920364 4:184758889-184758911 GGGGTGGGGGGAGGGAGGGAGGG - Intronic
985580904 5:694567-694589 CAGGAGAGGAGAGGAAGTGTGGG - Intergenic
985595529 5:785899-785921 CAGGAGAGGAGAGGAAGTGTGGG - Intergenic
985761781 5:1752690-1752712 TGGGAGAGGAGAGGGTGAGATGG + Intergenic
986902362 5:12452161-12452183 CAAGTGAGGAGAGAGAGAGAAGG + Intergenic
989534316 5:42546416-42546438 AGGGTGAGGAGGGGAAGTGTAGG + Intronic
989592148 5:43121591-43121613 CGGGGGAGAAGAGGGAGGGCGGG + Exonic
990416425 5:55591345-55591367 GGGGTGGGGAGAGGGAGAGAGGG + Intergenic
991017231 5:61945244-61945266 CGGATTGGGAGAGAGAGTGAGGG - Intergenic
992135114 5:73736837-73736859 TTGGTGAGGGGAGGGAGGGAGGG + Intronic
993041895 5:82823981-82824003 AGGGTGAGAAAAGTGAGTGATGG + Intergenic
993144682 5:84078990-84079012 AGGAAGAGGAGAGGGACTGAAGG + Intronic
993170290 5:84411434-84411456 GGGGAGAGGGGAGGGAGGGACGG - Intergenic
994567593 5:101471225-101471247 GGGAGGAGGAGAGGGAGGGAGGG + Intergenic
994567603 5:101471249-101471271 GGGAGGAGGAGAGGGAGGGAGGG + Intergenic
994877181 5:105439141-105439163 CTGGTGAGGAGAGGTAGAAAAGG + Intergenic
995320067 5:110824207-110824229 GGGGTGGGGAGAGAGAGAGAGGG - Intergenic
995380702 5:111530413-111530435 GGAGTGAGGAGAGGAAGTGTGGG - Intergenic
995561976 5:113391848-113391870 TGGGTGTGGAGAGGGAGGTAGGG + Intronic
995815104 5:116158475-116158497 GGAGAGAGGAGAGGGAGAGAGGG - Intronic
995887764 5:116915574-116915596 GGGGTGAGGAGACAGAGTAATGG + Intergenic
996056191 5:118985226-118985248 TGGCTGAGGAGAGGGCTTGAGGG - Intronic
996326437 5:122280141-122280163 CTAGAGAGGAGAGGGAGGGAGGG - Intergenic
996700468 5:126445630-126445652 GGGGTGAGGAGGGGGTGGGAGGG + Intronic
996953582 5:129157102-129157124 AGGCAGAGGAGAGGGAATGAAGG + Intergenic
996968235 5:129331222-129331244 GAGGTGAGGAGAGGGAAGGATGG + Intergenic
997186577 5:131887849-131887871 GGGGTGGGGGGAGGGGGTGAGGG - Intronic
997419593 5:133755500-133755522 AGGGGGAGGAGAGGATGTGAGGG - Intergenic
998028022 5:138837515-138837537 GGGGGGAGGAGAGGGAGGGGAGG - Intronic
998040886 5:138950437-138950459 GGCGTGTGCAGAGGGAGTGAGGG + Intronic
998163035 5:139824148-139824170 GGGGTGGGGACAGGGAGTGAGGG - Intronic
998394760 5:141811600-141811622 GGGCTGAGGAAAGGGAGAGATGG - Intergenic
998429980 5:142062460-142062482 GGGATGAGGTGAGGGAGTGAAGG + Intergenic
999150395 5:149422759-149422781 CGGGTGGGGTGAGGGAGCCAAGG - Intergenic
999270123 5:150291896-150291918 CAGGAGAGGAGAGGGAGGGTGGG + Intergenic
999622923 5:153490600-153490622 GGGGAGAGGAGAGGGAGTGGGGG + Intronic
999831290 5:155322589-155322611 AGGTTGAGGTGAGGGAGGGAGGG + Intergenic
1000432848 5:161170783-161170805 CTGGTGAGGATAGGGAGAAAAGG - Intergenic
1000505061 5:162106328-162106350 AGGGTGAGGAGTGGGAGAGAAGG - Intronic
1002316417 5:178347091-178347113 GCGGTGAGGACAGGGAGGGAGGG - Intronic
1002432279 5:179210583-179210605 TGGGTGAGGAGAGGAAGACAGGG + Intronic
1002580550 5:180207631-180207653 CGGGGCAGGAGAGGGAGGGCAGG - Intronic
1002603808 5:180370336-180370358 CTGGGGAGGGGAGGGAGGGAAGG + Intergenic
1002697004 5:181098376-181098398 GGGGTGGGGAGAGGTAGGGAGGG + Intergenic
1002697037 5:181098446-181098468 GGGGTGGGGAGAGGTAGGGAGGG + Intergenic
1002852669 6:1010509-1010531 AGGGAGAGGGGAGGGAGGGAGGG - Intergenic
1002902708 6:1423497-1423519 AGGGTGGGGAGAGGTAGGGAGGG - Intergenic
1003014078 6:2454038-2454060 GGGATGGGGAGAGGGAGAGAGGG - Intergenic
1003099394 6:3165454-3165476 CTGGAGAGGAGAGGGCCTGAAGG - Intergenic
1003126988 6:3363432-3363454 AGGCTGAGGAGAGGCTGTGAGGG + Intronic
1003153190 6:3570089-3570111 AGGGAGAGGAGAGGGAGGGAGGG - Intergenic
1003263766 6:4549163-4549185 AGGGTGGGAAGAGGGAGAGAGGG + Intergenic
1003319000 6:5035742-5035764 GGGGGGAGGGGAGGGAGGGAGGG - Intergenic
1003518450 6:6837064-6837086 AGGGAGAGGGGAGGGAGGGAGGG + Intergenic
1003872203 6:10412416-10412438 GGGGAGAGGGGAGGGAGGGAAGG + Intronic
1003901487 6:10659615-10659637 GGGGAGAGGAGAGGGAGAGAGGG + Intergenic
1004355117 6:14923806-14923828 GGGGTGAAGAGAGGGAGAGCTGG - Intergenic
1005565934 6:27094454-27094476 GGAGGGAGGAGAGGGAGGGAGGG + Intergenic
1005829625 6:29660178-29660200 CGGGTAGGGAGTGGGGGTGAAGG - Intronic
1005866522 6:29942094-29942116 CAGGTAAGGAGTGGGAGTCAGGG + Exonic
1006088728 6:31615466-31615488 AGGGTAAGGAGAGGAAGGGAGGG + Intronic
1006120666 6:31803164-31803186 ATGGTGAGGAGAGGGACTTAAGG - Intronic
1006166636 6:32069203-32069225 TGAGGGAGGAGAGGGAGTGAGGG + Intronic
1006175321 6:32117839-32117861 CAGGTGAGGAGAGAGAGAGAGGG - Exonic
1006572722 6:35018685-35018707 CTGGAGAGGGGAGGGAGTGGGGG - Intronic
1007399455 6:41595423-41595445 CGGCAGAGGAGAGCCAGTGAGGG + Intronic
1007610640 6:43146696-43146718 AAGGTGAGGACAGGGAGTGAAGG + Exonic
1007701052 6:43766832-43766854 GGGGTCAGGGGATGGAGTGAAGG + Intergenic
1007716640 6:43859951-43859973 GGGGTGAGGAGAGGGGGAGCAGG + Intergenic
1009455086 6:63847374-63847396 AGGAAGAGGAGAGGGAGAGAGGG - Intronic
1009477023 6:64105593-64105615 CAGGGGATGAGAGGGAGGGAAGG - Intronic
1010083089 6:71886688-71886710 CGGGAGAGGCGAGGGGGCGAGGG - Intronic
1010122970 6:72400634-72400656 CGGGTGAGGGGAGTGAGTGTGGG - Exonic
1011740096 6:90350870-90350892 TGGCAGAGGAGAGGGAGGGAGGG - Intergenic
1012172466 6:96035179-96035201 CATATGAGGAGAGGGAGGGAGGG + Intronic
1012349045 6:98228783-98228805 GGGGTGAGGGGAGGGAGGAACGG + Intergenic
1012422423 6:99079403-99079425 GGGATGGGGAGAGGGAGAGAGGG - Intergenic
1013338865 6:109193123-109193145 CTAGAGAGGGGAGGGAGTGAAGG - Intergenic
1013422314 6:109978186-109978208 CTGGCGAGGAGAGTGAGTGCTGG + Intergenic
1013796734 6:113896762-113896784 CCAGAGAGGAGAGAGAGTGAGGG + Intergenic
1014912459 6:127111300-127111322 GGGGTGAAGAGAAGGAGAGAAGG + Intergenic
1015354032 6:132255898-132255920 AGGGCGTGGAGAGGGAGAGAGGG - Intergenic
1015709677 6:136126257-136126279 TGGGTGAGAGGAGGGAGTGGTGG - Intronic
1016214685 6:141583603-141583625 AGGGTGAGAAGAGAGAGAGAAGG + Intergenic
1016254463 6:142088108-142088130 TGGGTGTGGAGAGGAAGAGAGGG - Intronic
1016623529 6:146140010-146140032 GGGGAGAGGAGGGGAAGTGAGGG - Intronic
1016872966 6:148837285-148837307 GGGGTGAGGATATGGATTGAGGG - Intronic
1017128727 6:151090270-151090292 GGGGTGGGGAGAGGGAGAGAAGG - Intronic
1017650877 6:156581508-156581530 CAGGAGAGGAGAAGGAGAGATGG - Intergenic
1017736656 6:157370876-157370898 GGGGAGGGGAGAGGGAGGGAAGG + Intergenic
1018017409 6:159724898-159724920 GGGGGGAAGAGAGGGAGGGAGGG + Intronic
1018857375 6:167684494-167684516 AGGAAGAAGAGAGGGAGTGAAGG + Intergenic
1018930741 6:168238823-168238845 CTGTTGAGATGAGGGAGTGAGGG + Intergenic
1019270484 7:144375-144397 AGGCTGAGGGGAGGGAATGACGG - Intergenic
1019360617 7:602538-602560 TGGGAGAGGTGAGGGTGTGAGGG - Intronic
1019703616 7:2487281-2487303 TGGGTGGGGGGAGGGAGGGAGGG + Intergenic
1020053233 7:5097449-5097471 CTGGTGAGGAGATGGAGAAAGGG - Intergenic
1020344862 7:7151993-7152015 GGGGAGGGGAGAGGAAGTGAGGG - Intergenic
1022585327 7:31603388-31603410 TGGGTGGGGAGGGGGAGGGAAGG - Intronic
1022600429 7:31753355-31753377 GGGAAGAAGAGAGGGAGTGAAGG - Exonic
1022754872 7:33276898-33276920 CCCATGAGGTGAGGGAGTGAGGG - Intronic
1022814698 7:33903690-33903712 TGGGTGGGGGGAGGGAGGGAAGG + Intergenic
1023344313 7:39255717-39255739 TGGGTGAGGAAAGGGATTTAGGG + Intronic
1023667153 7:42535792-42535814 GGCTTGAGGAGAGGGAGGGAGGG - Intergenic
1023911226 7:44558439-44558461 GGGGGGAGGAGAAGGAGGGAGGG - Intergenic
1023916995 7:44597059-44597081 GAGGGGAGGAGAGGGAGGGAAGG + Intergenic
1024010390 7:45261349-45261371 GAGGAGAGAAGAGGGAGTGAAGG + Intergenic
1024176955 7:46850352-46850374 TTGGTGGGGAAAGGGAGTGAGGG + Intergenic
1024577663 7:50777914-50777936 AGGGAGGGGAGAGGGACTGAGGG + Intronic
1024851716 7:53725669-53725691 TGGGAGGGGAGAGGAAGTGAAGG + Intergenic
1024920066 7:54545972-54545994 TGGGAGAGGAGAGAGAATGAGGG + Intronic
1026585295 7:71651192-71651214 CAGGAGAGGAGAGGAAGGGATGG + Intronic
1026793668 7:73351660-73351682 AGGATGTGGAGAGGGAATGAAGG - Intronic
1027145829 7:75693767-75693789 CGGGGGAAGGGAGGGAGGGAGGG + Intronic
1027559259 7:79706735-79706757 GGGGTGAGGAGAGAGTGGGAGGG - Intergenic
1028019253 7:85749992-85750014 TGGGTGAGGGCAGGGAGTGGTGG + Intergenic
1028268594 7:88759367-88759389 GGGGTGAGGACAGGGAGTTGGGG - Exonic
1029540354 7:101179142-101179164 GGAGGGAGGAGAGGGAGGGAAGG + Intronic
1030166763 7:106562979-106563001 TGAGGGAGGGGAGGGAGTGAGGG + Intergenic
1030196854 7:106860905-106860927 AGGGAGAGGAGAGAGAATGAGGG + Intergenic
1031689173 7:124766198-124766220 CGGGTGCGGGGCGGGAGTGGGGG + Intergenic
1032182062 7:129688714-129688736 CAGGTGCGGAGAGGGAATGCCGG + Intronic
1032189851 7:129758431-129758453 CATGTGAGAGGAGGGAGTGATGG + Intergenic
1032468962 7:132164434-132164456 AGGATGAGGAGATGGAGAGAAGG - Intronic
1033156574 7:138961981-138962003 CAGGTGGGAAGGGGGAGTGATGG - Intronic
1033628996 7:143139052-143139074 CTGGTGAGGAGAAGGTGGGAGGG - Intronic
1034232144 7:149538929-149538951 AGGGAGGGGAGAGGGACTGAAGG - Intergenic
1034367840 7:150567348-150567370 CAGGAGAAGAGAGGAAGTGAGGG - Exonic
1034653731 7:152712772-152712794 GGGGGGAGGAGAGGAAGGGAGGG - Intergenic
1034712272 7:153204092-153204114 CGGGTGAGGAGAGGGATTCCAGG + Intergenic
1034873534 7:154705116-154705138 AGGGAGAGGAGAGGGGGAGAAGG + Intronic
1034878906 7:154749012-154749034 CGGGACAGGAGAGAGAGGGATGG + Intronic
1035051984 7:156004243-156004265 CGGGTGAGGTGAGTGAATGCGGG - Intergenic
1035166873 7:156996012-156996034 GGGGAAGGGAGAGGGAGTGAGGG - Intronic
1035392459 7:158514310-158514332 CGGCTGGAGAGAGGGAGTGACGG + Intronic
1035425499 7:158769427-158769449 GGGGTGAGGAGGCGCAGTGAGGG - Intronic
1035487762 7:159240932-159240954 TGAGTGAGGAGAAGGAGGGATGG + Intergenic
1036020288 8:4837169-4837191 CGGGTGAGGATGGGGAGAAAAGG + Intronic
1036089679 8:5652040-5652062 AGGGTAAGGAGAGGGAGCCACGG - Intergenic
1036212221 8:6851925-6851947 CAGGTTAAGAGAGGGAGTCACGG - Intergenic
1036394073 8:8351839-8351861 GGGATGAGGAGATGGTGTGAAGG - Intronic
1036795659 8:11754677-11754699 GGGGTGAGGAGTGGGAAGGAGGG - Intronic
1037376535 8:18236109-18236131 GGGGTGAGGGGAGGGAGAGCAGG - Intergenic
1037467262 8:19172647-19172669 GGGGAGAGGAGAGGGAGGGGAGG + Intergenic
1037536531 8:19829562-19829584 TGGGGGAGGAGAGCGAGAGAGGG + Intronic
1037703507 8:21296042-21296064 TGGGTGAGATGAGGGAGGGAGGG - Intergenic
1037886531 8:22599071-22599093 GGGGAGAGGAGAGGGAGGGGAGG - Intronic
1037886540 8:22599092-22599114 GGGGAGAGGAGAGGGAGGGGAGG - Intronic
1037886614 8:22599280-22599302 GGGGCGAGGAGAGGGAGGGGAGG - Intronic
1037911368 8:22745605-22745627 AGGGTGAGGGGAGGGAATGCTGG - Intronic
1038311514 8:26449367-26449389 GGGGAGAGGAGAAGGAGGGAGGG + Intronic
1038476936 8:27875205-27875227 GGAGTGAAGAGAGGGAGGGAGGG - Intronic
1038603670 8:28975810-28975832 CAGATGAAGAGAGGAAGTGAGGG + Intronic
1038860901 8:31388003-31388025 GGGGAGAGGAGAGGGGGAGAGGG - Intergenic
1039891512 8:41688745-41688767 CATGGGAGGAGTGGGAGTGAAGG + Intronic
1039934094 8:42025079-42025101 CTGGTGAGGATAGGGAGAAAAGG - Intronic
1040812833 8:51475772-51475794 CTGGTGAGGGAAGGGAGGGAGGG - Intronic
1041036512 8:53796765-53796787 CGGGAGAGGAGAGGATGTAATGG + Intronic
1041172289 8:55156420-55156442 GGGGTGGGGAGAGGGAGGAAGGG + Intronic
1041304341 8:56445286-56445308 CAGGTGAGGGTAGGGAATGAGGG + Intronic
1041908972 8:63067761-63067783 CAAGAGAGGAGAGGGAGGGAGGG - Intronic
1042875362 8:73436165-73436187 GGGCTGGGGAGAGGGGGTGATGG + Intronic
1042892826 8:73631994-73632016 GGGGGGAGGAGAGGGAGGGAGGG + Intronic
1043268961 8:78304568-78304590 TGTGTGTGTAGAGGGAGTGAAGG + Intergenic
1043305343 8:78786900-78786922 GGGGAGAGGAGAGGGGCTGAAGG + Intronic
1043472746 8:80578493-80578515 CGGGAGAGGGGAAGGAGTGGGGG - Intergenic
1043729838 8:83662797-83662819 CGGGAGGGGAGAGAGAGAGAAGG + Intergenic
1044098739 8:88102581-88102603 GGGGAGGGGAGAGGGACTGAAGG - Intronic
1044213508 8:89580054-89580076 GGGGTGAGGGAAGGAAGTGAGGG + Intergenic
1044520933 8:93198553-93198575 GTGGGGAGGAGAGGGAGGGAAGG + Intergenic
1044985839 8:97755847-97755869 AGAGGGAGGAGAGGCAGTGAAGG - Intergenic
1045127780 8:99113028-99113050 AGGGTGGGGAGAGGGAGAGGAGG - Intronic
1045161894 8:99557279-99557301 GTGGTGAGGAAGGGGAGTGAGGG - Intronic
1045459200 8:102412108-102412130 TGGGGGAGGGGAGGGAGGGAAGG + Intronic
1045755190 8:105533958-105533980 GGAGGGAGGAGAGGGAGGGAGGG - Intronic
1045824528 8:106381349-106381371 CTGGTGAGGAGATGGAATTAGGG + Intronic
1046612904 8:116445296-116445318 CGGGGGAGGAGAGAGGGGGAGGG + Intergenic
1047254834 8:123207128-123207150 GGGAAGAGGAGAGAGAGTGATGG - Intronic
1047343729 8:124007288-124007310 AGGGGGGGGAGAGGGAGAGAGGG - Intronic
1047850800 8:128855189-128855211 CGGGTTTAGAGAGGGAGGGATGG + Intergenic
1048622055 8:136144524-136144546 CAGGGGAGGACAGGGAGAGATGG - Intergenic
1048788063 8:138073047-138073069 CTAGAGAGGGGAGGGAGTGAGGG + Intergenic
1048941957 8:139407558-139407580 TGGGGGATGAGAAGGAGTGAAGG + Intergenic
1049075996 8:140396550-140396572 TAGGGGAGGAGAGGGAGGGAGGG - Intronic
1049245412 8:141559816-141559838 GGGCAGAGGTGAGGGAGTGAGGG - Intergenic
1049468927 8:142766716-142766738 AGGGTGAGGACAGGGAGGGAGGG - Intronic
1049796908 8:144501099-144501121 GGAGAGAGGAGAGGGAGTGAGGG - Intronic
1050789262 9:9445716-9445738 CGTGTCAGGAGAGGGAATCATGG - Intronic
1051974942 9:22938051-22938073 AGGGTGGGGTGAGGAAGTGAGGG - Intergenic
1052427553 9:28325066-28325088 AGAGGGAGGAGAGGGAGAGAAGG - Intronic
1053580528 9:39399399-39399421 AGGATGATGAGAGGGAGGGAAGG - Intergenic
1053653989 9:40197239-40197261 AGGGTGTGGAGCGGGAGTGAGGG + Intergenic
1053845024 9:42227477-42227499 AGGATGATGAGAGGGAGGGAAGG - Intergenic
1053904378 9:42826414-42826436 AGGTTGTGGAGCGGGAGTGAGGG + Intergenic
1054102115 9:60958204-60958226 AGGATGATGAGAGGGAGGGAAGG - Intergenic
1054366107 9:64343455-64343477 AGGGTGTGGAGCTGGAGTGAGGG + Intergenic
1054530607 9:66179100-66179122 GGGTTGTGGAGCGGGAGTGAGGG - Intergenic
1054584244 9:66948659-66948681 AGGATGATGAGAGGGAGGGAAGG + Intergenic
1054673735 9:67833185-67833207 AGGGTGTGGAGCGGGAGTGAGGG + Intergenic
1054906789 9:70419732-70419754 CGGGGGTGGGGAGGGAGTGGGGG + Intergenic
1054949639 9:70835549-70835571 GGTGTGAGGAGAGTGAGTGGAGG - Intronic
1055255146 9:74360603-74360625 CAGGTGAAGAGAGGGCATGAGGG - Intergenic
1055361886 9:75500431-75500453 CGTGTGAGGACAGAGAGAGAAGG - Intergenic
1055381324 9:75710101-75710123 AGAGAGAGGAGAGGGAGGGAGGG - Intergenic
1055387104 9:75774515-75774537 GGGGTGGGGAGAGAGAGGGAGGG - Intergenic
1056318141 9:85410887-85410909 TGAGTGAGGAGATGGAGCGAAGG - Intergenic
1056474865 9:86944293-86944315 TGGGTGAGGAGGGGGGTTGAGGG - Intergenic
1056587831 9:87939872-87939894 AGGGTGGGGAGCGGGAGGGAGGG + Intergenic
1056604938 9:88077836-88077858 GGGGAGAGGGGAGGGAGAGAGGG + Intergenic
1056609036 9:88113073-88113095 AGGGTGGGGAGCGGGAGGGAGGG - Intergenic
1057379538 9:94555472-94555494 AGGGTGCAGAGAGGGAGGGAAGG + Intergenic
1057721485 9:97535427-97535449 CAGGTGAAGAGAGGGAGTGCAGG - Intronic
1057845604 9:98520244-98520266 GGGGGAAGGAGAGGAAGTGATGG + Intronic
1058444492 9:105042813-105042835 AGGGAGTGAAGAGGGAGTGAAGG - Intergenic
1058875862 9:109244323-109244345 GGGATGAGGGGAGGGAGGGAAGG + Intronic
1058907048 9:109490295-109490317 TGAATGAGGAGAGGGAGAGATGG - Intronic
1059050468 9:110919230-110919252 GGGGTGGGCAGAGGGAGAGAGGG - Intronic
1059130924 9:111748773-111748795 GGGGGGAGGGGAGGGAGGGAAGG - Intronic
1059354479 9:113688110-113688132 CGGGTGAGGGGAGGACGGGAAGG - Intergenic
1059705648 9:116820835-116820857 GGAGGGAGGAGAGGGTGTGATGG - Intronic
1059750679 9:117244598-117244620 GGAGGGAGGAGAGGGAGGGAGGG + Intronic
1061045430 9:128162448-128162470 CCGTGGAGGGGAGGGAGTGATGG + Intronic
1061128270 9:128689925-128689947 AGGGGGAGGAGAGCGAGGGAGGG - Intronic
1061272261 9:129550194-129550216 CGGGCGGGGAGAGGGAGGAAAGG - Intergenic
1061373312 9:130210040-130210062 TGGGTGGGGAGGGGCAGTGAGGG + Intronic
1061531608 9:131218552-131218574 TTGGTGAGGGGAGGGAGAGAAGG - Intronic
1061625568 9:131838937-131838959 AGGGTGTGGAGAGGGAGAGGGGG + Intergenic
1061753936 9:132799752-132799774 GGGATGAGGAGAGGCAGTGTGGG - Intronic
1062165809 9:135106711-135106733 CAGGTCAGGAGAGGGAGGGCGGG - Intronic
1062255899 9:135620290-135620312 CGGGGGAGAAGAGGGAGTAGGGG - Intergenic
1062527697 9:136984970-136984992 GGGGCGAAGAGAGGGAGAGAGGG - Exonic
1062681601 9:137784981-137785003 GGGGTGAGGTCAGGGAGTGGGGG + Intronic
1062731681 9:138113580-138113602 CGGGAGACGTGAGGGAGTGCCGG + Intronic
1062731710 9:138113712-138113734 CGGGAGACGTGAGGGAGTGCCGG + Intronic
1203626798 Un_KI270750v1:32845-32867 AGGGTGGGGAGTGGGAGGGAAGG - Intergenic
1186365107 X:8884442-8884464 AGGGAGAGGAGAAGTAGTGAAGG - Intergenic
1187187091 X:16997423-16997445 AGGGTGAGGAGAGGGGAAGAGGG - Intronic
1187411621 X:19055693-19055715 CGGGGAAAGAGAGAGAGTGATGG + Intronic
1187923356 X:24227603-24227625 CGGGTGAGGACATGGAGAAAAGG + Intergenic
1188058967 X:25577043-25577065 GGGGTTAGGATGGGGAGTGAAGG - Intergenic
1188474802 X:30580036-30580058 CTGGTGAGGATAGGGAGAAAAGG - Intergenic
1189137405 X:38562919-38562941 TGGGTGAGGGGCGGGGGTGAGGG - Intronic
1189446675 X:41086365-41086387 AGGGGGAGGAGGGGGAGGGACGG - Intronic
1189494372 X:41495814-41495836 AGGGTGAGGGGAGGGCGAGAGGG - Intergenic
1190179238 X:48177530-48177552 AGGGAGAGGGGAGGGGGTGAAGG + Intergenic
1190471250 X:50781761-50781783 AGGATGAGGTGAGGGAGTGAGGG - Intronic
1190536826 X:51437311-51437333 AGTGAGAGGAGAGGCAGTGAAGG + Intergenic
1190740062 X:53282712-53282734 GGGGTGGGCAGAGGGAGAGAAGG - Intronic
1191829293 X:65398559-65398581 CAGGACAGGAGAGAGAGTGAGGG - Intronic
1192215516 X:69155604-69155626 CAGGTAAGGAAAGGGAGTGTAGG - Intergenic
1192234129 X:69285458-69285480 CGGGTTGAGACAGGGAGTGAGGG - Intergenic
1193697310 X:84724535-84724557 TGGGGCAGCAGAGGGAGTGATGG - Intergenic
1195159215 X:102155160-102155182 CGGGTGGAGAGAGGGCCTGATGG - Intronic
1195430842 X:104787519-104787541 TGGGGGAGGTAAGGGAGTGAGGG + Intronic
1195847161 X:109241255-109241277 CAGGAGAGGAGAGAGAGAGAGGG - Intergenic
1195996036 X:110732556-110732578 CGGATGAGGAGGGGGAGAGCTGG - Intronic
1196918388 X:120561591-120561613 CGGGGGAGGGAAGGTAGTGACGG + Intronic
1197256003 X:124263989-124264011 CTGGAGGGGAGAGGGAGGGAAGG - Intronic
1197758128 X:130010419-130010441 CGGGGAAGGGGAGGGAGGGAGGG - Intronic
1198256056 X:134925519-134925541 GAGGTGCGGAGAGCGAGTGAGGG - Intergenic
1199567851 X:149234629-149234651 GTGGTGAGGGGAGGGAGAGAAGG + Intergenic
1199656654 X:150002664-150002686 AAGGTGAGAAAAGGGAGTGAGGG + Intergenic
1199679852 X:150216848-150216870 GGGGTGAGGAGAGGCGGAGAGGG + Intergenic
1199691370 X:150311361-150311383 AGGATGAGGAGTGGGAGTGAAGG + Intergenic
1199772209 X:150982497-150982519 CAGGAGAGCAGAGGGAATGAGGG + Intronic
1199880877 X:151973742-151973764 AGGGCGAGGAGAAGGTGTGAGGG + Intronic
1200110209 X:153737112-153737134 CTGGGGTGGAGAGGGAGTGGTGG - Intronic
1200169252 X:154060540-154060562 GGGGTGGGGAGAGGGAGGGAGGG + Intronic
1200771519 Y:7129957-7129979 CGGGTGGGGGGAGGGGGAGATGG - Intergenic
1202584761 Y:26410247-26410269 GGGGTGGGGAGATGGGGTGAGGG + Intergenic