ID: 953349791

View in Genome Browser
Species Human (GRCh38)
Location 3:42206887-42206909
Sequence GGTGAGGAGAGGGAGTGATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1198
Summary {0: 1, 1: 0, 2: 11, 3: 125, 4: 1061}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953349778_953349791 13 Left 953349778 3:42206851-42206873 CCTCATTTCTTTCTCTTCAGCCC 0: 1
1: 0
2: 9
3: 78
4: 679
Right 953349791 3:42206887-42206909 GGTGAGGAGAGGGAGTGATGGGG 0: 1
1: 0
2: 11
3: 125
4: 1061
953349785_953349791 -8 Left 953349785 3:42206872-42206894 CCATCCTTGGGAGCGGGTGAGGA 0: 1
1: 0
2: 2
3: 17
4: 182
Right 953349791 3:42206887-42206909 GGTGAGGAGAGGGAGTGATGGGG 0: 1
1: 0
2: 11
3: 125
4: 1061
953349776_953349791 23 Left 953349776 3:42206841-42206863 CCCTTTGTAGCCTCATTTCTTTC 0: 1
1: 1
2: 6
3: 87
4: 640
Right 953349791 3:42206887-42206909 GGTGAGGAGAGGGAGTGATGGGG 0: 1
1: 0
2: 11
3: 125
4: 1061
953349777_953349791 22 Left 953349777 3:42206842-42206864 CCTTTGTAGCCTCATTTCTTTCT 0: 1
1: 0
2: 2
3: 61
4: 655
Right 953349791 3:42206887-42206909 GGTGAGGAGAGGGAGTGATGGGG 0: 1
1: 0
2: 11
3: 125
4: 1061
953349783_953349791 -7 Left 953349783 3:42206871-42206893 CCCATCCTTGGGAGCGGGTGAGG 0: 1
1: 0
2: 0
3: 11
4: 95
Right 953349791 3:42206887-42206909 GGTGAGGAGAGGGAGTGATGGGG 0: 1
1: 0
2: 11
3: 125
4: 1061

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953349791 Original CRISPR GGTGAGGAGAGGGAGTGATG GGG Intronic
900123289 1:1058708-1058730 GGGGAGCAGAGGGAGGGATTTGG + Intergenic
900327871 1:2118757-2118779 GATGAGGGGAGGGAGGGAAGGGG + Intronic
900508047 1:3039420-3039442 GGGGAGGAGGGGGAGGGAGGAGG - Intergenic
900915110 1:5632165-5632187 GGTGGGGAGGGTGAATGATGTGG + Intergenic
900932840 1:5747651-5747673 AGGGAGGAGAGGGAGGGAGGAGG + Intergenic
901343481 1:8516942-8516964 GGTGGGGAGAGGGAGGGAGGCGG + Intronic
901379198 1:8861678-8861700 GGAGAGGAGAGGAAGAGAAGGGG - Intronic
901425750 1:9181647-9181669 GGTGAGGAGAGGAACTGGGGAGG + Intergenic
901783708 1:11610789-11610811 GGTTAGGAGTGGGAGTGCGGAGG - Intergenic
902283040 1:15388321-15388343 GGGGAGGGGAGGGAGGGAGGTGG - Intronic
902602934 1:17552193-17552215 GGCGAGGGGAGGGGGAGATGGGG + Intronic
902674055 1:17996156-17996178 GGTGGGGTGAAGGAGTGAAGTGG - Intergenic
902778996 1:18692633-18692655 GATGAGCAGAGGAAGTGATCAGG + Intronic
902806081 1:18862111-18862133 GGTGCAGAAAGGGGGTGATGAGG - Intronic
902840517 1:19071156-19071178 GGGGATGAGAGGGAGTGGGGAGG + Intergenic
902975547 1:20085585-20085607 TGTGAGGGGAGGGAGTGGTGGGG + Intronic
903034609 1:20485865-20485887 GGGGAGGGGAGGGAGAGAGGAGG + Exonic
903735928 1:25530029-25530051 GGTGGGCAGAGGGGGTGTTGAGG - Intergenic
904322727 1:29707579-29707601 GGAGAGGAGAGGGAGGGGAGGGG + Intergenic
904361564 1:29976428-29976450 GGTGAGGATAGGGATTGAATTGG + Intergenic
904378813 1:30097549-30097571 TGTGGGGAGAGGGAGAGTTGGGG + Intergenic
904467425 1:30716733-30716755 GGTGTGGAGGGGAGGTGATGGGG - Intronic
904614435 1:31742347-31742369 GGGGAGGGGAGGGGGTTATGAGG + Intronic
904681768 1:32234381-32234403 GGTGAGCTGAGGGGGTGTTGAGG - Intergenic
904762802 1:32817689-32817711 GGTGAAGAGCGGGAGGGACGAGG + Exonic
904870514 1:33614967-33614989 AGTGAGGAGAGGGAGATTTGGGG - Intronic
906046687 1:42836438-42836460 GGTGAGGCTGGGGAGTGAGGCGG + Intronic
906194247 1:43920189-43920211 GGTGAAGAGAGCGTGTGGTGGGG - Intronic
906279476 1:44543326-44543348 GGGGAGGGGAGGGGGTGATGGGG + Intronic
906301016 1:44681650-44681672 GGAGAGGAGAAGGATGGATGTGG + Intronic
906359353 1:45139437-45139459 GGAGAGGGGAGGGAGAGAGGAGG - Intronic
906861716 1:49367914-49367936 GGAGAGGAGTGGGGGCGATGAGG - Intronic
907085984 1:51674459-51674481 GGAGAGCAGAGGTAGTGGTGAGG + Intronic
907112914 1:51943019-51943041 CCTGAAGAGAGGGAGAGATGGGG - Intronic
907246065 1:53109946-53109968 GGTGAGCAGAGGCATGGATGGGG - Intronic
907255112 1:53173367-53173389 GGAGAGGAGAGGGAGGGGAGGGG - Intergenic
907255133 1:53173414-53173436 GGAGAGGAGAGGGAGGGGAGGGG - Intergenic
907255170 1:53173509-53173531 GGAGAGGAGAGGGAGGGGAGAGG - Intergenic
907395165 1:54184615-54184637 GGAGACAATAGGGAGTGATGGGG + Intronic
907416139 1:54315220-54315242 GTTAAGGAGAGAGAGTTATGTGG - Intronic
907873755 1:58466270-58466292 AGGGAGGGGAGGGAGGGATGGGG - Intronic
908111304 1:60901256-60901278 AGAGGGGAGAGGGAGGGATGGGG - Intronic
908681103 1:66661868-66661890 AATGAGGTGAGGGAATGATGGGG - Intronic
908872899 1:68635059-68635081 GTGGAGGAGAGGGAGTTATGGGG + Intergenic
909765360 1:79349240-79349262 GGTAAGGAGAGGGAGAGAGAAGG + Intergenic
910603956 1:89062952-89062974 TGTGAGGAGAGAAAGAGATGAGG - Intronic
911094499 1:94044568-94044590 GGTGAGGAGAGGGGATGGGGCGG + Intronic
912134227 1:106639780-106639802 GGGGAGGAGCAGGAGTGACGAGG + Intergenic
912270471 1:108203571-108203593 GGGGAGGGGAGGGAGTGGGGAGG - Intergenic
912275724 1:108256551-108256573 GGGGAGGAGAGGGAGGGCAGGGG - Intergenic
912292502 1:108437803-108437825 GGGGAGGAGAGGGAGGGCAGGGG + Intronic
912305908 1:108566844-108566866 GGTGAGGGCACGGAGAGATGGGG + Intronic
912411600 1:109484110-109484132 GGGGAGGGGAGATAGTGATGGGG - Intronic
912431514 1:109630595-109630617 GGTGGGGAGAGTGAGTGAGGAGG + Intronic
912519892 1:110238084-110238106 GGTGAGGAGAGGGAGCCAAACGG + Intronic
912895055 1:113577463-113577485 GGTGAGAAGTGGGGGTGAGGGGG + Intronic
913226858 1:116708166-116708188 GGTAAGGAGAGAGAGGGAAGGGG + Intergenic
913378413 1:118182282-118182304 GGTGAGGAGAGGGAAGGATGGGG + Intronic
913508706 1:119542972-119542994 GGGGAGGAGATGGAGCAATGTGG + Intergenic
913528294 1:119713857-119713879 GGTGGGGATAGGGAGGGATGAGG + Intronic
913706854 1:121434126-121434148 GGAGAGGAGAGGGATAAATGGGG + Intergenic
914331827 1:146679349-146679371 GGAAAGGAGAGGGACTGAGGTGG - Intergenic
914790878 1:150876521-150876543 GGTGAGGAGACGGAGGACTGGGG - Exonic
914845620 1:151282259-151282281 AGGGAGGAGAGGGAGTGGGGAGG + Intronic
914977154 1:152377176-152377198 CCTGATGAGAGGGAGAGATGGGG - Intergenic
915121688 1:153633511-153633533 GGGGAGGGGAGGAAGTGAGGAGG + Intronic
915347719 1:155206474-155206496 GGTGGGGGTAGGGGGTGATGTGG - Intronic
915586005 1:156844363-156844385 GGTGAGGATGGGGAGGGATGCGG + Intronic
915734971 1:158078732-158078754 GGTGAGGGGTGGGAGGGATGGGG + Intronic
915956720 1:160226354-160226376 GGAAAGGAGAGGGAGTCTTGAGG - Intronic
917421255 1:174866089-174866111 GGAGGGGAGAGGGAGGGAGGGGG + Intronic
917508601 1:175650906-175650928 GGTGGGGAGGGGTAGTAATGAGG - Intronic
917508638 1:175651030-175651052 GGTGGGGAGGGGTAGTAATGAGG - Intronic
917508681 1:175651176-175651198 GGTGGGGAGGGGTAGTAATGAGG - Intronic
917513488 1:175687852-175687874 GGGGAGGGGAGGGTGTGGTGGGG - Intronic
917535639 1:175872449-175872471 GAAGAGAAAAGGGAGTGATGGGG + Intergenic
917564953 1:176203977-176203999 GGTAAGAAAAGGGAGTGGTGAGG + Intronic
918070217 1:181128891-181128913 GGAGAGGAGGGGAAGTGAAGGGG + Intergenic
918183921 1:182110746-182110768 GGAGAGGAGAGGAAGGGAGGGGG - Intergenic
918693312 1:187510091-187510113 GTTGAGGAGAGACAGTGTTGGGG - Intergenic
919496969 1:198285040-198285062 GGGGTGGAGTGGGAGTGAAGCGG - Intronic
919923905 1:202182298-202182320 GGAGAGGAAAGGGAGAGAGGGGG + Intergenic
919982524 1:202651120-202651142 AATGAGAAGAGGGAGTGTTGCGG + Intronic
920117570 1:203631250-203631272 GGTGAGGAAAGGTAGAAATGGGG - Intronic
920180967 1:204131499-204131521 GGACAGGAGAGGGAGTGGTGAGG - Exonic
920181232 1:204132925-204132947 GGTGGGGAGAGGGAGCAATGGGG - Intronic
920258692 1:204674290-204674312 GGGGAGGGGAGGCAGTGAGGGGG - Intronic
920309419 1:205040035-205040057 GGTGAGGCGGGGGAGTGGTGAGG + Intergenic
920372542 1:205488415-205488437 GGTGTGGGGAGTGAGGGATGAGG + Intergenic
920565214 1:206967624-206967646 GGTGAGGAGAGGAAGAGAAGTGG - Exonic
920808261 1:209255528-209255550 GCTGTGGAGAGGGAGTAATGGGG - Intergenic
921132226 1:212229690-212229712 GGTGGGGAGAGGAAGGGAGGAGG - Intergenic
921379530 1:214510121-214510143 CGGGAGGAGAGGGAGAGATAAGG + Intronic
921442432 1:215203412-215203434 GGTGAGGAGTGTATGTGATGTGG + Intronic
921579046 1:216873967-216873989 GGGGAGGGGAGGGAGGGAGGGGG + Intronic
921585837 1:216945226-216945248 GATGAGAAGAGAGAGTGCTGAGG + Intronic
921734427 1:218610849-218610871 GGAGAGGAGTGGGACTGATGGGG + Intergenic
921800215 1:219394483-219394505 GGTTAGGAGAAGGGGTGATGGGG - Intergenic
921921794 1:220677857-220677879 GGTGGGGAGAGGGGATAATGAGG + Intergenic
922139288 1:222866133-222866155 GGTGAGCAGAGGAACTGTTGGGG + Intergenic
922347460 1:224708183-224708205 GGTGAGGACAGGAAGTGGAGGGG - Intronic
922555903 1:226531721-226531743 GGTGAGCAGAGGGAGAGGTTGGG + Intergenic
922894429 1:229089282-229089304 GTTGAGGAGGGGGAGAGAGGAGG + Intergenic
923407906 1:233680908-233680930 GTTCAGGAGAGTGAGAGATGGGG + Intergenic
923915545 1:238499700-238499722 GGTGAGAAGAGGGACAGAAGAGG + Intergenic
924292269 1:242548564-242548586 GGTGAGGAGATGGAGAGATGTGG + Intergenic
924560279 1:245153271-245153293 GGTGTCGAGGGGGAGTGTTGGGG - Intergenic
924625734 1:245695318-245695340 GCTGAGGAAATGGAGTGAAGTGG - Intronic
924867089 1:247995169-247995191 ACTGAGAAAAGGGAGTGATGAGG - Intronic
1062934571 10:1376466-1376488 GGAGAGGAGAGGGCCTGATGAGG - Intronic
1063069408 10:2646137-2646159 AGAGAGGGGAGGGAGTGAAGGGG - Intergenic
1063227690 10:4031958-4031980 AGTGAGAAGAGGCAGTGCTGAGG + Intergenic
1063361373 10:5462333-5462355 GGAGAGGAGAGGGAGGAAAGGGG - Intergenic
1063486913 10:6428739-6428761 GGTGGGGAGAGGGAGTGAGGGGG + Intronic
1063972802 10:11393229-11393251 GGGGAGGAGAGGGAGACCTGGGG + Intergenic
1064096828 10:12429951-12429973 GGTGGGGAGGGGCAGTGCTGGGG - Intronic
1064709820 10:18111730-18111752 AGAGAGGAGAGGGAGAGTTGAGG + Intergenic
1064932363 10:20641509-20641531 GGATACAAGAGGGAGTGATGTGG + Intergenic
1065020175 10:21496428-21496450 GGGGAGGAGAGGGAGACGTGTGG + Intronic
1065338588 10:24680708-24680730 GGTGAGTAGAAGGAGTGAAGAGG - Intronic
1065464090 10:26000961-26000983 GCTGGAGAGAGAGAGTGATGGGG + Intronic
1065669136 10:28094646-28094668 GGTGAGGAGGGGGAGTTAAGAGG + Intronic
1065789314 10:29245200-29245222 AGAGAGGAGAGGAAGGGATGAGG + Intergenic
1065944454 10:30594263-30594285 GGGGAGATGAGGAAGTGATGAGG - Intergenic
1066478975 10:35777029-35777051 CCTGAGGAGAGGGAGAAATGGGG + Intergenic
1067062925 10:43087219-43087241 GCTGAGGAGGAGGAGAGATGGGG - Intronic
1067522709 10:47020313-47020335 GGTGAGGAGAGGAGGTGAAGGGG + Intergenic
1067685687 10:48465035-48465057 GATGAGGGGAGGGATTGGTGGGG - Intronic
1067808964 10:49412394-49412416 GGTGAGCAGTGGGAATGGTGTGG - Intergenic
1068065539 10:52126164-52126186 GGTGAGGGGAGGTGGTGGTGGGG + Intronic
1068255082 10:54498921-54498943 GAGGAGGAGAGAGAGTGAAGGGG + Intronic
1068291398 10:55006248-55006270 TGGGAGAAGAAGGAGTGATGAGG - Intronic
1068835959 10:61553914-61553936 GGTGAGGAGAAGGAATGTAGAGG + Intergenic
1069555694 10:69396495-69396517 GGTGGGGGGAGGGAGGAATGTGG - Intronic
1069662322 10:70132005-70132027 GGTGAGGATGGGGAGTGGTGAGG - Intronic
1069786989 10:70994753-70994775 GGAGAGGAGAGGGTGGGAAGAGG + Intergenic
1069886230 10:71625466-71625488 GGTGGGGGTAGGCAGTGATGGGG + Intronic
1069950870 10:72017212-72017234 GGTGAGGAGAGGGAGTCTGAAGG + Intergenic
1070018456 10:72559265-72559287 GGGGAGGAAAGGGACTGAAGGGG + Intronic
1070102601 10:73402302-73402324 GGTGGGGAGGGGGGGTGTTGAGG - Intronic
1070490322 10:76969902-76969924 GGTGAGGAGAGGGCGAGGGGAGG + Intronic
1070808254 10:79283538-79283560 GCTGTGGAGATGGTGTGATGTGG - Intronic
1070842115 10:79494575-79494597 GGTGAGGAGAGGAAGGCACGAGG - Intergenic
1071381546 10:85068158-85068180 TTTGAGGAGAGGGAGAGAGGTGG - Intergenic
1071429176 10:85592870-85592892 GGTGAGGACAGGCAGTGTGGAGG - Intergenic
1071788467 10:88929520-88929542 GGGGGGGAGAGGGAGGGAAGGGG - Intronic
1071798626 10:89032521-89032543 ACTGAGGAGAGGGAGGGGTGGGG - Intergenic
1071902070 10:90131425-90131447 GAGGAGGAGAGAGAGTGAGGGGG - Intergenic
1071971881 10:90916025-90916047 GGTTAGGAGATGGAGGGGTGGGG + Intronic
1072236609 10:93459213-93459235 GATGAGGAGAGGGAAGGGTGGGG - Intronic
1072709374 10:97706086-97706108 GGTTAGGATAGGGAGTTAGGGGG + Intergenic
1072968001 10:99991417-99991439 GGAGAGGAGAGGGGATGTTGTGG - Intronic
1073027858 10:100501347-100501369 GGTAAAGAGAGGGAGTGGTCAGG - Intronic
1073036278 10:100566343-100566365 GGTAGGGAGAGGGAGTAATGGGG + Intergenic
1073122500 10:101131373-101131395 GGGGAGGGGAGGGAGAGAGGGGG - Exonic
1073774698 10:106772492-106772514 GGGGAGGAGAGAGAGAGAGGAGG - Intronic
1073795768 10:106986574-106986596 AGTGAGGAAAGAGAGAGATGGGG - Intronic
1074135777 10:110625509-110625531 GGAGAGGAGAGTGTTTGATGAGG - Intergenic
1074548145 10:114417894-114417916 GGGGAGGAGAGGGAGAGAGGAGG + Intergenic
1074641238 10:115384368-115384390 GGGCAGGTGAGGAAGTGATGGGG - Intronic
1074902719 10:117833028-117833050 GGTGGGGAGGGGGAGGGAGGAGG - Intergenic
1075016166 10:118911367-118911389 GGTGAGGAGAGAGAGGAGTGGGG - Intergenic
1075274101 10:121078103-121078125 GGCGAGGAGAAGGAGAGAAGCGG + Intergenic
1075468828 10:122672704-122672726 GGTCTAGAGAGGGAGGGATGAGG - Intergenic
1075486745 10:122828906-122828928 GGGGAAGAGAAGGAGTGCTGGGG - Intergenic
1075587051 10:123665890-123665912 GGCGGGGAGAGGGAGAGAGGTGG + Intergenic
1075618168 10:123906364-123906386 GGTGAGGAGGAGGAGTGAGCTGG - Intronic
1075727572 10:124618307-124618329 GGTGAGGGGAGGGTGTGCTGGGG + Exonic
1075932919 10:126314340-126314362 GGTGAGGATATGGTGTGAGGGGG + Intronic
1075947808 10:126453430-126453452 GGAGAGGAGAGGGAGTGAAGGGG + Intronic
1076148591 10:128144841-128144863 AGTGGGGAGAGGGAAGGATGAGG + Intergenic
1077115555 11:883066-883088 TGTAAGGAGACAGAGTGATGGGG - Intronic
1077253241 11:1569989-1570011 GCTGAGGGGAGGCAGGGATGAGG - Intronic
1078087505 11:8243044-8243066 GGTGAGGGGAGGAAGGGCTGGGG + Intronic
1078101877 11:8334797-8334819 GGTGGGGAGAGGGGTTGGTGGGG - Intergenic
1078131045 11:8614486-8614508 GGAGAGGAGAGAGAGGGCTGAGG + Exonic
1078539295 11:12200433-12200455 GCAGAGGAGTGGGAGAGATGAGG - Intronic
1078730729 11:13971678-13971700 GGCTAGGAGAGGTGGTGATGGGG - Intronic
1078851491 11:15168077-15168099 GATGAGCAGAGAGAGGGATGAGG - Intronic
1079126102 11:17719627-17719649 GGACAGGAGAGGGAGGGGTGGGG + Exonic
1079143506 11:17830580-17830602 GATGGGGAGAGGGAGAGAGGTGG + Intronic
1079443138 11:20535152-20535174 GGTGACGAGAGAGGGTGATATGG - Intergenic
1080343371 11:31294618-31294640 GGGGAGGGGAGGGAGGGAAGGGG + Intronic
1080406033 11:31980019-31980041 AGTGTGGGGAGGGAGAGATGGGG + Intronic
1080529490 11:33161277-33161299 GGTGAGGAAGGAGAGTGGTGGGG - Exonic
1080591235 11:33724601-33724623 TGTGTGGGGAGGGAGTGTTGGGG + Intronic
1081626440 11:44658807-44658829 GCTGAGCAGAGGGAGGGAGGAGG + Intergenic
1081636288 11:44724458-44724480 GGTGAGGAGTGGGAGTGGAGGGG + Intergenic
1081688697 11:45060386-45060408 GAAGAGGAAAGTGAGTGATGGGG + Intergenic
1081864128 11:46350487-46350509 GGTGGGGAGGGGGCGGGATGGGG - Intronic
1082131370 11:48493447-48493469 AGTGAGGAGAGGGGATGAAGAGG + Intergenic
1082245435 11:49916684-49916706 AGTGAGGAGAGGGGATGAAGAGG - Intergenic
1083134868 11:60662823-60662845 GGGCAGAAGACGGAGTGATGGGG - Intergenic
1083182916 11:60999496-60999518 GGTGAGGACGGGGACTGAAGGGG + Intronic
1083300959 11:61739436-61739458 GGGGTGGAGTGGGAGAGATGGGG - Intronic
1083321089 11:61847371-61847393 GGGTAGGGGAGGGAGTGAGGGGG - Intronic
1083620455 11:64046849-64046871 GATGGGGAGAGGCAGGGATGGGG - Intronic
1083756343 11:64793662-64793684 TGTGGGGAGAGGGAGGGACGAGG - Intronic
1083810980 11:65106857-65106879 GAGGAGAAGAGGCAGTGATGGGG + Intronic
1083958103 11:65997992-65998014 GGTGCAGAGTGGGAGAGATGAGG + Exonic
1084173677 11:67412492-67412514 GGTGAGGAGAGGCAGTGCTTTGG - Intronic
1084372612 11:68753878-68753900 GCAGAGGAGAGAGAGTGAGGGGG - Intergenic
1084429166 11:69101828-69101850 AGTGGGGAGAGGGTGTGATGAGG + Intergenic
1084587674 11:70072559-70072581 GGGGAGGGGAGGGTGTGATGAGG + Intergenic
1084665041 11:70571770-70571792 CCTGAGGAGAGGGAGGGGTGCGG + Intronic
1084793478 11:71489630-71489652 GGACAGGACAGGGAGCGATGGGG + Intronic
1084934562 11:72579947-72579969 GACAAGGAGAGGCAGTGATGAGG + Intronic
1084982156 11:72835415-72835437 GGTGAGGAGAGGTGGTGGTGAGG + Intronic
1084993329 11:72950008-72950030 GGTGAGGAGATGGAGAAATTGGG - Intronic
1085517339 11:77119180-77119202 GGTGGGGAGAGGGAGGGAGCTGG + Intronic
1085530073 11:77187019-77187041 CGTGAGGAGAGGGAGTGAGATGG + Intronic
1085554675 11:77409780-77409802 GGCCAGGAAAGGGAGTGAGGAGG + Intronic
1085590037 11:77751724-77751746 GGAGAGGAGTGGGAGGAATGGGG - Intronic
1086367728 11:86124720-86124742 GGTGGGGAGTAGAAGTGATGAGG + Intergenic
1087006652 11:93478339-93478361 GATGAGCAGAGGGAGTGCTGGGG + Intergenic
1087201269 11:95346854-95346876 GAAGAGGAGAGGGAAGGATGAGG + Intergenic
1087217967 11:95515064-95515086 GGGGAGGAAAGGCAGTGAAGAGG - Intergenic
1087517704 11:99185213-99185235 GGTGAGCATAGGAAGAGATGAGG + Intronic
1087747691 11:101968512-101968534 TGTGAAGAGAGGGAGAGATTGGG + Intronic
1087889316 11:103518614-103518636 GAGGAAGAGAGGGAGAGATGGGG + Intergenic
1088047036 11:105466076-105466098 GAGGAGGAGAGGGAGTGAAAGGG - Intergenic
1088317409 11:108521128-108521150 GGTGGGGAGAGGGATTCAAGAGG - Intronic
1088596413 11:111444256-111444278 GGAGAGGAGAGGGAGGGAAGAGG + Intronic
1088798134 11:113282049-113282071 GGTCAGGAGAGGCAGTGACTTGG + Intergenic
1088993726 11:114977828-114977850 GGAGAGGAGAGGGAGTGAGAGGG + Intergenic
1089194889 11:116688404-116688426 AGTGAGGAGATAGAGTGGTGAGG + Intergenic
1089753478 11:120668579-120668601 TGAGAGGAGAGGGAGACATGGGG - Intronic
1089878045 11:121745005-121745027 TGTGAGGAGACTGAGTCATGTGG + Intergenic
1089967683 11:122666867-122666889 GATGAGGAGAGTGAGAGAGGAGG - Intronic
1090266113 11:125353919-125353941 GGGGTGGAGTGGGAGGGATGGGG + Intronic
1090275175 11:125413909-125413931 GGTGAGGAGAGTCAGTGAGCAGG - Intronic
1090429364 11:126633235-126633257 GGTGAGGGGAGGGAATGTAGAGG + Intronic
1090681271 11:129059866-129059888 TGTGAGAAGAGGTATTGATGTGG - Intronic
1090872643 11:130761968-130761990 GGTGAGCAGTGGGGGTGAGGTGG - Intergenic
1090976727 11:131685657-131685679 GGTAAGGAGAGAGTGTGCTGTGG - Intronic
1091613931 12:2034943-2034965 GGCGAGGCGAGGGGGTGAAGAGG + Intronic
1091885542 12:4014686-4014708 GGAGAGCAGAGTTAGTGATGGGG + Intergenic
1091894179 12:4087586-4087608 GCTGAGAACAGGGAGGGATGGGG + Intergenic
1091967242 12:4754985-4755007 GGAGAGGAGAGGGAGAAGTGAGG - Intronic
1092156685 12:6287075-6287097 GGTGGGGCGTTGGAGTGATGGGG - Intergenic
1092196186 12:6551054-6551076 GGTGGGGACAGGGAGCCATGGGG - Intronic
1092798206 12:12135326-12135348 GGAGAGGAGGGGGAGTGGAGGGG + Intronic
1092894659 12:13000481-13000503 GGTGAGGCGAGGGTGCGAGGCGG + Intergenic
1093016547 12:14161152-14161174 GGTCAGGAGAGGGAGGGGGGAGG + Intergenic
1093587711 12:20860838-20860860 GGTGATGAGAGGGGGTGAAATGG - Intronic
1093791215 12:23252577-23252599 GGTGAGGAAACTGAGTCATGAGG + Intergenic
1094051021 12:26220786-26220808 GCTGAAGAGAGGGAGAGATCAGG - Intronic
1094304456 12:29001896-29001918 GGTGAGGACAGTGTGTGAGGAGG + Intergenic
1094391846 12:29960291-29960313 GGTGATGAGAGGAGGTGGTGGGG - Intergenic
1094682704 12:32679731-32679753 GGACAGGAGAGGGAAGGATGGGG + Intronic
1095251935 12:39989223-39989245 CGTGAGGAGAGTGAGCCATGTGG - Intronic
1095341056 12:41088775-41088797 GGTGAGGGTAGTGAGTGATAGGG + Intergenic
1095409438 12:41906156-41906178 GGTGATGAGTAGGAGTGAGGTGG - Intergenic
1096186863 12:49587248-49587270 GGTGTAGGGAGGGAGAGATGAGG - Intronic
1096264333 12:50111476-50111498 GGAGGGGAGAGAGAGGGATGGGG - Intergenic
1096648548 12:53050830-53050852 AGTTGGGAAAGGGAGTGATGGGG - Intronic
1096761498 12:53845543-53845565 GGGGAGGAGAGGGCAAGATGAGG + Intergenic
1096849503 12:54426633-54426655 CGTGAGGAGAGGGAGGGCAGGGG + Intergenic
1097021709 12:56025532-56025554 GCTGGGGAGAGGCAGTCATGGGG - Intronic
1097235628 12:57537492-57537514 TGTGGGGAGAGGGTGTGAGGGGG + Intronic
1097644909 12:62224690-62224712 GCTGGGGAAAGGGAGGGATGGGG + Intronic
1098094893 12:66944731-66944753 GGTGAGGAAAGGGTGTGAAATGG - Intergenic
1098391174 12:69971486-69971508 GGTGGTGAGAGGGACTGGTGGGG - Intergenic
1098435238 12:70461509-70461531 GGGGAAGAGAGGGAGTGGGGAGG - Intergenic
1098828438 12:75329786-75329808 TGGGAGCAGGGGGAGTGATGGGG - Intronic
1099254478 12:80298607-80298629 GGTGAAGAGAGGGAGTAGGGTGG + Intronic
1100054861 12:90496952-90496974 AGAGAGGAGAGGGAGGGAAGGGG + Intergenic
1100217637 12:92468790-92468812 GGGGAGGATAGGGAGAGATTGGG + Intergenic
1100361608 12:93884685-93884707 GGTGAGGAGAGGAATTTATTGGG - Intronic
1100418723 12:94407692-94407714 GGATAGGAGAGGGAGAGATGGGG - Intronic
1100522309 12:95387018-95387040 GCCAAGGAGAGGGAGCGATGCGG - Intergenic
1101731017 12:107426773-107426795 GGAGGGGAGAGGCAGAGATGTGG - Intronic
1101963223 12:109265306-109265328 GGTGAGCACAGGGGGTGCTGGGG + Intronic
1101990046 12:109477159-109477181 CGAGAGGAGGGGGTGTGATGAGG - Intronic
1102138963 12:110598795-110598817 GGTGGGGAGAGGGCCAGATGCGG + Intergenic
1102177429 12:110886538-110886560 GGTCAGGGGAGGGAGGAATGAGG + Intronic
1102484827 12:113248478-113248500 TTTGAGGGGACGGAGTGATGTGG + Intronic
1102812373 12:115835487-115835509 GGGATGTAGAGGGAGTGATGAGG - Intergenic
1103047400 12:117748859-117748881 GATGAGGAGATGGAGAGGTGAGG + Intronic
1103064780 12:117888412-117888434 GATTAGGAGTGGGAGTGATGGGG + Intronic
1103201842 12:119094205-119094227 CCTGTGGAGAGGGAGTGGTGGGG + Intronic
1103340778 12:120220116-120220138 GGAGAGGAGAGAGAGAGATGAGG + Intronic
1103937838 12:124485954-124485976 GGTGGGGAGTGGGAGGGAGGTGG - Intronic
1103984816 12:124760247-124760269 GGGGAGGGGAGGAAGTGAGGAGG + Intergenic
1104215381 12:126728392-126728414 GGTGAGGAGACAGAGTGACGGGG + Intergenic
1104639633 12:130459151-130459173 GGTTAGGGGAGGGTGTGACGAGG + Intronic
1104803286 12:131569348-131569370 CCTGAGGAGAGGGAGGGAGGAGG - Intergenic
1104968581 12:132520955-132520977 GGTGGGGAAATGGAGTGTTGTGG + Intronic
1105007278 12:132729404-132729426 GGGGAGGTGAGGGGGAGATGAGG + Intronic
1105007348 12:132729552-132729574 GGTGAGGGAAGGGGGAGATGAGG + Intronic
1105432847 13:20352680-20352702 GGGGAGGAGAGGGAGTAAAGAGG - Intergenic
1105683299 13:22752059-22752081 GGTGGGGAAAGGGAGTGAGGCGG - Intergenic
1106937085 13:34734856-34734878 GGTGGGGAGAGGGAGCAAGGGGG + Intergenic
1108260304 13:48649074-48649096 AGTGGGGAGAGGGTGTCATGTGG + Intergenic
1108299782 13:49061722-49061744 GGAGAGGAGAGGGAGAGGGGAGG - Intronic
1108299787 13:49061733-49061755 GGAGAGGAGAGGGAGAGGAGAGG - Intronic
1108299790 13:49061744-49061766 GGAGAGGAGAGGGAGAGGAGAGG - Intronic
1108299794 13:49061760-49061782 GGAGAGGAGAGGGAGAGGAGAGG - Intronic
1108299798 13:49061776-49061798 GGAGAGGAGAGGGAGAGGAGAGG - Intronic
1108378775 13:49837349-49837371 GCTGAGGGGAGGGATGGATGGGG + Intergenic
1108454399 13:50598332-50598354 GGAGATGAGAGAGAGAGATGGGG - Intronic
1109150039 13:58835732-58835754 GGGGAGCAGAGGGAGGGAGGGGG - Intergenic
1109655035 13:65378890-65378912 GGAGAGGAGAGAGAAAGATGAGG + Intergenic
1110521582 13:76485419-76485441 CTTGAGGAGAGGGAGAGATATGG - Intergenic
1111613010 13:90628700-90628722 GGTGGGGAGAGTGAGAGAAGAGG - Intergenic
1111710401 13:91805122-91805144 GATGGAGAGAGGGAGTGGTGTGG + Intronic
1111886066 13:94022682-94022704 GGTGAGAAAAGGGATTGATGTGG - Intronic
1112126781 13:96477115-96477137 GATGGGGAGAGGGAGGAATGGGG - Intronic
1112169223 13:96952319-96952341 GGGGAGTAGAGGCAGGGATGTGG - Intergenic
1112177966 13:97047295-97047317 GATGAGGAGAAGGAATGAGGAGG - Intergenic
1112462292 13:99613593-99613615 TGGGAGAAGAGGGAGCGATGGGG + Intronic
1112618935 13:101035075-101035097 GGAGAGGAGAGGGAAGGGTGGGG - Intergenic
1113267311 13:108633952-108633974 GGTGAGGGCAAGGAGTGAAGTGG - Intronic
1114405697 14:22453938-22453960 GAGGAGGGGAGGGAGTGATGGGG + Intergenic
1114514433 14:23288719-23288741 TGTAAGGAGGGGGAGTGGTGAGG - Intronic
1114712796 14:24795218-24795240 GGAAAGGAAAGGGAGTGTTGAGG + Intergenic
1115773715 14:36692697-36692719 AGTGAGGAGTGGGGGTGATGAGG + Intronic
1116700377 14:48233939-48233961 GGTGAGCAGAGGGGAAGATGAGG - Intergenic
1116747293 14:48836887-48836909 GGGGAGGGGAGGGAGTGAAGAGG - Intergenic
1116808303 14:49514789-49514811 GGTGAGGAGAAGCAGTGCGGAGG + Intergenic
1117222739 14:53621786-53621808 GGTGAGGGGAGTGGGAGATGAGG + Intergenic
1117287625 14:54302163-54302185 CTTGAGGAAAGGGAGCGATGGGG + Intergenic
1117694376 14:58344108-58344130 TGTGAGATGAGGGGGTGATGAGG + Intronic
1117981656 14:61347926-61347948 GGTGAGGAGAGGAAGTTAATAGG + Intronic
1118764176 14:68899122-68899144 GGTGAGGTGTGGGTGTGGTGTGG - Intronic
1118837663 14:69488028-69488050 GGGGAGGAGAAGGGGTGAGGAGG - Intronic
1118845253 14:69543233-69543255 GGTGAGGAGAGGTGGAGAGGCGG - Intergenic
1118857726 14:69637152-69637174 GGTGGGTACAGGGAGTGGTGGGG - Intronic
1119286289 14:73457999-73458021 GGTGAGGAGAGAGCGGGGTGGGG - Intronic
1119549135 14:75495654-75495676 GGTGAGGGGAGGAGGTAATGAGG - Intergenic
1119574163 14:75703136-75703158 GGTGAGGAGAGGGAATGCTGAGG + Intronic
1119896770 14:78226381-78226403 GGTGACAAGAGGGAGTTAAGCGG - Intergenic
1120138871 14:80904333-80904355 GGCGGGGAGAGGGGGTGAAGAGG + Intronic
1120623683 14:86797440-86797462 GGTGAGGAGAAGTAGTAATGAGG - Intergenic
1121292028 14:92783705-92783727 GCTGAGGATAGGGAGAGAGGGGG + Intergenic
1121641171 14:95485809-95485831 AGTGAGGAGCAGGAGAGATGAGG - Intergenic
1121829370 14:97036351-97036373 GGTCAGGAGACGGCCTGATGGGG - Intergenic
1122544036 14:102512568-102512590 GCTGAGGTGAGGCAGTGCTGTGG - Intergenic
1122550381 14:102545903-102545925 GGTGAGGAGGGGGAGGGAGGTGG + Intergenic
1122604050 14:102936588-102936610 GCTGAGGGGAGGGAGGGACGGGG + Intronic
1122738467 14:103857079-103857101 AGGCAGGAGAGGGAGCGATGCGG - Intergenic
1122886782 14:104713774-104713796 AGTGAGTGGAGGGAGGGATGAGG - Intronic
1122895143 14:104753080-104753102 TTTGAGGAGAGGGAGCGACGCGG - Exonic
1202860401 14_GL000225v1_random:78438-78460 GGTGTGGGGAGGGGGTGATCAGG + Intergenic
1123472866 15:20567956-20567978 GGTGTTCAGAGGGAGGGATGTGG + Intergenic
1123645139 15:22432397-22432419 GGTGTTCAGAGGGAGGGATGTGG - Intergenic
1123733171 15:23162947-23162969 GGTGTTCAGAGGGAGGGATGTGG + Intergenic
1123751301 15:23360323-23360345 GGTGTTCAGAGGGAGGGATGTGG + Intronic
1124100044 15:26684366-26684388 GGTGAGGAGAACAAATGATGGGG + Intronic
1124219513 15:27837337-27837359 TGTGAGCAGATGCAGTGATGTGG - Intronic
1124299025 15:28527372-28527394 GGTGTTCAGAGGGAGGGATGTGG - Intronic
1125267577 15:37900844-37900866 GATGAGGTGAGGGAGAGAAGGGG - Intergenic
1125339504 15:38661038-38661060 GGGGAGGGGAGGGAGGGAAGGGG - Intergenic
1125430543 15:39589081-39589103 GATGAGGTGAGGAACTGATGGGG + Exonic
1125458817 15:39888728-39888750 GGGTAGGAAAGGGATTGATGAGG - Intronic
1125679930 15:41524140-41524162 GGTGAGGAGAGTGAGCAGTGAGG + Exonic
1126154225 15:45550209-45550231 GGTGTGGAGAGTGGGTGTTGTGG + Intergenic
1126310045 15:47305267-47305289 GGTGAGTAGATGGAGTGGTGTGG + Intronic
1126778507 15:52119303-52119325 GGTGATGAGAGGGAGGGAGGAGG + Exonic
1127144189 15:56007791-56007813 GCTGAGGAGAGCGAATCATGAGG + Intergenic
1127759017 15:62120071-62120093 GGAGAGGAGAGAGAAAGATGAGG - Intergenic
1127793576 15:62419648-62419670 GGTGGGGGGAGGGGTTGATGGGG + Intronic
1127900681 15:63338797-63338819 GGTGAGGAGAGGCAGTGCTGGGG - Exonic
1127920960 15:63493780-63493802 GGTGATGGGAGGCAGAGATGAGG + Intergenic
1127995156 15:64149661-64149683 GGAGAGGAGAGGAAATGAGGTGG + Intergenic
1128492474 15:68162684-68162706 GGTGAGGAGAAGGGCTGATATGG + Intronic
1128519231 15:68364659-68364681 GGTCAGGAGAGGCAGGGGTGGGG - Intronic
1128702921 15:69817131-69817153 GGAGAGGGGAGGGAGGGAGGGGG + Intergenic
1128862614 15:71086566-71086588 GGTGAGCACAGGAAGTGGTGAGG + Intergenic
1129385910 15:75196012-75196034 GATGGGGAGAGGAGGTGATGAGG + Intronic
1129386524 15:75199304-75199326 GGAGGGGAGAGGGAGCAATGAGG + Intronic
1129589809 15:76905165-76905187 GGTGAGGGGAGGGGGTGAAAGGG + Intronic
1129686386 15:77688444-77688466 GATGGGGAGAGGGAGGGAAGAGG + Intronic
1129747086 15:78030280-78030302 GGTGAGGATACGGAGAAATGGGG + Intronic
1129749337 15:78049632-78049654 GGTGAATACAGGGATTGATGTGG - Intronic
1129952780 15:79606905-79606927 GGTGTGGAGAGGAAGTTGTGGGG - Intergenic
1130023100 15:80247501-80247523 GGTGGGGAGTGGGAGTGGTAAGG + Intergenic
1130393373 15:83479396-83479418 GGTGAGTAGGGAGAGTGACGGGG + Intronic
1130555275 15:84918266-84918288 GCTGAGGAGAGGGGGTGGTCTGG + Intronic
1131019612 15:89087511-89087533 GATGAGGTGAGTGGGTGATGGGG + Intronic
1131229191 15:90647534-90647556 GGAGAGGAGAAGGGGTGAGGAGG - Intergenic
1131229205 15:90647584-90647606 GGTGTGAAGGGGGAGGGATGTGG - Intergenic
1131229233 15:90647654-90647676 GGTGAGGAGGAGGAGGGGTGAGG - Intergenic
1131229245 15:90647686-90647708 GGTGAGGAGAAGGAGGGGTGTGG - Intergenic
1131506353 15:93023177-93023199 GCTGGGGAGAGGGAATAATGGGG - Intronic
1131541585 15:93279573-93279595 GGTGAGGGGTGGGGGTGAGGGGG - Intergenic
1131771951 15:95747552-95747574 GGTGGGGAGAGGGAAGGATGGGG - Intergenic
1132298914 15:100764360-100764382 GATGAGGAAATGGAGGGATGGGG + Intergenic
1132567929 16:631675-631697 TGGGAGGAGAGGCAGTGACGGGG - Intronic
1132567990 16:631897-631919 TGGAAGGAGAGGCAGTGATGGGG - Intronic
1132568018 16:632018-632040 TGGGAGGAGAGGCAGTGAAGGGG - Intronic
1132703638 16:1231982-1232004 GGTGAGGGGATGGGGTGACGGGG + Intergenic
1132704871 16:1239379-1239401 GGTGAGGGGATGGGGTGACGGGG - Intergenic
1132707880 16:1254413-1254435 GGTGAGGGGATGGGGTGACGGGG - Intergenic
1132734190 16:1377536-1377558 GGTGGGCAGAGTGAGTGGTGAGG - Intronic
1133360263 16:5168526-5168548 GGTGAGTAGAGGTTGGGATGGGG - Intergenic
1134107470 16:11494415-11494437 GGTGAGGAGACGGGTTGAAGTGG + Intronic
1134270101 16:12725563-12725585 GGAGAGGGGAGGGAGGAATGAGG + Intronic
1134310639 16:13072404-13072426 GGCCAGGGGAGGAAGTGATGGGG + Intronic
1134419309 16:14071281-14071303 GGGGAGGAGGGGGAGTGCCGAGG + Intergenic
1134641477 16:15832447-15832469 GGAGACGACAGGGAGTGGTGAGG + Intronic
1134817007 16:17214077-17214099 AGTGAGGAGAGGCTGTTATGGGG - Intronic
1135197938 16:20409869-20409891 GGTGAGGGGCGGGAGAGGTGAGG + Intronic
1135197944 16:20409885-20409907 GGTGAGGGGCGGGAGAGGTGAGG + Intronic
1135197950 16:20409901-20409923 GGTGAGGGGCGGGAGAGGTGAGG + Intronic
1135199176 16:20421857-20421879 GGTGAGGGGAGAGGGTAATGGGG - Intronic
1135219521 16:20601787-20601809 GGTGAGGGGAGAGGGTAATGGGG + Intergenic
1135275076 16:21105218-21105240 GTTGATGGGAGGGAGAGATGGGG - Intronic
1135649950 16:24197374-24197396 GGTGAGGGGGGAGAGTGATTTGG + Intronic
1136047249 16:27624330-27624352 GGGGAGTACAGGGTGTGATGAGG - Intronic
1136248576 16:28989285-28989307 GCTGTGGAGAGGGAGGGAGGAGG - Intronic
1137270594 16:46900223-46900245 AGGGAGGAAAGGGGGTGATGAGG + Intronic
1137377532 16:47965843-47965865 GGAGAGGAGCTGTAGTGATGGGG + Intergenic
1137529622 16:49270208-49270230 CCTGAGGAGAGGGACTAATGAGG + Intergenic
1137729642 16:50680290-50680312 GGTGAGGAGAGGGAAGGAAAGGG - Intronic
1138026070 16:53523454-53523476 GGTGAGGGAAGGGAGTGGGGAGG - Intergenic
1138124599 16:54428491-54428513 GAGGAGGAGAGTGAGTGAAGAGG + Intergenic
1138482886 16:57315684-57315706 GGTGAGAAGAGGAAGTTAGGGGG - Intergenic
1138607126 16:58096660-58096682 GGTGAGGTTGGGGAGGGATGCGG - Intergenic
1138802799 16:60055219-60055241 AGAGAGGAGAGGGAGAGGTGAGG - Intergenic
1139136069 16:64206201-64206223 GGTGGGGGGTGGGAGTGGTGGGG + Intergenic
1139137472 16:64222362-64222384 GGTGAGGAGAGGAAAAGAAGTGG + Intergenic
1140001725 16:71031555-71031577 GGAAAGGAGAGGGACTGAGGTGG + Intronic
1140588848 16:76327196-76327218 AGACAGGAGAGGCAGTGATGGGG - Intronic
1140644265 16:77012385-77012407 GGTGAGGAAAGGGAGTTGTTAGG - Intergenic
1141088012 16:81110598-81110620 GGTGCACTGAGGGAGTGATGGGG - Intergenic
1141337847 16:83174026-83174048 GGAAAGGAGAGGGACTTATGGGG + Intronic
1141347286 16:83258897-83258919 TGGAAGGAGAGGCAGTGATGTGG - Intronic
1141570647 16:84931642-84931664 GGTGAGGAGCAGGAGAGAGGAGG - Intergenic
1141598382 16:85111118-85111140 GGAAAGGAGAGGGCGTGAGGAGG - Intronic
1141667735 16:85474585-85474607 GGGGAGGAGACAGGGTGATGGGG - Intergenic
1141708041 16:85680135-85680157 GGTGTGGTGCGGGAGAGATGTGG - Intronic
1141713929 16:85716330-85716352 GGGGAGAAGAGGGAGGGAGGAGG + Intronic
1141766705 16:86063807-86063829 GGTGGGGAGGGGAAGAGATGGGG + Intergenic
1141775703 16:86121564-86121586 GGTGAGGAGGGGCAGGGAGGAGG - Intergenic
1141861244 16:86717979-86718001 GAAGAAGAGAGGCAGTGATGAGG + Intergenic
1142018465 16:87765441-87765463 GGTGAGAAGAGGGAGGGGTTTGG - Intronic
1142044277 16:87914984-87915006 GGTGAGGGGTGTGAGCGATGGGG + Intronic
1142082149 16:88155131-88155153 GGTGAGGAGATGCAGAGCTGGGG + Intergenic
1142123861 16:88400579-88400601 GCTGAGAGGAGGGACTGATGTGG - Intergenic
1142307571 16:89294108-89294130 GGTGGGGAGCGGGAGGGATGTGG - Intronic
1142596652 17:1032987-1033009 GGTGAGGACAGGGGGTCAGGAGG + Intronic
1142726183 17:1816131-1816153 GATGTGGAGAGGGAGGAATGAGG - Intronic
1142880664 17:2880301-2880323 GGTGTGGAGAGGAAGTGAGAGGG + Intronic
1142891783 17:2948544-2948566 GGTGATGAGATGGAGAGAAGGGG + Intronic
1142891814 17:2948682-2948704 GGTGATGAGATGGAGAGAAGGGG + Intronic
1143123012 17:4621080-4621102 ACTGAGCAGAGGAAGTGATGGGG - Intergenic
1143181922 17:4988736-4988758 GGTGGAGTGAGGGAGTGATGTGG - Intronic
1143409901 17:6702533-6702555 AGTGAGCAAAGGGAGTGCTGGGG + Intronic
1143619773 17:8074137-8074159 GGTGATGGGAGGGAGTGGAGAGG - Intronic
1143638713 17:8182562-8182584 AGTGGGGAGAGGGAAGGATGGGG + Intergenic
1144769005 17:17748825-17748847 TGTGAGTCAAGGGAGTGATGTGG + Intronic
1144776020 17:17784985-17785007 GGTGGGGAGAGGAGGTGATCAGG - Intronic
1144835529 17:18154766-18154788 GGAGAGGAGGGGTACTGATGGGG + Intronic
1144892375 17:18501360-18501382 GGGGAGGAAAGGGAGGGATCTGG - Intergenic
1145016550 17:19402573-19402595 GGGGAGGAGAGAGAAGGATGAGG + Intergenic
1145139839 17:20442928-20442950 GGGGAGGAAAGGGAGGGATCTGG + Intergenic
1145834971 17:27947914-27947936 GCTGGGGAGAGAGAGTAATGGGG + Intergenic
1145891967 17:28423428-28423450 GGTGAGGGGAGGCAGAGAAGAGG - Intergenic
1145976816 17:28988643-28988665 GGTGGTGAGAGGCTGTGATGGGG - Intronic
1146297445 17:31660896-31660918 TGTGTGGAGAGGAGGTGATGGGG + Intergenic
1146386836 17:32384506-32384528 GATGAGGAAAAGCAGTGATGTGG - Intergenic
1147059597 17:37864647-37864669 GGTGAGCAGGGGGAGGGATTTGG - Intergenic
1147156680 17:38547690-38547712 GGTGAGGAGAGGAAGCTGTGGGG + Intronic
1147164201 17:38584847-38584869 GGAGAGGAGAGGGAGGGAGAAGG + Intronic
1147306291 17:39566696-39566718 GGTGGGGAGAGGGAGTAATGGGG - Intergenic
1147318419 17:39632091-39632113 GGTGAGTAGAGGCAGGGAAGAGG + Intronic
1147392863 17:40121416-40121438 GGGGAGGAGAGGGGGTGGAGGGG + Intergenic
1147680443 17:42240481-42240503 GCTGAGGGGAGGGAGAAATGGGG + Intronic
1148128548 17:45248863-45248885 AGAGAGGAGAGGGGGTGCTGTGG + Intergenic
1148408869 17:47447137-47447159 GGTGAGCAGGGGGAGGGATTTGG - Intergenic
1148457831 17:47820455-47820477 GGTGAGCAGAGGGTATGTTGGGG - Intronic
1148487646 17:48001294-48001316 GGTCAGGAGAGGGAGTGTGCTGG - Intergenic
1148551130 17:48551326-48551348 GGTGGGGTGGGGGAGTGAGGAGG - Intronic
1148852891 17:50563221-50563243 GATGAGAAGAGGATGTGATGAGG - Intronic
1148957512 17:51365951-51365973 GGTGGGGAGAGGGGCTGTTGGGG - Intergenic
1149119263 17:53141807-53141829 AGTGAGTAGAGAGGGTGATGTGG - Intergenic
1149626213 17:58082853-58082875 GGTGAGGGGAGGGAGTCCTGGGG + Intergenic
1149866469 17:60153898-60153920 GGGAAGGAGAGGCAGTGATCAGG + Intronic
1150202515 17:63372042-63372064 GGGGAGGAGGGAGAGTGCTGGGG + Intronic
1150410478 17:64937260-64937282 GGTGGGGAGAAGGAGGGAAGGGG + Intergenic
1150486255 17:65546034-65546056 GGGGGGGAGAGGGAGAGAGGGGG - Intronic
1150537792 17:66061781-66061803 GGGGAGGAGAGGGAGGAAAGGGG + Intronic
1150847214 17:68671536-68671558 GGTGAGGGGTGGCAGGGATGGGG - Intergenic
1151247253 17:72804395-72804417 GGTGGGGAGTGGGAGGGAAGAGG - Intronic
1151319091 17:73342157-73342179 GGTGAGGAGAGGGAGGGGAGGGG - Intronic
1151329874 17:73400436-73400458 GGTGAAGGGAGGGACTGGTGGGG + Intronic
1151773065 17:76177531-76177553 GGAGAGGCGAGGGGGTGCTGAGG + Intronic
1152073985 17:78147567-78147589 GGGGAGGGGAGGGAAGGATGGGG - Intronic
1152410555 17:80120549-80120571 GGTGAGGAGGGGAGGTGAAGTGG - Intergenic
1152410602 17:80120671-80120693 GGAGGGGAGAGGGGGTGAGGTGG - Intergenic
1152466143 17:80467558-80467580 GGTGAGGAGAGGCTGGCATGAGG - Exonic
1152853356 17:82649809-82649831 AGTGAGGAGGGGGAGTGGAGAGG - Intergenic
1152979431 18:261955-261977 GGTAAGGAGAGAGATTGGTGTGG - Intronic
1153404432 18:4720419-4720441 GGATAGATGAGGGAGTGATGGGG + Intergenic
1154041434 18:10859868-10859890 GGAGAGGGGAGGGAGTGGTGGGG + Intronic
1155066525 18:22273741-22273763 GGGGAGGAGGGGGAGGGAGGAGG - Intergenic
1155182562 18:23360610-23360632 GGTGTGGAGAGGGAGTGACTAGG + Intronic
1155242714 18:23878929-23878951 AATGAGAAGAGGGAGAGATGGGG - Intronic
1155364166 18:25033783-25033805 GGGGGGGAGAGGGAGAGAGGGGG + Intergenic
1155866021 18:30965644-30965666 GGCAAAGAGATGGAGTGATGAGG - Intergenic
1155879143 18:31122485-31122507 GGTGAGGAGTAGGAATGATATGG - Intergenic
1156962306 18:43047426-43047448 TGAGAGTAGAGGGAGTGATTTGG - Intronic
1157041210 18:44041732-44041754 GGTTGGGCGAGGGAGTGAGGGGG - Intergenic
1157239675 18:45997633-45997655 GGGGAGGGGAGGGAGGGAAGGGG - Intronic
1157378889 18:47192842-47192864 GCTGAGAAGAGGGAGAGATCGGG + Intergenic
1157502819 18:48203000-48203022 GGTGAGAAGAGGGGGTCTTGAGG - Intronic
1157528635 18:48404401-48404423 GGTGGGCACAGGGAGTGAAGGGG + Intronic
1157580710 18:48772424-48772446 GGTGATGAGAGGGTTTGGTGGGG - Intronic
1157814006 18:50717936-50717958 GATGGGGAGAGGGATTGCTGTGG + Intronic
1158437480 18:57443514-57443536 GGTGATAAGAGGGGGTGATAGGG - Intronic
1158628658 18:59093231-59093253 GATGAGGAGAGGGACTTAGGAGG - Intergenic
1158888475 18:61851193-61851215 AGTGATGGGAGGGAGGGATGGGG - Intronic
1159301001 18:66567365-66567387 GAGGAGGAGAGGGAGGGATGAGG + Intronic
1159306277 18:66647025-66647047 GGAGAGCAGAGGGTGTGCTGAGG - Intergenic
1160184634 18:76665961-76665983 GGTGGGGATAGGGAGGGAAGTGG + Intergenic
1160517992 18:79488965-79488987 GGTGAGCAGCGGCAGTGCTGGGG + Intronic
1160676390 19:393605-393627 GGTGGGGATAGGTGGTGATGGGG + Intergenic
1160676435 19:393782-393804 GGTGGGGATAGGTGGTGATGGGG + Intergenic
1160676469 19:393937-393959 GGTGGGGATAGGTGGTGATGGGG + Intergenic
1161427156 19:4210027-4210049 GGAGGGGAGAGAGAGTGAAGGGG - Intronic
1161509242 19:4661600-4661622 GGTGTGAAGAGAGTGTGATGGGG + Intronic
1162298237 19:9828064-9828086 GGTGAGGCCAGGGAGTTTTGTGG + Exonic
1162520691 19:11177871-11177893 GGTGAAGAGAGGGTGTGGGGAGG - Intronic
1162578530 19:11513594-11513616 GGGGAGGAGAGGGAGGGAGGGGG + Intronic
1162829054 19:13272748-13272770 GGAGGGGAGAGGGAGGGAAGGGG + Intronic
1162829209 19:13274075-13274097 TTTGAGGAGAGGGAAGGATGTGG + Intronic
1163207409 19:15813763-15813785 GGTGGGGAGAGAGAGGGTTGGGG + Intergenic
1163207415 19:15813811-15813833 GGTGGGGAGAGAGAGAGAAGTGG + Intergenic
1163390447 19:17027098-17027120 GGAGAGGAGAGGGAGAGTGGGGG - Intergenic
1164394425 19:27850913-27850935 GGTGGGGGAAGGGAGCGATGGGG + Intergenic
1164834550 19:31349267-31349289 GCTGAGGACAGGGAGGGAGGGGG + Exonic
1164971917 19:32539889-32539911 AGAGAGGAGAGAGAGAGATGCGG + Intergenic
1165295931 19:34925796-34925818 GGTGGGGAAGGGGAGTGCTGGGG - Intergenic
1165829649 19:38724131-38724153 GGGGAGGAGCTGGAGTGAGGGGG - Intronic
1165862877 19:38918378-38918400 GGGGAGGAGCAGGAGTGATGTGG - Intronic
1165958924 19:39518713-39518735 GGGGAGGAGATGGGGTCATGGGG - Intronic
1165988628 19:39792567-39792589 GGTGGGGAGCGGGGGTGTTGGGG + Intergenic
1165994510 19:39834193-39834215 GGAGCGGAGAGGGAGGGATGGGG - Intronic
1166043899 19:40218296-40218318 GGTGGGGAGAGGGCGGGAGGCGG + Exonic
1166159540 19:40941527-40941549 GGTGAGAAGAGGGAGGGAAAAGG + Intergenic
1166168474 19:41009450-41009472 GGTGAGAAGAGGGAGGGAAAAGG + Intronic
1166642665 19:44507290-44507312 GGTGAAGAGAGGGACTTAGGTGG + Intronic
1166695385 19:44848797-44848819 GGAGAGGAGAGAGAGAGATGGGG - Intronic
1166829297 19:45629065-45629087 GGTGAGGATATGGAGATATGGGG - Intronic
1166948073 19:46409223-46409245 GGGGAGGGGAGGGAGGGAAGGGG + Intergenic
1167179972 19:47895569-47895591 GGTGGAGGGAGGGAGTGAGGTGG + Intergenic
1167566570 19:50261127-50261149 ATTGGGGAGAGGGGGTGATGGGG - Intronic
1167566585 19:50261161-50261183 GGTGAGGAGGGGCAGTGATTGGG - Intronic
1167566660 19:50261365-50261387 GGCGAGGAGGGGGAGTGATAGGG - Intronic
1167566673 19:50261396-50261418 GGTGAGGAGGGGGAGTAATGGGG - Intronic
1167568925 19:50274963-50274985 GCTGGGGAGAAGGAGGGATGGGG - Intronic
1167574102 19:50309556-50309578 GGGGAGGAGAGAGAGAGATGAGG - Intronic
1167602008 19:50459834-50459856 GGTGAGGAGAGGAGGTGAGGAGG + Intronic
1167608192 19:50492870-50492892 GGTGAGGAGGAGGAGGGAGGAGG + Intergenic
1167677719 19:50897860-50897882 TGGAATGAGAGGGAGTGATGGGG + Intergenic
1168099563 19:54133993-54134015 GGTGGAGAGAGGGAGGGAGGGGG - Intergenic
1168099580 19:54134039-54134061 GGTGGAGAGAGGGAGGGAGGGGG - Intergenic
1168108956 19:54181222-54181244 GGTGGGAAGAGGGAGTGAGAGGG + Intronic
1168162723 19:54522460-54522482 GTTGCGGAAAGGGAGTCATGAGG - Intergenic
1168173944 19:54609283-54609305 GGTGGGGCGAGGGAGTGGGGCGG - Intronic
1168304622 19:55428841-55428863 GGTGGAGAGAGGAAGTGATGAGG + Exonic
1168307554 19:55443477-55443499 GGGGAGGAGAGGGAGGGAGGAGG + Intergenic
1168483824 19:56743736-56743758 GGTGAGGGGAGGGAGTTTAGAGG - Intergenic
1168517221 19:57017952-57017974 GGGGATGAGAGGGAGGGAAGTGG - Intergenic
1168517239 19:57018018-57018040 GGGGATGAGAGGGAGGGAAGAGG - Intergenic
1168577928 19:57528501-57528523 GATGAAGAGAGGGAGGGCTGAGG + Intronic
924992232 2:322068-322090 GGGGAGGAGCAGGAGGGATGTGG + Intergenic
925150707 2:1612846-1612868 GCTCAGGAGAGGCGGTGATGAGG + Intergenic
925281973 2:2691085-2691107 AGTGAGGAGAGGGAGTGAGAGGG - Intergenic
925781471 2:7386008-7386030 AGTGAGGAGAGAGAGAGAAGGGG + Intergenic
926424570 2:12729177-12729199 GATGAGGAAAGGGAGTGCTATGG - Intronic
927193811 2:20534347-20534369 GGTGAGGAGAGGGAGGCAGCTGG + Intergenic
927295930 2:21453030-21453052 GGGGAGGTGAGGGATTGAGGTGG + Intergenic
927683394 2:25154786-25154808 GGGGAGCAGGGGGAGTGCTGGGG - Exonic
928353188 2:30582179-30582201 GGTGAGGAGAGGGGGAAAGGGGG - Intronic
928400350 2:30973314-30973336 GGTGAGGAAAGGAAGGGATGAGG - Intronic
928402263 2:30987701-30987723 GGGGAGGAGGGGGAGGGAGGAGG - Intronic
928536290 2:32244834-32244856 GAGGAGGAGAGGGAGAGAGGGGG + Intronic
928796924 2:35034194-35034216 GGTGATGAGAAGGAGAGAAGAGG - Intergenic
928858460 2:35827945-35827967 GGGGAGGTGGGGGAGGGATGGGG + Intergenic
929055577 2:37873492-37873514 GGTCAGGAGAGGGAGCAATCAGG + Intergenic
929281035 2:40079120-40079142 GTAGAGGAGAGGCAGAGATGTGG + Intergenic
929304993 2:40351313-40351335 GGTGAGGAGTGGAAGAGGTGAGG - Intronic
929431167 2:41887853-41887875 GATGAGGGGAGGGAGGGGTGGGG + Intergenic
930506162 2:52285028-52285050 GGGCAGGAGAGAGAGTGAAGTGG + Intergenic
930583144 2:53236656-53236678 CCTGAGGAGAGGGAGAGAGGTGG - Intergenic
930639530 2:53840609-53840631 GGGGAGGGGAGGGAGTGGAGGGG + Intergenic
930886515 2:56332688-56332710 GGAGAGAAGAGGGAGAGAGGGGG - Intronic
931426275 2:62174778-62174800 TGTGAGGGGTGAGAGTGATGGGG - Intergenic
931458476 2:62431101-62431123 GGAGAGGAGAGGGGCTTATGTGG + Intergenic
931617592 2:64175981-64176003 GGGGAGGAGAGGGTCTGAAGGGG + Intergenic
932002009 2:67893741-67893763 GGTTAGGGCAGGGAGTGAAGGGG + Intergenic
932114980 2:69037917-69037939 GGTGAGGAGCTGGGGAGATGGGG - Intronic
932558486 2:72846405-72846427 GCTGAGGGGAGGGAGGAATGAGG + Intergenic
932685637 2:73866965-73866987 AGTGATGAGATAGAGTGATGGGG - Exonic
932703022 2:74003659-74003681 GGAGAGGAGAGGAGGTGGTGGGG + Intronic
932862216 2:75305926-75305948 GGTTGGGGGAGGGAGGGATGAGG - Intergenic
933603031 2:84353066-84353088 GGAGAGGAGAGAAAGTGAGGAGG + Intergenic
934094374 2:88585496-88585518 AGTGAAAAGAGGGAGTGCTGAGG + Intronic
934658986 2:96133164-96133186 GGTGAGGAGAGGAGGTTTTGCGG - Intronic
934741991 2:96730971-96730993 GGTTAAGAGAGGGGATGATGAGG - Intronic
935877350 2:107524616-107524638 AGAGGGGAGAGGGAGCGATGGGG - Intergenic
937197989 2:120177169-120177191 GGTGGGGAGAGGCAGGGCTGAGG + Exonic
937293250 2:120794572-120794594 GGTGAGGCGTGCGAGTGCTGGGG + Intronic
937400188 2:121575743-121575765 GGTGAGGAGAGGCAGAAAGGAGG + Intronic
937504558 2:122522477-122522499 AGTTAGGAGACTGAGTGATGTGG - Intergenic
937534046 2:122864226-122864248 GGTGAGCACGGGGAGTGTTGGGG + Intergenic
937696453 2:124813635-124813657 GCTGAGGAGTTGGAGTGGTGGGG - Intronic
938080825 2:128369210-128369232 GGGGAGGAGAGAGATGGATGGGG + Intergenic
938219105 2:129550477-129550499 GGTGAGGGGAGGGACAGACGAGG - Intergenic
938743136 2:134251888-134251910 GGGGAGGAGAGAGGGGGATGAGG - Intronic
939019052 2:136937285-136937307 GGTGAGGGAAGGAGGTGATGTGG - Intronic
939162647 2:138608021-138608043 TGGGAGGAGAAGTAGTGATGGGG + Intergenic
939390562 2:141563871-141563893 GGAGAGGAGAGGGAGGGAGACGG + Intronic
939392369 2:141584888-141584910 GATGTGGGGAGGGAGAGATGCGG + Intronic
939823737 2:146988465-146988487 GGTGAGGAAAGGGAGGGTTAGGG + Intergenic
940310262 2:152271442-152271464 GCTGAGGAGAGGGAGAATTGAGG + Intergenic
940790121 2:158023188-158023210 GAGGAGGGGAGGGTGTGATGAGG + Intronic
940853613 2:158711740-158711762 GCTGAGGAGAGGGGGAAATGGGG - Intergenic
940901660 2:159131495-159131517 CGGGGGGAGGGGGAGTGATGAGG - Intronic
941638339 2:167960613-167960635 GGTGAGGAGATGGAGTGTTCAGG - Intronic
941721505 2:168817577-168817599 GGGGAGGACAGGGAGTATTGTGG - Intronic
941809206 2:169738932-169738954 GGGGAGGAGAGGGAAGGAGGAGG - Intronic
942036875 2:172018732-172018754 GGTGGGGTGAGGGGGGGATGGGG - Intronic
942088280 2:172463268-172463290 GGTGAGAAGAGGAAGTGGTTAGG + Intronic
942345599 2:174999648-174999670 GTTGAGGAGATGGAGAGTTGGGG + Intronic
942770405 2:179511197-179511219 CGTGTGGAAAGGGAGTTATGTGG + Intronic
943347631 2:186758504-186758526 GGTAAGAAGAGTGAGTGGTGGGG - Intronic
943699262 2:190972056-190972078 GGTAAAGAGAGGGAGGGAGGGGG + Intronic
944862029 2:203824276-203824298 GTAGAGGAGAGAGAGTGAGGGGG + Intergenic
944907268 2:204275056-204275078 TGTGTGGAGAGGGGGTGATTTGG - Intergenic
945294687 2:208159020-208159042 GCTGAGGAGGGGGAATCATGAGG - Intergenic
945513002 2:210725735-210725757 GATGAGGGGTGGGAGTGAAGAGG + Intergenic
945593593 2:211765082-211765104 TGTGAGGCGAGGGAGTGAGATGG - Intronic
945779136 2:214146221-214146243 GATGTGGAGATGGAGAGATGTGG - Intronic
945814397 2:214586553-214586575 GGTGTGGAGAGGGAGAAATGAGG - Intergenic
946074769 2:217064687-217064709 GGTGAGGAGAGGGTGGGGAGGGG - Intergenic
946901247 2:224374017-224374039 GCTGAGGAGAGGGAGAGAGATGG - Intergenic
946984649 2:225257993-225258015 GGAGAGGAGAGGGAATAGTGGGG + Intergenic
947020728 2:225672797-225672819 CCTGAGGAGAGGAAGAGATGGGG + Intergenic
947303273 2:228714214-228714236 GGAGAGAAGAGAGAATGATGAGG - Intergenic
947511046 2:230754503-230754525 GAGGAGGAGAAGGAGGGATGAGG - Intronic
947661211 2:231869994-231870016 GGAGAGAAGAGGGAGTGGGGAGG - Intergenic
947860041 2:233352330-233352352 GGTGAGCAGAGCGGGTGACGAGG - Intergenic
948027605 2:234790363-234790385 GGTGAGGAGAGGGAGGAAGGAGG + Intergenic
948383461 2:237567211-237567233 GGAGAGGAGAGGGTGGGGTGGGG - Intergenic
948577762 2:238965370-238965392 AGGGAGGAGAGGGAGGGAGGAGG - Intergenic
948935803 2:241163785-241163807 GGTGAGGAATGGAAGAGATGAGG + Intronic
948984506 2:241511983-241512005 TGTGAGGGGATGGAGGGATGAGG - Intergenic
1168787250 20:550633-550655 GGGAAGGAGAGGGAGTGCTGAGG + Intergenic
1168812663 20:715868-715890 AGTGGGGAGAGGGAGGGATGAGG + Intergenic
1168917347 20:1500989-1501011 GGAGAGGAGAGGGAAGAATGAGG - Intergenic
1168965026 20:1893997-1894019 GGGGAGGAGAGGGAGCGAGAAGG - Intergenic
1169412940 20:5389144-5389166 GGTGGGGAGGGGAAGTGAGGAGG + Intergenic
1169549161 20:6684540-6684562 GGTGAAGGGAGGAATTGATGTGG + Intergenic
1169726295 20:8736672-8736694 GGAGAAGAGAGAGAGTGAGGGGG + Intronic
1169951875 20:11053682-11053704 GGGGAGGAGAGGAAGAGAAGGGG + Intergenic
1170368509 20:15622693-15622715 CGTGAGGAGATGAAGTGAGGTGG - Intronic
1171869396 20:30513421-30513443 GGGGAGGACAGGGAGAGAGGGGG + Intergenic
1172133655 20:32673118-32673140 GGTGAGGAGAGGAAGTGGAGGGG + Intergenic
1172292152 20:33784180-33784202 GGTGAGGAGGCGGAGGGAGGGGG - Intronic
1172759061 20:37309280-37309302 GGTGAGGAGAGGCAGAGAAATGG - Intronic
1172773103 20:37392906-37392928 GGAGAGAAGAGGCAGAGATGGGG - Intronic
1173363835 20:42367764-42367786 GGAGAGGAGAGTGGGAGATGGGG + Intronic
1173687973 20:44937387-44937409 GGTGAGGGGAAGGGGTAATGTGG - Intronic
1173688487 20:44940675-44940697 GGGGAGGAGAGAAAGTGGTGTGG - Intronic
1174180237 20:48669856-48669878 GGTGGAGAGACGGAGTAATGGGG + Intronic
1174306481 20:49617443-49617465 GGTGTGGAGAGGGTGGGGTGAGG - Intergenic
1174306487 20:49617459-49617481 GGTGTGGAGAGGGTGGGGTGTGG - Intergenic
1174306501 20:49617509-49617531 GGTGTGGAGAGGGTGGGGTGTGG - Intergenic
1174306515 20:49617559-49617581 GGTGTGGAGAGGGCGGGGTGTGG - Intergenic
1174306525 20:49617592-49617614 GGTGTGGAGAGGGTGGGGTGTGG - Intergenic
1174306535 20:49617625-49617647 GGTGTGGAGAGGGTGGGGTGTGG - Intergenic
1174306545 20:49617658-49617680 GGTGTGGAGAGGGTGGGGTGTGG - Intergenic
1174306551 20:49617674-49617696 GGTGTGGAGAGGGTGGGGTGTGG - Intergenic
1174306561 20:49617707-49617729 GGTGTGGAGAGGGTGGGGTGTGG - Intergenic
1174306571 20:49617740-49617762 GGTGTGGAGAGGGTGGGGTGTGG - Intergenic
1174347193 20:49938963-49938985 GGTGAGAAGGGCAAGTGATGAGG - Intronic
1174424714 20:50423749-50423771 AGTGAGGAGAGGGAGGGAAGGGG + Intergenic
1174543698 20:51309086-51309108 GGAGAGGAGAGGGGATGAGGAGG - Intergenic
1174627517 20:51927806-51927828 GGTGATGAGGGGGAGTGGGGGGG + Intergenic
1174864193 20:54119855-54119877 GGAGAGGAGAGGGAGAGAGAGGG + Intergenic
1175129672 20:56779912-56779934 GGGGAGGGGAGGGAGGGAAGGGG - Intergenic
1175318333 20:58067898-58067920 GGATAGGGGAGGGAGTGTTGGGG + Intergenic
1175487393 20:59355741-59355763 GGGGGGGAGAGGGAGAGAGGAGG - Intergenic
1175487418 20:59355802-59355824 GGGGGGGAGAGGGAGAGAAGAGG - Intergenic
1175890257 20:62312835-62312857 GGAGAGGAGATGGAACGATGGGG - Intronic
1175921513 20:62452531-62452553 GCTGAGGAGAAGGACTGAGGAGG - Intergenic
1176125433 20:63472758-63472780 GGAGGGGAGAGGGAGGGACGGGG + Intergenic
1176270489 20:64233388-64233410 GGGGAGGAGAGGGGGTGGGGAGG - Intronic
1177154262 21:17485625-17485647 GGTGAGGAGTGGGAAGGAGGTGG - Intergenic
1177203485 21:17984078-17984100 GCTGTGGAGAGGGAGAAATGGGG - Intronic
1177331492 21:19670088-19670110 AGTGAGGAGAGGGAGAGAGATGG + Intergenic
1178666029 21:34547302-34547324 GGTGAGGGGAAGCTGTGATGTGG - Intronic
1179452519 21:41475576-41475598 GGTGGGGTGAGGGAGGGATGAGG + Intronic
1179722349 21:43322888-43322910 GGGGAGGGGAGGGAGCGAAGTGG + Intergenic
1179821300 21:43938931-43938953 GTGGAGGAGAGAGCGTGATGGGG - Intronic
1179999263 21:44987714-44987736 GGTGAGGAGTGGGAGGGAATTGG - Intergenic
1180101312 21:45588455-45588477 GGGGAGGAGAGAAAGAGATGGGG - Intergenic
1180140902 21:45892937-45892959 GGAGAGGGGAGGGAGTCCTGGGG + Intronic
1180163366 21:46007691-46007713 GGGAAGGAGAGGGAGAGATGTGG - Intergenic
1180871894 22:19150920-19150942 GGTGAGGAGACGGAGAACTGGGG - Intergenic
1180926801 22:19560789-19560811 GGTGAGGGGTGGGAGAGAGGTGG + Intergenic
1181085222 22:20436710-20436732 GGTGAGGAGCGGGCGTGTGGGGG - Intronic
1181293239 22:21814337-21814359 GCTGAGGAGAGGGAGAAATGGGG + Intronic
1181789169 22:25250001-25250023 GCTGGGGAGAGGGAGAAATGAGG - Intergenic
1181988527 22:26819063-26819085 ACTGAGGGGAGGGAGTGAAGGGG - Intergenic
1182063438 22:27414116-27414138 GGTGAGATGATGAAGTGATGGGG + Intergenic
1182122286 22:27796048-27796070 GTTGGGGAGGGGGAGTGCTGGGG - Intronic
1182361575 22:29749516-29749538 GGTCAGGAGGGGAAGTGAGGCGG - Intronic
1182412921 22:30202371-30202393 GGTGAGGAGTGGGAGTTGAGTGG + Intergenic
1182508856 22:30804193-30804215 GGGGAGGAGAGGGAGTGGAGAGG + Intronic
1182560088 22:31152863-31152885 AGTGTGGAGAGGGAGGGAGGTGG - Intergenic
1182881736 22:33739532-33739554 TGTCAGGAGAGGGAGAGAAGGGG - Intronic
1182890874 22:33817914-33817936 GGGGAGGAGAGGGAGGAAAGGGG + Intronic
1183078966 22:35444228-35444250 GGAGAGGAGAGGAAGTGGGGAGG + Intergenic
1183085280 22:35483340-35483362 GGTGAGGGTAGTGATTGATGAGG - Intergenic
1183102697 22:35593610-35593632 GGTGGGGAGAGGGAGAGAGAGGG + Intergenic
1183333032 22:37231527-37231549 GGTGAGGAGAGAGAGACGTGAGG + Intronic
1183545266 22:38452070-38452092 GGTGGGGAGATGGAGGCATGAGG + Intronic
1183649958 22:39148136-39148158 GGTGAGAAGAGGCAGCCATGAGG + Intronic
1183747188 22:39698649-39698671 GGAGATGATGGGGAGTGATGGGG - Intergenic
1183782488 22:40007670-40007692 GGAGAGGAGAGGAAATGAGGAGG - Intronic
1183865061 22:40697715-40697737 GCTGAGGGGAGGGAGAGATGGGG + Intergenic
1184094263 22:42308169-42308191 GGTGGGGAGAGGGGGCTATGGGG + Intronic
1184172835 22:42769592-42769614 GGTGAGGTGAGGAGGTGACGGGG + Intergenic
1184513320 22:44945631-44945653 CGTGGGGACAGGGAGTGATAGGG + Intronic
1184670804 22:46011520-46011542 GGTGGGGACAGGGAGTGGAGGGG + Intergenic
1184709401 22:46239660-46239682 GAAGAGGAGAGGGGGTGCTGGGG - Exonic
1185015301 22:48339326-48339348 GGAGAAGAGAGGGAGAGAGGAGG + Intergenic
1185415365 22:50706344-50706366 GGTGAGGAGAGGGTGGCATGTGG + Intergenic
949575673 3:5337028-5337050 GGTGACAATAGGGAGTGGTGGGG - Intergenic
949793085 3:7814932-7814954 GTTGAGCAGAGGGAGTGGTAGGG - Intergenic
949956070 3:9269641-9269663 GGGGATGAGAGGGAGTAAGGAGG + Intronic
950011584 3:9727970-9727992 GATGATGACAGGGAGTGAGGAGG + Intronic
950193929 3:10995793-10995815 GCTGAGGAGAGGGGCTGCTGGGG - Intronic
950442164 3:13016397-13016419 ACTGTGGAGAGGGAGTGGTGGGG - Intronic
950465804 3:13153098-13153120 GGAGAGGAGAGGGAGGGGAGAGG - Intergenic
950565158 3:13765031-13765053 GGTGAGGGCAGGAAGTAATGGGG - Intergenic
951340837 3:21484706-21484728 AGGGAGGAGAGGGAGAGGTGTGG + Intronic
951851448 3:27145750-27145772 GATGAGGAGACTGAGTGCTGTGG + Intronic
952240201 3:31524290-31524312 GATGAGGAGAGGGAAGGATTTGG + Intergenic
952364391 3:32662065-32662087 GCTGAGGGGAGGGAGTGGAGAGG + Intergenic
952613758 3:35244209-35244231 AGAGGGGAGAGGGAGGGATGGGG + Intergenic
952615142 3:35262143-35262165 GGAGAGAAGAGTGAGTGAGGGGG - Intergenic
952845126 3:37681816-37681838 GGTGAGGAGATGGAGGGAAATGG - Intronic
953034284 3:39198488-39198510 GGTGAGGAAAGTGAGTGCTATGG + Intergenic
953349791 3:42206887-42206909 GGTGAGGAGAGGGAGTGATGGGG + Intronic
953408061 3:42669779-42669801 GGAGAGAGGCGGGAGTGATGGGG - Intergenic
953706937 3:45238297-45238319 TGTGAAGAGAGGAAGTGAAGGGG - Intergenic
953806012 3:46067782-46067804 GGTGAGAACAGGGAGAGAAGAGG + Intergenic
953930372 3:47002887-47002909 GGTGAGGCCAGGGAGGGATGGGG + Intronic
954313826 3:49790169-49790191 GGCGGGGAGAGGGAGAGAGGGGG - Intergenic
954370912 3:50169224-50169246 GGTGAGGACAGGCACTGAGGAGG - Intronic
954663462 3:52238083-52238105 GGGGAGGGGAGGGTGTGATGCGG + Intronic
954851204 3:53602100-53602122 GGTGAGGAGAGGGGAGAATGAGG - Intronic
955044036 3:55343200-55343222 GGTTGAGAGTGGGAGTGATGGGG - Intergenic
955065485 3:55530553-55530575 GATGAGCTGAGGGAGAGATGGGG - Intronic
956744181 3:72298567-72298589 GTTGTGGGGAGAGAGTGATGAGG + Intergenic
957078774 3:75620306-75620328 GGTGGGGGGAGGGAGGGAGGGGG - Intergenic
957175400 3:76801937-76801959 TCTGAGGAGAGAGAGAGATGAGG + Intronic
957216622 3:77328163-77328185 GGAGGGAAGAGGAAGTGATGGGG - Intronic
957251798 3:77781042-77781064 GGTCAGGTGATGGAGAGATGGGG + Intergenic
957350765 3:79019493-79019515 GGGGAGGAGAGGGAGGGAACTGG - Intronic
958049176 3:88322347-88322369 GGGGTGGATAGGGAGTGAGGTGG - Intergenic
958532006 3:95345041-95345063 GAACAGGAGAGAGAGTGATGGGG + Intergenic
959903050 3:111681397-111681419 GGTTAGGAGGGCAAGTGATGAGG - Intronic
961339016 3:126204972-126204994 GGAGAGGAGAGGGAGAGTTGAGG + Intergenic
961539148 3:127588857-127588879 GGAGAGGAGAGGCAGAGAAGGGG + Intronic
961543854 3:127618537-127618559 GGTGAGGGAAGGGAGCGAGGAGG - Intronic
961576306 3:127839463-127839485 GATGGGGAGAGGGAGTAATAGGG + Intergenic
962386419 3:134936143-134936165 GGGGAGGAGTGGGAATGAGGAGG + Intronic
962807518 3:138938018-138938040 GGTGAGGGGAGGGAGCGAGAAGG + Intergenic
962844421 3:139262373-139262395 ACTGAGGAGAGGGAGTTAAGGGG - Intronic
962870415 3:139485478-139485500 GATGGGGAGAGGGAGGAATGGGG - Intergenic
963044136 3:141090083-141090105 GGAGAAGAGAGGGAGAGAAGAGG - Intronic
963066260 3:141266671-141266693 GGGGGAGAGAGGGAGAGATGAGG + Intronic
963890644 3:150632567-150632589 GGTGAGAAGGGGGGATGATGAGG + Intergenic
963963873 3:151343056-151343078 GTTGAGGAGAGGGTGTGATAGGG - Intronic
964506484 3:157405532-157405554 GGAGGGGAGGGGGAGAGATGCGG - Intronic
965895010 3:173565005-173565027 GTTGAGCGGAGGGAATGATGAGG + Intronic
966441540 3:179950362-179950384 GGTGAGGGGAGGGGGTGGGGAGG + Intronic
966542492 3:181107435-181107457 GGTGAGGACATGGAGAGAGGTGG + Intergenic
966826133 3:183966604-183966626 AGTGAGGAGAGACAGAGATGGGG - Intronic
966826629 3:183970413-183970435 GGTGAGGAGAGAGTGTGCTGGGG - Intronic
966864155 3:184247630-184247652 GGTGAGGGGAAGGAGTGCTGTGG - Intronic
966888413 3:184389316-184389338 GGAGGGGAGAGGGAGTGGAGAGG - Intronic
966905669 3:184523986-184524008 CGTGATGAGAGGCAGTGTTGAGG + Intronic
967033628 3:185631443-185631465 GGAGGGGAGAGGGAGGGAGGGGG - Exonic
967255426 3:187587188-187587210 TGTGAGAGGAGGGTGTGATGGGG - Intergenic
967649805 3:191972992-191973014 GGTGAAGAGAGGGAGAGAAGAGG - Intergenic
967685458 3:192410755-192410777 GGTGCGGCGAGGGAGTGATGTGG + Intronic
967787688 3:193514982-193515004 GGTGAGGAGAGGGCAGGGTGAGG + Intronic
967884269 3:194322543-194322565 GGTGAGGAGAGGGTGGGCGGAGG - Intergenic
968446356 4:654219-654241 GGGCAGGAGAGGGAGGGATAGGG + Intronic
968511768 4:998815-998837 TGTGAGCAGAGGGACTGATGAGG - Intronic
968647824 4:1749057-1749079 GGTGGGGAGGGGGCGTGGTGGGG - Intergenic
968647849 4:1749109-1749131 GGTGGGGAGGGGGCGTGATGGGG - Intergenic
968850311 4:3074075-3074097 GGTGGGGCGAGGGAGGGGTGGGG - Intergenic
968862651 4:3184877-3184899 GGTGAGGGGAGCCAGTGCTGGGG + Intronic
968945871 4:3663888-3663910 GGTGATGAGGTGGAGTGAGGAGG + Intergenic
968983410 4:3863052-3863074 GGGGTGGGGAGGGAGAGATGGGG + Intergenic
969215817 4:5721501-5721523 GCAGAGGAAAGGGAGGGATGGGG + Intronic
969345269 4:6565869-6565891 GGTGAGGATGGGGAGCCATGGGG + Intergenic
969607813 4:8211235-8211257 GGTGGGGAGAGGGAGGGAGAGGG - Intronic
970240823 4:14006895-14006917 GATGAGGGGAAGGAGTGAAGAGG + Intergenic
970522348 4:16898668-16898690 GGAGAGGAGAGGGAGAGGAGAGG + Exonic
970569059 4:17361780-17361802 GGGGAGAAGAGGGAGGGAAGTGG - Intergenic
970573989 4:17409668-17409690 GGTGAGCAGAGGGATGGAGGGGG - Intergenic
970812732 4:20114209-20114231 AGTGATGAGAGGGAGTGAAGAGG - Intergenic
970856325 4:20652607-20652629 GAGCAGGAGAGGGAGTGAAGGGG + Intergenic
970921908 4:21404207-21404229 GGTGAGAACAGAGAGTAATGAGG - Intronic
970990679 4:22209678-22209700 GCAGAAGAGAGGGAGTGAAGGGG - Intergenic
971318644 4:25587599-25587621 GAAGAGGAGGGGGAGGGATGAGG - Intergenic
971879903 4:32358346-32358368 GCTGAGAAGAGGGGGTAATGGGG - Intergenic
972002897 4:34060837-34060859 TGTGAGAAGATGGAGTTATGAGG - Intergenic
972709975 4:41586064-41586086 GGGGAGGAGAGGGAGCGGAGGGG - Intronic
973095352 4:46191131-46191153 GCAGTGGAGAGGGACTGATGAGG + Intergenic
973136094 4:46708712-46708734 GGTCAGTAGAGGGAGTGATATGG + Intergenic
973277721 4:48327298-48327320 GATGAGGAGATGGGGAGATGAGG + Intergenic
973634834 4:52852270-52852292 GGAGTGGGGAGGGAGTGATGGGG - Intergenic
975356430 4:73411078-73411100 GGTGAGGAGTGTGGGTGACGGGG - Intronic
975503854 4:75116991-75117013 GGAGAGGAGAGGGAAGGGTGGGG + Intergenic
975582779 4:75921747-75921769 GGTGAGGAGTGGCAGTGGGGAGG + Intronic
976047522 4:80968845-80968867 GGAGAGAAGAGGGAGGGATAGGG - Intergenic
976184872 4:82433132-82433154 GGACAGGAGAGGTAGTGATGTGG + Intronic
976421138 4:84845416-84845438 GCTGAGGAGAGGGGGAAATGAGG + Intronic
976597588 4:86908618-86908640 GTTGAGGAGGGGGAGGGAGGGGG - Intronic
976744775 4:88392009-88392031 GGGGAGGGGAGGGAGAGAAGGGG - Intronic
977079454 4:92505611-92505633 GTGGAGGAGAGGGAGTTGTGAGG + Intronic
977495837 4:97774400-97774422 CTTGAGGAGGAGGAGTGATGAGG - Intronic
977658715 4:99556866-99556888 GCTGAGGTGAGGGAGTGATTTGG - Intronic
977715116 4:100173528-100173550 CTTGAGGAGAGGGAGAGAGGTGG + Intergenic
978072428 4:104490680-104490702 GAAGGGGAGAGGGAGTGAGGAGG + Intronic
978285598 4:107073445-107073467 GGTGGGGAGGGGGATTGGTGGGG - Intronic
978389798 4:108213560-108213582 GGGGATGGGAGGGAGTGCTGAGG + Intergenic
978454758 4:108876271-108876293 GATGAGGAGAAGGAGTAGTGAGG + Intronic
979321768 4:119332914-119332936 GGTGAAGAGAGTGAGAAATGTGG - Intergenic
979430905 4:120629173-120629195 GGGGAGGAAATGGGGTGATGGGG + Intergenic
979490270 4:121318647-121318669 GGTGAAGAGGGAGAATGATGCGG + Intergenic
979971182 4:127137292-127137314 GGGGAGGAGAGGGAGCAATTCGG + Intergenic
980882350 4:138724744-138724766 GGGGAAGAGAGGGAGAGGTGTGG - Intergenic
981010002 4:139915801-139915823 GGTGATGAGGGGTAGGGATGGGG + Intronic
981601808 4:146497741-146497763 TGTTTGGAGAGGGAGTTATGTGG - Intronic
982074145 4:151721679-151721701 GGAAAGCAGAGGGAATGATGAGG - Intronic
982081716 4:151796719-151796741 TGGGCGGAAAGGGAGTGATGGGG + Intergenic
982127873 4:152200001-152200023 GCAGAGGGGAAGGAGTGATGGGG - Intergenic
983521128 4:168709763-168709785 GGGGAGAAGAAGGAGTGAAGTGG + Intronic
983595133 4:169457710-169457732 GGAGGGGAGAGGGAGGGAAGAGG + Intronic
983931726 4:173460422-173460444 GGAGAGGAGAGGGAAGAATGAGG + Intergenic
984667992 4:182448809-182448831 GGTGAGGCGAGGGGGTGAGGCGG + Intronic
984750022 4:183263291-183263313 GAAGAGGGGAGAGAGTGATGAGG + Intronic
985117371 4:186605327-186605349 AGTGAGGAGGAGGGGTGATGAGG + Intronic
986105880 5:4658924-4658946 CATGAGGAGAGGGGGTGAGGAGG + Intergenic
986284229 5:6348035-6348057 AATGAGGTGAGGGAGGGATGAGG + Intergenic
986369806 5:7068632-7068654 GGTTAGGACAGGGTGTGCTGTGG - Intergenic
986488063 5:8260549-8260571 GGTGAGGGGAGGAAATGCTGGGG + Intergenic
986691522 5:10317424-10317446 GGGGGGGAGAGGGAGAGAGGGGG - Intergenic
987058638 5:14220345-14220367 CCTGAGGAGAGGGAGAGAGGCGG - Intronic
987373894 5:17217414-17217436 GGGGAGCAGAGGGAGTGCAGGGG + Intronic
987481693 5:18467138-18467160 GCTGAGCAGAGAAAGTGATGGGG + Intergenic
988346415 5:30042654-30042676 GGTGAAGAGAAGGAGAGAAGAGG + Intergenic
988422594 5:31024400-31024422 GGTGTGGAGGGTGAGTGGTGGGG - Intergenic
988813476 5:34807544-34807566 GGTGGGGTGCTGGAGTGATGAGG + Intronic
989417807 5:41200772-41200794 TGTGAGGAGAGGGAATGTAGAGG + Intronic
989534318 5:42546418-42546440 GGTGAGGAGGGGAAGTGTAGGGG + Intronic
989970807 5:50521769-50521791 GGAGAGGAGAGGGATAAATGGGG - Intergenic
990446223 5:55896658-55896680 GGGGAGGGGAGGGAGTGGGGAGG - Intronic
990723727 5:58729401-58729423 GGTGCAGGGAGAGAGTGATGGGG - Intronic
990986927 5:61649312-61649334 GGTGGGGAGATGGAGCGAGGCGG - Intronic
993106773 5:83609164-83609186 GTTGAGAAGAGGGTGTAATGAGG - Intergenic
993364590 5:87020157-87020179 TCTGAGGAGAGGGAGGGAGGTGG - Intergenic
993632937 5:90309507-90309529 GGGAAGGAGAGGGAGGGAGGAGG + Intergenic
994997228 5:107079139-107079161 GGGGAGGAGAGGGAGAGAAAAGG + Intergenic
995059110 5:107794775-107794797 GGTGAGGATAGTGGGTGCTGTGG + Intergenic
995689464 5:114807799-114807821 GTTGGGGAGAGGGAGAAATGGGG + Intergenic
995887766 5:116915576-116915598 GGTGAGGAGACAGAGTAATGGGG + Intergenic
996326435 5:122280139-122280161 AGAGAGGAGAGGGAGGGAGGGGG - Intergenic
996404345 5:123090835-123090857 GGTGAGGAGAGGGAGGGAGAGGG - Intronic
996968237 5:129331224-129331246 GGTGAGGAGAGGGAAGGATGGGG + Intergenic
997225773 5:132208427-132208449 GGGGAGGAGAGGGGGGAATGGGG + Intronic
997291785 5:132742293-132742315 GCTGAGGATAGGGAGCGATAGGG + Intergenic
997374988 5:133391468-133391490 GATGAGGGGAGGGAGTGACATGG - Intronic
997513076 5:134466374-134466396 GATGGGGAGAGGGGCTGATGGGG + Intergenic
997610141 5:135210000-135210022 AATGAATAGAGGGAGTGATGGGG - Intronic
997676737 5:135718833-135718855 GGTGAGGGGTGGGAGGGAAGTGG + Intergenic
997998190 5:138603346-138603368 GGAGAGGGGAGGGAGGGAAGAGG + Intergenic
998016241 5:138734504-138734526 AGTGAGGAGAGGCAGTAATGGGG + Intronic
998130448 5:139648906-139648928 GGGGAGGAGAGGGAGGTAGGCGG - Intronic
998371490 5:141664865-141664887 GGTGGGGGGTGGGGGTGATGAGG - Intronic
998391403 5:141789137-141789159 GGTGAGGGTGGGGAGTGAGGAGG - Intergenic
998703614 5:144733036-144733058 GGAGAGGGGAGGGAGCAATGGGG - Intergenic
998723502 5:144981019-144981041 GGTGGGGTGGGGGAGAGATGAGG + Intergenic
999258618 5:150223649-150223671 GGAGGCGATAGGGAGTGATGGGG + Intronic
999286147 5:150395395-150395417 GGTGAGGAGACCCAGTCATGGGG + Intronic
999366456 5:151026820-151026842 GGTGAGCCGGGGGAGTGGTGTGG + Intronic
999406634 5:151312641-151312663 GGTGAGGAGAAGGAATAGTGGGG - Intergenic
999565850 5:152860533-152860555 TGTGAGGAGTAGGAGTGGTGTGG + Intergenic
999616706 5:153432715-153432737 AGTGAGGAGACTCAGTGATGAGG + Intergenic
999682904 5:154076374-154076396 GGCGAGGAGAAGGGGTAATGTGG + Intronic
999922268 5:156334725-156334747 GGTGGAAAGAGGTAGTGATGGGG - Intronic
1001206723 5:169770245-169770267 GGTGGGGAAAGGCAGTCATGTGG - Intronic
1001259543 5:170216051-170216073 GGAGAGGAGGAGGAGTGCTGAGG - Intergenic
1001506240 5:172283289-172283311 GGCCTGGAGAGGGAGTGAGGTGG + Intronic
1001529802 5:172454095-172454117 GGGGAGGGGAGGGAGGGAGGAGG + Intronic
1001568886 5:172717489-172717511 GGTGAGGAGAAGGCGGGAGGTGG + Intergenic
1002057007 5:176603909-176603931 GGAGACAAGAGGGAGTGGTGGGG + Intronic
1002316415 5:178347089-178347111 GGTGAGGACAGGGAGGGAGGGGG - Intronic
1002527287 5:179821594-179821616 GGCGAGGGGAGGGAGTGACGCGG + Intronic
1002620028 5:180481645-180481667 GGCCAGGAGATGAAGTGATGTGG + Intergenic
1002695449 5:181085479-181085501 GGTGAGGAGCGGGCGGGCTGGGG - Intergenic
1002795673 6:469432-469454 GGAGAGGAGGGGGAGAGAGGAGG - Intergenic
1002895985 6:1380540-1380562 GGAGAGGTGAAGGAGTCATGGGG - Intergenic
1002912152 6:1498558-1498580 GGTGAGGAGAGGGCGGGATGTGG + Intergenic
1003256983 6:4483228-4483250 GGTGGGGAGGGGGTGGGATGGGG - Intergenic
1003533501 6:6956547-6956569 GGTGTGGAGAGGCAGAGGTGAGG - Intergenic
1003665726 6:8109587-8109609 GGTGAGGATAGGAAGGGATTAGG - Intergenic
1003901484 6:10659606-10659628 GGTGAGGAGGGGGAGAGGAGAGG + Intergenic
1003912036 6:10751849-10751871 AGTGAGGACAGTGAGTGGTGTGG + Intronic
1004252210 6:14032132-14032154 GGTGAGTTGAGGTAATGATGAGG - Intergenic
1004397163 6:15255441-15255463 GGTGAGGAGGAGGAGTGAAAAGG + Intronic
1004447543 6:15714087-15714109 AGTGATGAGAGGGAGTGACTGGG + Intergenic
1004581511 6:16958678-16958700 GGGGAGGCGAGAGAGTGAAGTGG + Intergenic
1004924460 6:20403680-20403702 GGAGAGGAGAGGGAGGGTGGCGG - Intronic
1005141676 6:22639065-22639087 GGTGAGGAGAGTGAGTCAAGTGG - Intergenic
1005840331 6:29741005-29741027 GGAGAGGACAGGGAGTGCTTTGG - Intergenic
1005913436 6:30330563-30330585 GGTGAGCAGAGAAGGTGATGTGG + Intronic
1005948327 6:30611742-30611764 GCTGAACAGAGGGAGAGATGAGG + Intronic
1006113197 6:31761262-31761284 GGTGAGGGGAGAAACTGATGAGG + Exonic
1006133595 6:31882858-31882880 GGTGGGGAGAGGGTGGGCTGTGG + Intronic
1006657548 6:35608735-35608757 GGTGAGGATAGGAAATGAAGAGG - Intronic
1007103967 6:39270797-39270819 GGTGAGAAGGGGCAGTGGTGGGG + Intergenic
1007239083 6:40412228-40412250 GGTGTGGAGTGGGAGTGGGGCGG - Intronic
1007496591 6:42264059-42264081 GGCCAGGAGATGGAGTGATCTGG + Intronic
1007893203 6:45316172-45316194 GGAGAAGAGTGGGAGTGAAGTGG + Intronic
1007944885 6:45817332-45817354 GAGGAGGAGAGAGAGTGACGGGG + Intergenic
1007962203 6:45970066-45970088 GGTGAGGAGAGGGAGGAAGGAGG - Intronic
1008307228 6:49918209-49918231 GGGGAGGGGAGGGAGGGAAGGGG - Intergenic
1008535054 6:52501168-52501190 GGGAAGGAGAGGGAGAAATGGGG + Exonic
1010222772 6:73462071-73462093 GGTGAGGAGCGCGGGTGCTGTGG + Exonic
1010731354 6:79394830-79394852 GGTGGGAAGAGGGAGTGCTTGGG + Intergenic
1011369619 6:86621284-86621306 GGTAGGGGGAGGGAGGGATGGGG - Intergenic
1011632294 6:89339458-89339480 GGGGAGGAGAGGGGGGGAGGGGG + Intronic
1012158905 6:95857502-95857524 GGTGGGAAGAAGGGGTGATGAGG + Intergenic
1012349047 6:98228785-98228807 GGTGAGGGGAGGGAGGAACGGGG + Intergenic
1012625057 6:101394221-101394243 GGTGGGCAGAAGGAGGGATGGGG - Intergenic
1013338863 6:109193121-109193143 AGAGAGGGGAGGGAGTGAAGGGG - Intergenic
1013351335 6:109308666-109308688 GGTGGGGAGTGGGTGGGATGGGG + Intergenic
1013429368 6:110042110-110042132 GGGGAAGAAAGGAAGTGATGTGG - Intergenic
1013920648 6:115398959-115398981 GGAGAGGAGAGGAAGGGAGGAGG - Intergenic
1014935492 6:127380504-127380526 GGTGAGGTGGGGTAGTGAGGGGG - Intergenic
1015190602 6:130467813-130467835 AGTGAGCAGAGGGAGGGAGGAGG - Intergenic
1015568122 6:134594976-134594998 TGGGACGAGAGGGAGTCATGAGG - Intergenic
1015752111 6:136570796-136570818 ACTGAGAAGAGGGAGTAATGGGG - Intronic
1016569162 6:145493009-145493031 TTTGAGGAGAGGAAGTGATAGGG - Intergenic
1016833109 6:148452363-148452385 GGTGAGGAGTGTGAGTCAGGTGG + Intronic
1016833454 6:148454744-148454766 TGTGAAGAGAGGGAGAGATCTGG + Intronic
1016872964 6:148837283-148837305 GGTGAGGATATGGATTGAGGGGG - Intronic
1017044886 6:150337976-150337998 GGTGAGGAAAGGGGTGGATGTGG + Intergenic
1017844584 6:158245415-158245437 GGTGTGGAAAGGGAATGATAAGG + Intronic
1017881519 6:158565733-158565755 GGTGTGGGGAGGGTGTGGTGTGG + Intronic
1018266602 6:162030885-162030907 GCTGAGGAGAGGTAATGATCAGG - Intronic
1018811374 6:167300586-167300608 GGTGTGGACAGGGAGTCAGGAGG + Intronic
1018834321 6:167471722-167471744 GGGGAGGGGCTGGAGTGATGAGG - Intergenic
1018857377 6:167684496-167684518 GAAGAAGAGAGGGAGTGAAGGGG + Intergenic
1019010731 6:168841805-168841827 GGGGACGGGAGGGAGGGATGGGG + Intergenic
1019054746 6:169215034-169215056 GGGGAAGAGAGGGAGGGATGGGG - Intergenic
1019125932 6:169840123-169840145 GGTGTGGAGTGGGCGTGCTGTGG - Intergenic
1019125965 6:169840246-169840268 GGTGTGGAGTGGGAGTGGTGTGG - Intergenic
1019125975 6:169840290-169840312 GGTGTGGAGTGGGCGTGGTGTGG - Intergenic
1019223604 6:170493542-170493564 GGGGAGGAGAGGAGGTGAGGAGG + Intergenic
1019646410 7:2131742-2131764 GGTGAGGACAAGGGCTGATGGGG - Intronic
1020080027 7:5282206-5282228 GGGAAGGAGAGGGAGGGAGGAGG + Intronic
1020080121 7:5282492-5282514 GGGGAGGAGTGGGAGGGAGGAGG + Intronic
1020284071 7:6666782-6666804 GCTGAGGGGAGGGAGAAATGGGG - Intergenic
1020344860 7:7151991-7152013 GGAGGGGAGAGGAAGTGAGGGGG - Intergenic
1020549034 7:9574829-9574851 GGTGAGGATTAGGAGTGATTAGG + Intergenic
1020611642 7:10404515-10404537 GGGGAAGAGAGGGAGGGAGGAGG + Intergenic
1021433719 7:20590397-20590419 GGTGAGGAGAGGGAGGAAAGAGG + Intergenic
1021556089 7:21919657-21919679 TGTGAGATGAGGGAGAGATGAGG - Intronic
1021827961 7:24573414-24573436 GGGGAGGAGAGAGAGGGAGGCGG + Exonic
1021833175 7:24638789-24638811 GGTGAGGAGAAGTAGGAATGTGG - Intronic
1022088846 7:27094918-27094940 GCTGTGGAGGGTGAGTGATGAGG + Intronic
1022098466 7:27155368-27155390 GGGGAGGAGGGGGAGTGTTAGGG + Intronic
1022194245 7:28049034-28049056 GGGGAGGGGAGGGAGGGAAGGGG - Intronic
1022207909 7:28180654-28180676 GGTGAGGAGAGGAGGGGCTGGGG + Exonic
1022473336 7:30694879-30694901 AGGGAGGAGAGGGGATGATGAGG + Intronic
1022548892 7:31217650-31217672 CCTGAGGAGAGGGAGAGATGAGG + Intergenic
1022728096 7:32998726-32998748 GGAGAGGAGTGGGAGTGAGCCGG + Intronic
1022741187 7:33123134-33123156 GGAGAGGAGAGGGAAGGATGGGG - Intergenic
1022805289 7:33815186-33815208 GGAGAGGAGGGGGAGTGGAGCGG + Intergenic
1022981789 7:35611180-35611202 GCTGAGGAGAGGGCATGATTGGG + Intergenic
1023334004 7:39149657-39149679 GGTGAGGAAATGGGGAGATGTGG - Intronic
1023458804 7:40370603-40370625 AGAGAGGAGAGAGAGAGATGGGG + Intronic
1023621923 7:42082230-42082252 GGTGGGAAGAGACAGTGATGAGG - Intronic
1023911224 7:44558437-44558459 GGGGAGGAGAAGGAGGGAGGGGG - Intergenic
1024855079 7:53769652-53769674 GGGTAGAAGAGGGAGTGTTGGGG - Intergenic
1024920068 7:54545974-54545996 GGAGAGGAGAGAGAATGAGGGGG + Intronic
1025045557 7:55689293-55689315 GGAGAGGAGTGGGAGTGAGCCGG - Intergenic
1025198798 7:56949718-56949740 GGGGAGGAGTGGGAGGGAGGAGG - Intergenic
1025198889 7:56950010-56950032 GGGAAGGAGAGGGAGGGAGGAGG - Intergenic
1025258158 7:57399306-57399328 GGAGAGGAGGGGGAGGGCTGGGG + Intergenic
1025673057 7:63626923-63626945 GGGAAGGAGAGGGAGGGAGGAGG + Intergenic
1025673148 7:63627215-63627237 GGGGAGGAGTGGGAGGGAGGAGG + Intergenic
1025778157 7:64576818-64576840 GGAGAGGAGAGGGAGAGAGAGGG - Intergenic
1025987225 7:66464154-66464176 GGTTAGGAGGGGCAGTCATGAGG + Intergenic
1026239128 7:68556497-68556519 GCTGGGGAGAGTGAGGGATGTGG - Intergenic
1027005988 7:74693504-74693526 CCTGAGGAAAGGGAATGATGGGG - Intronic
1027193062 7:76009118-76009140 GCTGGGAAGAGGGTGTGATGTGG + Intronic
1027362945 7:77428305-77428327 TCTGAGGAGAGGGAGTGATTGGG + Intergenic
1028090324 7:86692549-86692571 AGTGATGAGAGAGAGAGATGTGG - Intronic
1028315927 7:89403240-89403262 GGTGAGAGGAGGGAGAGATCAGG - Intergenic
1028950639 7:96631023-96631045 GGAGAGGAGATGGAATAATGTGG - Intronic
1028954519 7:96673985-96674007 GGAGAGGGGAGGTAGAGATGGGG - Intronic
1028983630 7:96993202-96993224 GGTGGGAGGAGGGAATGATGGGG + Intergenic
1029127307 7:98303460-98303482 GGTGAGGTGATGGCGTGGTGGGG - Intronic
1029436698 7:100567783-100567805 GGTCAGGAGAGGCAGAGTTGAGG + Exonic
1029536325 7:101159855-101159877 TCTGAGGAGGGGGAGAGATGGGG + Intronic
1029546294 7:101212214-101212236 GGGGAGGAGAGGGTGGGATGAGG - Intronic
1029547124 7:101216507-101216529 GGAGTGGCGAGGGGGTGATGTGG - Exonic
1030072917 7:105713090-105713112 GAGCAGGAGAGAGAGTGATGGGG + Intronic
1030115558 7:106059892-106059914 GGTGAGGACAGGAAGGGAAGGGG - Intergenic
1030450505 7:109704183-109704205 GGTCAGCAGAAGGAGTCATGAGG - Intergenic
1031247689 7:119337676-119337698 GGTGAGGAGGGAGAGGGAGGAGG - Intergenic
1032026456 7:128446370-128446392 TGTCAGGAGAGGGGGTAATGAGG - Intergenic
1032096551 7:128941079-128941101 GGGGAGGAGAGGGACAGAAGGGG + Intronic
1032189853 7:129758433-129758455 TGTGAGAGGAGGGAGTGATGGGG + Intergenic
1032334989 7:131016908-131016930 GGTGAGGAGAGGGAAAAATAGGG + Intergenic
1032410815 7:131692376-131692398 GATGAGCAGAGGGCCTGATGCGG + Intergenic
1032675904 7:134129396-134129418 GGGGAGGGGAGGGAGGGAAGGGG - Intronic
1032675914 7:134129415-134129437 GGGGAGGGGAGGGAGGGGTGGGG - Intronic
1033281621 7:140010001-140010023 GGTGTGGAGCGGGTGTGAAGCGG - Intronic
1033356202 7:140602136-140602158 GGAGAGGAGGAGTAGTGATGGGG - Exonic
1033607589 7:142938693-142938715 GGTGAAGAGAGGGTGTGAATGGG + Intergenic
1033628994 7:143139050-143139072 GGTGAGGAGAAGGTGGGAGGGGG - Intronic
1033845931 7:145432150-145432172 CCTGAGGAGAAGGAGAGATGAGG + Intergenic
1034028165 7:147730587-147730609 CTTGAGGAGAGGGAGAGATGGGG - Intronic
1034226863 7:149491066-149491088 GGTGAGGAGAAGGGGAGGTGAGG + Intronic
1034238587 7:149592068-149592090 GGTGAGGAGAAGGGGAGGTGAGG + Intergenic
1034242005 7:149617824-149617846 GGTGAGGAGAAGGGGAGGTGAGG + Intergenic
1034318453 7:150156588-150156610 GGAGAGGAGAGAGAGCGATTTGG + Intergenic
1034653729 7:152712770-152712792 GGGGAGGAGAGGAAGGGAGGGGG - Intergenic
1034695960 7:153053950-153053972 GGTGAGGAGGGTGAGGAATGGGG - Intergenic
1034774299 7:153810644-153810666 AGAGAGGAGAGGGAGCGATTTGG - Intergenic
1034783026 7:153899108-153899130 GAGGAGGAGAGAGAGTGAAGAGG - Intronic
1034954978 7:155328561-155328583 TTTGGGGAGAGGGAGAGATGAGG - Intergenic
1034955019 7:155328726-155328748 TTTGGGGAGAGGGAGAGATGAGG - Intergenic
1034955036 7:155328794-155328816 TTTGGGGAGAGGGAGAGATGAGG - Intergenic
1034955050 7:155328860-155328882 TTTGGGGAGAGGGAGAGATGAGG - Intergenic
1034955066 7:155328926-155328948 TTTGGGGAGAGGGAGAGATGAGG - Intergenic
1034955113 7:155329151-155329173 TTTGGGGAGAGGGAGAGATGAGG - Intergenic
1034955144 7:155329314-155329336 TTTGGGGAGAGGGAGAGATGAGG - Intergenic
1034955180 7:155329446-155329468 TTTGGGGAGAGGGAGAGATGAGG - Intergenic
1034955191 7:155329512-155329534 TTTGCGGAGAGGGAGAGATGAGG - Intergenic
1034955207 7:155329612-155329634 TTTGGGGAGAGGGAGAGATGAGG - Intergenic
1034955235 7:155329744-155329766 TTTGGGGAGAGGGAGAGATGAGG - Intergenic
1034955249 7:155329810-155329832 TTTGGGGAGAGGGAGAGATGAGG - Intergenic
1034955263 7:155329876-155329898 TTTGGGGAGAGGGAGAGATGAGG - Intergenic
1035124819 7:156600963-156600985 GGGTCTGAGAGGGAGTGATGTGG - Intergenic
1035167635 7:157000714-157000736 GGCGAGGAGAGGGAGAGCAGAGG + Intronic
1035482143 7:159195776-159195798 TCTGGGGAGAGGGAGGGATGGGG + Intergenic
1035574332 8:695479-695501 GGAGAGGAGAGGGAGGGAGGCGG - Intronic
1036053833 8:5228658-5228680 GGTGAGAGTAGGGAGTGATTAGG + Intergenic
1036279938 8:7392157-7392179 GCTTAGAAGAGGGAGTGAGGCGG + Intergenic
1036469110 8:9034620-9034642 GGTCTGGAGAGGGAGCGATGGGG - Intronic
1036797737 8:11768498-11768520 GGTGAGGAGAGGGAGGCCTGGGG - Intergenic
1037467264 8:19172649-19172671 GGAGAGGAGAGGGAGGGGAGGGG + Intergenic
1037764438 8:21763649-21763671 GGTGAGGAGAGGGTGGCTTGAGG - Intronic
1037822797 8:22143235-22143257 AGAGAGGAGAGGGAGACATGGGG - Intergenic
1037834638 8:22208829-22208851 GGTGGGGAGAGGGAAGGACGGGG - Intronic
1037886529 8:22599069-22599091 GGAGAGGAGAGGGAGGGGAGGGG - Intronic
1037886538 8:22599090-22599112 GGAGAGGAGAGGGAGGGGAGGGG - Intronic
1037886612 8:22599278-22599300 GGCGAGGAGAGGGAGGGGAGGGG - Intronic
1037912906 8:22754770-22754792 GGTGAGGGAGGGGAGAGATGTGG - Intronic
1038711086 8:29946434-29946456 GGAGAGGAGAAGGAGGGAGGTGG - Intergenic
1038779280 8:30556822-30556844 GGGGAGGAGAGGGAGGGCAGAGG - Intronic
1038832065 8:31072836-31072858 GGTGAAGTGAGGGAGCCATGTGG + Intronic
1039854356 8:41399562-41399584 TGAAAGGAGAGGGAGTGATACGG - Intergenic
1040685822 8:49871652-49871674 TCTGAGGAGAAGGAGAGATGGGG + Intergenic
1040778299 8:51073865-51073887 GGTGAGAACAGGGAGGTATGTGG - Intergenic
1040812831 8:51475770-51475792 GGTGAGGGAAGGGAGGGAGGGGG - Intronic
1041028623 8:53712599-53712621 AGAGAGGAGAGGGAGTGAACAGG + Intergenic
1041678053 8:60556225-60556247 GGTGAGGATAGGGAGTGGTTGGG + Intronic
1041771215 8:61474403-61474425 TGTGAGCAGAGGGAGAGATGGGG + Intronic
1043268963 8:78304570-78304592 TGTGTGTAGAGGGAGTGAAGGGG + Intergenic
1043296179 8:78666164-78666186 GGTGAGGCGATGAAGGGATGAGG + Exonic
1043638341 8:82414827-82414849 TGTGAGTAGAGGGAGGGAGGAGG - Intergenic
1043979809 8:86624631-86624653 GGAGAGGAGAGAGAGGAATGAGG - Intronic
1044870116 8:96611206-96611228 GGGAAGGAGATGGAGTTATGAGG + Exonic
1045043009 8:98244578-98244600 GGTGATGAGAGGGTGGGCTGTGG + Intronic
1045043014 8:98244599-98244621 GGTGATGAGAGGGTGGGCTGTGG + Intronic
1045092960 8:98766059-98766081 GGTGAAGAAATGGAGTGATAAGG - Intronic
1045127778 8:99113026-99113048 GGTGGGGAGAGGGAGAGGAGGGG - Intronic
1045491265 8:102671234-102671256 AGGGAGGAGAGGGAGGGTTGGGG - Intergenic
1046611111 8:116426636-116426658 GTGGAGGAGAGGGAGTGACAAGG - Intergenic
1046630690 8:116620033-116620055 GGAGAGGAGAGAGAGAGATAAGG + Intergenic
1046786786 8:118275702-118275724 AGAGAGGAGAGAGAGGGATGGGG - Intronic
1047453133 8:124984772-124984794 GGTGATGAGAGGAAAGGATGGGG - Intergenic
1048423683 8:134302657-134302679 TATGTGGAGGGGGAGTGATGAGG + Intergenic
1048788065 8:138073049-138073071 AGAGAGGGGAGGGAGTGAGGGGG + Intergenic
1048925552 8:139267828-139267850 TGAGAGGAGAGGAAGGGATGGGG - Intergenic
1049217793 8:141415729-141415751 GGTGGGGAGAGGGTGTGGGGTGG + Intronic
1049217804 8:141415752-141415774 GGTGGGGAGAGGGTGTGGGGTGG + Intronic
1049510951 8:143026398-143026420 GGTGAGGAGAGGAGGGGCTGCGG + Intergenic
1049644236 8:143728894-143728916 GGTGTGGAAAGGGGGTGCTGGGG + Intronic
1049695386 8:143981935-143981957 GGTGATGACAGTGAGTGGTGAGG + Intronic
1049871431 8:144980920-144980942 GTTGGGGAGAGGGAGAAATGGGG + Intergenic
1050364480 9:4861608-4861630 GGTACCGAGAGGGAGTGATGAGG - Intronic
1051059962 9:13034436-13034458 GAAGAGGAGAGGGAGGGACGTGG - Intergenic
1052474573 9:28942356-28942378 AGTGAGGAGAGTAAGTGATGGGG + Intergenic
1053071382 9:35104068-35104090 GTTGGGGAGAGGGTGTGAAGGGG - Intergenic
1053221277 9:36315327-36315349 TGTGAGGGGAGGGGGGGATGTGG + Intergenic
1053329240 9:37188655-37188677 GGGGAGGAGAGGGAGGGGAGGGG - Intronic
1053329271 9:37188720-37188742 GGTGAGGAAGGGGAGGGGTGAGG - Intronic
1053654009 9:40197331-40197353 GGGGAGGGGAGAGAGTGGTGAGG + Intergenic
1054898812 9:70345426-70345448 GGTGAGGAGATGGAGTGACATGG + Intronic
1055073911 9:72194501-72194523 GGAGAGGAGAGGGAAGGGTGGGG - Intronic
1055387102 9:75774513-75774535 GGTGGGGAGAGAGAGGGAGGGGG - Intergenic
1055453500 9:76452597-76452619 GGGGAGGAGAGGCAGGGAGGAGG + Intronic
1055786982 9:79881608-79881630 AGGGAGGAGAGGGAGGGAAGAGG - Intergenic
1056474863 9:86944291-86944313 GGTGAGGAGGGGGGTTGAGGGGG - Intergenic
1056922244 9:90801503-90801525 GGGGAGGAGGGGGACCGATGCGG + Intergenic
1057186089 9:93058415-93058437 GGTGAGAACAGGAAGGGATGGGG + Intergenic
1057195877 9:93115491-93115513 GGAGAGGTGAGGGAGGGGTGAGG + Intergenic
1057491174 9:95521017-95521039 GGCCAGGATAGGGAGTGAGGGGG - Intergenic
1057721483 9:97535425-97535447 GGTGAAGAGAGGGAGTGCAGGGG - Intronic
1057852498 9:98576227-98576249 GGTGAAGAGAGTGAGTGACAGGG - Intronic
1058190722 9:101911944-101911966 GGTTAAGAAAGGGAGTAATGGGG + Intergenic
1058425165 9:104869608-104869630 GCTGAGGAGAAGGGGTGAGGCGG + Intronic
1058660574 9:107263735-107263757 GCTGGGGAGAGGGAGAAATGGGG + Intergenic
1058811016 9:108639598-108639620 GGAGAGGAGAGGGAGGGAGGAGG - Intergenic
1059112929 9:111573834-111573856 AGTGTGGAGCGGGAGGGATGTGG + Intronic
1059228670 9:112697016-112697038 GGAAAGGAGAGGGACTGAGGTGG - Intronic
1059705646 9:116820833-116820855 AGGGAGGAGAGGGTGTGATGGGG - Intronic
1059760077 9:117329441-117329463 GGAGAGGAGAGGGAGAGGAGAGG + Intronic
1060034823 9:120245800-120245822 GGTAGGGAGAGGGAGGAATGTGG + Intergenic
1060049561 9:120368048-120368070 GGTGGTGAGAGGGAGGAATGAGG + Intergenic
1060150862 9:121287242-121287264 GGGGAGGAGTGGGAGGGAGGCGG + Intronic
1060290681 9:122299772-122299794 AAAGAGGGGAGGGAGTGATGGGG + Intronic
1060656167 9:125374189-125374211 GCTCTGGAGAGGGAGGGATGGGG - Intergenic
1061128268 9:128689923-128689945 GGGGAGGAGAGCGAGGGAGGGGG - Intronic
1061330649 9:129890281-129890303 GGTGGGGAGGGGGAGCGATGAGG + Exonic
1061359464 9:130131848-130131870 GGAGAGGATCGGGAGTGAAGAGG - Intronic
1061521775 9:131122511-131122533 AGAGAGGAGAGGCAGTGAGGAGG - Exonic
1061568627 9:131461456-131461478 GTTGAGGAGTGGGAGGGCTGGGG + Intronic
1062039822 9:134399181-134399203 GGTGAGGTGGGGCTGTGATGAGG + Intronic
1062165807 9:135106709-135106731 GGTCAGGAGAGGGAGGGCGGGGG - Intronic
1062726816 9:138078788-138078810 GGAGAGGCAAGGGAGTGAGGTGG + Intronic
1203492344 Un_GL000224v1:118993-119015 GGTGGGGAAGGGGAGGGATGAGG + Intergenic
1203504967 Un_KI270741v1:60865-60887 GGTGGGGAAGGGGAGGGATGAGG + Intergenic
1185535513 X:858483-858505 GGGGAGGTGAAGGAGTTATGGGG - Intergenic
1185576275 X:1175237-1175259 GGTGAGAAGAAGGAGAGATGAGG - Intergenic
1185777844 X:2819967-2819989 GGAGAGGAGAAGGGGTAATGAGG + Intergenic
1185785116 X:2884201-2884223 GGTAGGGAGAAGGGGTGATGGGG + Intergenic
1186015721 X:5191050-5191072 GGTGGAGACAGGGAGAGATGAGG - Intergenic
1186378526 X:9033564-9033586 GGGGAGAAGTGGGAGTGAGGCGG - Intronic
1186598477 X:11010009-11010031 GATGTGGTGGGGGAGTGATGGGG - Intergenic
1188403836 X:29782177-29782199 GGGGAGGAGAGAGAGAGAGGCGG + Intronic
1188968235 X:36580832-36580854 GGTGAGGTGAGGTGCTGATGAGG + Intergenic
1189222090 X:39381301-39381323 GGAGAAGGGATGGAGTGATGGGG - Intergenic
1189244134 X:39550213-39550235 GGGCAGGAGTGGGAGAGATGAGG + Intergenic
1189276281 X:39788334-39788356 GGTGGGGAGAGGCAGTGGTAAGG + Intergenic
1190179212 X:48177472-48177494 GGAGAGGAGAGGGAGAGGAGGGG + Intergenic
1190179240 X:48177532-48177554 GGAGAGGGGAGGGGGTGAAGGGG + Intergenic
1190390007 X:49922633-49922655 GGGGAGGAGGGGGAGCGAAGCGG - Exonic
1190751426 X:53365156-53365178 AGTAAGGATAGGGACTGATGGGG - Intergenic
1190803887 X:53816786-53816808 AGTGAGGATACGGACTGATGGGG - Intergenic
1191841796 X:65518465-65518487 GCTGAGCAAAGGGAGGGATGGGG + Exonic
1191852777 X:65598060-65598082 GGTAAGGAGAGGTAGAAATGGGG - Intronic
1192086053 X:68098441-68098463 GGTGTGGAGAGTGAGTGTTTCGG - Intronic
1192185765 X:68945982-68946004 GGTGACAACAGGGAGTGGTGGGG - Intergenic
1192347960 X:70327515-70327537 GGTGAGGAGAGGGGAGGTTGGGG + Intronic
1193012801 X:76696684-76696706 GGAGAGGAGAGGGAAGAATGGGG + Intergenic
1193821942 X:86175520-86175542 TGTGAGGGGAGGGGGTCATGAGG + Intronic
1193860279 X:86657098-86657120 GGTGAGGTGAGGAGGTGATGTGG + Intronic
1194619195 X:96147881-96147903 GGTGAAGAAAGGGAGAAATGAGG + Intergenic
1194643922 X:96434915-96434937 GGTGAGGAGGGGATGGGATGAGG + Intergenic
1194784649 X:98067194-98067216 GCTGAGGGGAGGGAGAAATGGGG + Intergenic
1194835146 X:98672636-98672658 GGGGAGGAGAGGGAAGAATGAGG - Intergenic
1195067611 X:101251932-101251954 GGTGATGACAGGGAGAGTTGTGG - Intronic
1195238364 X:102925351-102925373 GGGGAGGTGAGGGAGAGGTGGGG - Intergenic
1195274964 X:103273148-103273170 GGTGAGGGTATGGAGTGTTGCGG - Intergenic
1196150118 X:112364292-112364314 GGGGAGTAGAGGGTGTGTTGTGG - Intergenic
1196609516 X:117695486-117695508 GGTGAAGAGAGGGAGGAGTGGGG + Intergenic
1196614506 X:117752550-117752572 TGTGAGAAGTGGCAGTGATGTGG - Intergenic
1197313814 X:124939286-124939308 AGTTAGGAGAGGGACTGATTGGG - Intronic
1197846509 X:130810071-130810093 GGTTGGGAGAGGGATTGACGTGG - Intronic
1197875041 X:131093448-131093470 GGTTAGGAAAGGGGGTGGTGGGG - Intergenic
1198785530 X:140283743-140283765 GGAGAGGAGAGGGAAGAATGAGG - Intergenic
1199076266 X:143530115-143530137 GGAGAGGAGATGGAATGGTGAGG - Intergenic
1199531413 X:148851868-148851890 TGAGAGGAGAGGGTGTGAGGAGG - Intronic
1199599940 X:149535866-149535888 GGGGAGGAGAGGGAGTGGGTTGG - Intergenic
1199743973 X:150760312-150760334 GGGGAGGGGAGGGAGTGCAGGGG + Intronic
1199790684 X:151152409-151152431 GGAGAGCAGGGGTAGTGATGGGG + Intergenic
1200054613 X:153453259-153453281 GTTGAGGCTAGGGAGGGATGGGG + Intronic
1200081004 X:153576317-153576339 GGTGAGGAGAGGCTCAGATGTGG + Intronic
1200754885 Y:6981719-6981741 GGTTAGGGGTGGGAGGGATGGGG + Intronic