ID: 953349792

View in Genome Browser
Species Human (GRCh38)
Location 3:42206906-42206928
Sequence GGGGCAGCCTGTTGAACAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 132}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953349785_953349792 11 Left 953349785 3:42206872-42206894 CCATCCTTGGGAGCGGGTGAGGA 0: 1
1: 0
2: 2
3: 17
4: 182
Right 953349792 3:42206906-42206928 GGGGCAGCCTGTTGAACAGTTGG 0: 1
1: 0
2: 0
3: 12
4: 132
953349786_953349792 7 Left 953349786 3:42206876-42206898 CCTTGGGAGCGGGTGAGGAGAGG 0: 1
1: 0
2: 1
3: 33
4: 386
Right 953349792 3:42206906-42206928 GGGGCAGCCTGTTGAACAGTTGG 0: 1
1: 0
2: 0
3: 12
4: 132
953349783_953349792 12 Left 953349783 3:42206871-42206893 CCCATCCTTGGGAGCGGGTGAGG 0: 1
1: 0
2: 0
3: 11
4: 95
Right 953349792 3:42206906-42206928 GGGGCAGCCTGTTGAACAGTTGG 0: 1
1: 0
2: 0
3: 12
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953349792 Original CRISPR GGGGCAGCCTGTTGAACAGT TGG Intronic
900318630 1:2071390-2071412 GCGACCGCCTGTGGAACAGTGGG + Intronic
900370270 1:2329117-2329139 GGGGGAGCCTGTTCACCTGTGGG + Intronic
900615685 1:3564757-3564779 GGGGGAGCCTGGTGCAGAGTGGG - Intronic
902747020 1:18481170-18481192 AGGGCAGCCTGCTGTACAGGAGG + Exonic
903335306 1:22620505-22620527 GGGGCAGCCTGGTGTGCAGCAGG + Intergenic
904841394 1:33373986-33374008 GGGGCAACATGTGGAAGAGTTGG - Intronic
905688430 1:39925579-39925601 GAGGCAGACTGAGGAACAGTTGG + Intergenic
906203795 1:43976163-43976185 GGGGCAGCCTGGTGAGTATTGGG + Exonic
907050477 1:51326762-51326784 GGGGCAGCCTGTGGAGAAATGGG - Intronic
907283927 1:53368465-53368487 AGGACAGCCTGTTTAACAGAAGG - Intergenic
912492870 1:110071465-110071487 GGGGCAGCCTTTGGAACAGGTGG + Intronic
915193271 1:154169796-154169818 GGGGCAGCCTGTGGAGCAGAGGG - Intronic
915931212 1:160062066-160062088 GGGGCAGTCTGTGGAGGAGTTGG - Intronic
922562717 1:226580682-226580704 GGGGCAGCATGGGGAGCAGTGGG - Intronic
923754739 1:236781464-236781486 GCCTCAGCCTCTTGAACAGTTGG - Intergenic
1067474510 10:46556870-46556892 TGGGCAGCCTGGAGAACAGGCGG - Intergenic
1070667723 10:78357206-78357228 GAGGCAGCCTGTTTAAAGGTTGG + Intergenic
1070727654 10:78803200-78803222 GGGGCAGCCAGTTGTACCCTGGG + Intergenic
1077362778 11:2148066-2148088 AGGGCAGCCTGTCCAACAGAAGG - Intronic
1077433108 11:2525851-2525873 GACGCAGCCTGGTGCACAGTAGG - Intronic
1077471479 11:2762898-2762920 TGGGCAGACAGATGAACAGTGGG - Intronic
1082615702 11:55356840-55356862 GGCCCTGCCTGGTGAACAGTGGG - Intergenic
1083200355 11:61117880-61117902 GGGCCATCCTGCTGGACAGTGGG + Intronic
1083330642 11:61896878-61896900 GAGGCTGCCTGTTGCTCAGTGGG - Intergenic
1083781719 11:64921738-64921760 GGGGCAGCCAGGAGAACAGGGGG + Intronic
1086844336 11:91730200-91730222 AGGCCAGCCTTTTGAACTGTGGG + Intergenic
1087488024 11:98783346-98783368 GGGGCAAGCTGGTGAAAAGTAGG - Intergenic
1088483567 11:110319763-110319785 GGGGCAGAGTTCTGAACAGTAGG - Intergenic
1089625703 11:119749369-119749391 GAGGCAGCCTGTGGAGCAGCAGG + Intergenic
1090236395 11:125151507-125151529 TGGGCAGTTTGTTGACCAGTGGG + Intergenic
1090758203 11:129813724-129813746 CGGGCAGCCTGTTGACCAAATGG - Intergenic
1091727644 12:2856893-2856915 GGGACAGCCTGTAGCCCAGTGGG + Intronic
1092291074 12:7159727-7159749 GCGGCTGCCTGTAGCACAGTTGG + Intergenic
1096716368 12:53493808-53493830 GGGGAAGCCTGGTGAACTGGAGG - Exonic
1098143810 12:67477879-67477901 GGGGCAGCATGTCGTGCAGTGGG + Intergenic
1103700710 12:122847504-122847526 GGGGCAGCCTATGGGGCAGTGGG + Intronic
1106118945 13:26841813-26841835 GGGACTGCATGTTGAAGAGTGGG + Intergenic
1106443434 13:29801238-29801260 GGGTGTGCCTGTTGAAGAGTGGG - Intronic
1107175607 13:37395007-37395029 GGGCCTGCCTGGTGAAGAGTCGG - Intergenic
1108691927 13:52866940-52866962 GAGGCAGCTTGCTGAACACTGGG + Intergenic
1108744816 13:53382025-53382047 TGGGCAGTCTCTTGAAAAGTTGG + Intergenic
1116660306 14:47701532-47701554 TGGGCAACCTCTTGAAAAGTTGG - Intergenic
1116997072 14:51335438-51335460 GGGACTGACTGTGGAACAGTGGG - Intergenic
1117349059 14:54862862-54862884 GGGGCACTCTGCTGAACAGCTGG + Intronic
1117349238 14:54864669-54864691 GGGGCACTCTGCTGAACAGCTGG - Intronic
1122296632 14:100709586-100709608 GAGGCAGCCGGGAGAACAGTCGG + Intergenic
1122647442 14:103204626-103204648 GGGGCAGGTTGTGGGACAGTGGG - Intergenic
1123075526 14:105665738-105665760 GGGACAGCATGTGGGACAGTGGG + Intergenic
1124719511 15:32099197-32099219 GGGGCAGCAGGCTGCACAGTGGG + Intronic
1126653883 15:50955597-50955619 GGGGTGGCTTGCTGAACAGTGGG + Intronic
1129245452 15:74276370-74276392 GGAGCAGCCTGTTGGGCAATGGG - Intronic
1130528213 15:84725114-84725136 TGGGCAGCCTAGTTAACAGTGGG - Intergenic
1131250640 15:90828015-90828037 GGGCCAGCCTGGTGAACATCAGG - Intergenic
1133321158 16:4914589-4914611 GGGGCAGCCTGTCCCAAAGTGGG + Intronic
1140275597 16:73505963-73505985 AAGGCACCCTGTTGAACAGTGGG + Intergenic
1140722843 16:77787018-77787040 GAGGCAGCCTGTTGAAAAACTGG - Intergenic
1145804118 17:27714301-27714323 GGGACAGCTTGTTAACCAGTAGG - Intergenic
1149437311 17:56644278-56644300 GGGGCAGTCTCTTGAAAAGCAGG - Intergenic
1151315092 17:73316991-73317013 GGGGCAACCTGCTGAGCAGCTGG + Intergenic
1153166887 18:2271950-2271972 GGGGCACACAGCTGAACAGTTGG + Intergenic
1156767847 18:40680236-40680258 GGGACAAACTTTTGAACAGTAGG - Intergenic
1160967419 19:1752859-1752881 CGGGCAGCCCATTGTACAGTTGG + Exonic
1163769284 19:19180883-19180905 GGGGCATCCTGCTTAAAAGTGGG + Intronic
1164423843 19:28121980-28122002 GGGGAAGCCTGATAAACAGATGG - Intergenic
1165145774 19:33729083-33729105 AGGGTATCCTGTTGCACAGTGGG - Intronic
1167154456 19:47729734-47729756 GTGGCAGCCTGGTCCACAGTGGG - Intronic
925688382 2:6495475-6495497 GGGGCGTCCTGTCGGACAGTAGG + Intergenic
927680076 2:25133167-25133189 GGGGCAGCCTGAGAAACTGTGGG - Intronic
930017731 2:46982407-46982429 GAGGCAGCCTGTTTCCCAGTAGG - Intronic
931540496 2:63324726-63324748 GGGACAGCTTGCTGACCAGTAGG - Intronic
933786046 2:85842462-85842484 GAAGAAGCCTGTTGAGCAGTAGG - Intronic
937259026 2:120573599-120573621 GGGGCAGCCTAAGGAAGAGTAGG + Intergenic
937991157 2:127663306-127663328 GGGGCAGCCTGCTGTTCAGGTGG - Intronic
938317865 2:130342350-130342372 GGATCAGCCTGCTGAACTGTCGG + Exonic
945971320 2:216234371-216234393 GATGCAGCCTGTTGAAGGGTAGG + Intergenic
946777970 2:223163750-223163772 GGGGCAGCTCCTGGAACAGTGGG - Intronic
948226340 2:236312069-236312091 TGGGTAACCTGTTGAACAATGGG - Intergenic
948868499 2:240786831-240786853 GGGGCTGCCTGCTGAGCAGAGGG + Intronic
949047152 2:241877420-241877442 GGGGCAGCCTCAGGAACGGTGGG + Intergenic
1170495780 20:16923754-16923776 GGGGTAGACTTTTGATCAGTGGG + Intergenic
1175009242 20:55718235-55718257 GGTACAGCCTGTGGAACTGTGGG + Intergenic
1179875177 21:44263363-44263385 GGGGCAGCCTGATGACCCCTTGG + Intergenic
1180069017 21:45426882-45426904 GGAGCTGCCTCTTGAACAGCAGG + Intronic
1183243527 22:36675887-36675909 GGTGGAGCCTGTCAAACAGTGGG - Intronic
1183406419 22:37632698-37632720 GGGGTAGCCTCTAGAACAGAGGG + Exonic
1184208942 22:43023889-43023911 GGGGCAGCCTGTGGAGCATTTGG + Intergenic
1185005135 22:48271435-48271457 GGGGCAGCCTGTGGTTCAGTGGG - Intergenic
953349792 3:42206906-42206928 GGGGCAGCCTGTTGAACAGTTGG + Intronic
954627832 3:52032284-52032306 GGGGCAGCCTGTTGCAGATACGG - Intergenic
954644672 3:52123795-52123817 GAGGCAGCCTGGTGGAAAGTAGG - Intronic
956122816 3:65983032-65983054 GCAGCAGCCTTTTGAACAGCTGG + Intronic
956236775 3:67080538-67080560 GAGACAGGCAGTTGAACAGTGGG - Intergenic
957543802 3:81610742-81610764 GGGGCACCGTGTTCCACAGTGGG + Intronic
960531222 3:118767518-118767540 GTGGCAGCCTGCTCAACAGTGGG - Intergenic
964223327 3:154369931-154369953 GGGGCTGCCTGTTGCCCTGTGGG - Intronic
964480026 3:157130739-157130761 GGGGGCGCCTGGTAAACAGTGGG - Intergenic
964680174 3:159329479-159329501 AGGGCAGCCTGTTGGAGAGGAGG - Intronic
967300136 3:188004635-188004657 GGGGCAGCAAGTTGAAGGGTGGG - Intergenic
967583618 3:191187926-191187948 GGGACAGCTTGCTGACCAGTAGG - Intergenic
968868499 4:3228504-3228526 GGGGCAGACTGTTAGACGGTAGG + Intronic
969363673 4:6681401-6681423 GGGGCAGCCTGCTGAATGGTGGG - Intergenic
971431559 4:26573440-26573462 GAGGTAGCCTCTTGATCAGTAGG + Intergenic
973741752 4:53925546-53925568 GGGGCAACCTTTTGTACCGTAGG - Intronic
973793338 4:54398038-54398060 GAGACAGCCTGGAGAACAGTAGG + Intergenic
975047987 4:69827330-69827352 GGGACAGCGTGCTGACCAGTAGG - Intronic
981405565 4:144363753-144363775 CAGGCAGCCTTTTGTACAGTAGG - Intergenic
982087844 4:151854324-151854346 GGGCCAGCATTTTGAAGAGTTGG + Intergenic
985782885 5:1880298-1880320 GGGGCATCCTGTCCAAAAGTGGG + Intronic
986746364 5:10748311-10748333 GGGGCTGCCTGTGGATCAGGGGG + Intronic
986776433 5:11018273-11018295 GGGCCAGTCTGTGGAGCAGTCGG - Intronic
991499210 5:67259492-67259514 GGAGCACCTTGTTGAACAGGTGG + Intergenic
994792205 5:104243227-104243249 GAGGCAGCCTGATGCACAGTGGG - Intergenic
995474479 5:112534108-112534130 GTGGCAGCCTGGTGCAGAGTTGG - Intergenic
997162909 5:131627982-131628004 GGAACAGCCAGTGGAACAGTTGG - Intronic
997774512 5:136588884-136588906 GGGGCAGGCTGCTGGACAGAGGG + Intergenic
1000946195 5:167426367-167426389 GGGGTAGCCTCCTGAACAGCTGG - Intronic
1003532743 6:6951771-6951793 GGGGCAGCCTTTGGAACAGCAGG + Intergenic
1003855405 6:10268643-10268665 GCAGCAGCCTGCTGCACAGTGGG + Intergenic
1004641720 6:17522184-17522206 TGGGAATCCTGTTGAAAAGTAGG - Intronic
1009539854 6:64940775-64940797 GGTGCAGACTGTTCAACAGTAGG - Intronic
1010074933 6:71788055-71788077 GGGACAGCTTGCTGACCAGTAGG - Intergenic
1013533661 6:111043208-111043230 GGGGCAATCTGATGAACTGTTGG - Intergenic
1015510993 6:134037914-134037936 GGAGCAGCATGTTGGACATTTGG - Intronic
1016177754 6:141100869-141100891 GAGTCATCCTGCTGAACAGTGGG + Intergenic
1016289009 6:142507119-142507141 GGGCCAGCCTGGTGAGGAGTAGG + Intergenic
1019312310 7:368837-368859 GGGGCACCCTGTGGGACATTAGG - Intergenic
1019436413 7:1024578-1024600 GGGGCAGTCTGCTGAACGCTAGG + Intronic
1022024067 7:26429409-26429431 GGGGCAGCCTGGAGAACACTTGG + Intergenic
1023519438 7:41035757-41035779 AGGGCAGCTTGTTGACCTGTGGG + Intergenic
1024544492 7:50505861-50505883 GGGGCAGTCTGTTTAAATGTAGG + Intronic
1033460335 7:141541709-141541731 GGGGCAAACTTTTGACCAGTGGG + Intergenic
1034923540 7:155102868-155102890 GGGGAAGTCTGCTGAGCAGTGGG - Intergenic
1037802677 8:22043981-22044003 GGGGCAGCCTTTGAAGCAGTGGG + Intronic
1044005457 8:86932020-86932042 GGGACAGCTTGCTGACCAGTAGG + Intronic
1045150344 8:99400223-99400245 GGGCCAGCATGTTCAAAAGTGGG - Intronic
1045520049 8:102895572-102895594 GTGGCTGCCTGTGAAACAGTGGG + Intronic
1049497212 8:142941702-142941724 GCCTCAGCCTCTTGAACAGTTGG - Intergenic
1053080594 9:35173129-35173151 GGGGCTGGCAGTTGGACAGTGGG + Intronic
1056686463 9:88767317-88767339 AGGGTAGGCTGTTGAACACTGGG + Intergenic
1059361102 9:113742641-113742663 AGGGCAGCCTGTTGATCTGAAGG + Intergenic
1059434109 9:114266193-114266215 GAGTCACCCTTTTGAACAGTGGG + Intronic
1059756021 9:117294063-117294085 GGGGAAGCCTCTTTAATAGTGGG - Intronic
1059763180 9:117358756-117358778 GAGGGAGGCTGTTGAACAGTTGG - Intronic
1060276771 9:122188492-122188514 GCGGGAGCCTGTTGTCCAGTTGG - Intronic
1196488957 X:116245998-116246020 GGGACAGCTTGCTGACCAGTAGG - Intergenic