ID: 953349795

View in Genome Browser
Species Human (GRCh38)
Location 3:42206916-42206938
Sequence GTTGAACAGTTGGAGGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 2, 2: 1, 3: 32, 4: 270}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953349785_953349795 21 Left 953349785 3:42206872-42206894 CCATCCTTGGGAGCGGGTGAGGA 0: 1
1: 0
2: 2
3: 17
4: 182
Right 953349795 3:42206916-42206938 GTTGAACAGTTGGAGGAGAAAGG 0: 1
1: 2
2: 1
3: 32
4: 270
953349783_953349795 22 Left 953349783 3:42206871-42206893 CCCATCCTTGGGAGCGGGTGAGG 0: 1
1: 0
2: 0
3: 11
4: 95
Right 953349795 3:42206916-42206938 GTTGAACAGTTGGAGGAGAAAGG 0: 1
1: 2
2: 1
3: 32
4: 270
953349786_953349795 17 Left 953349786 3:42206876-42206898 CCTTGGGAGCGGGTGAGGAGAGG 0: 1
1: 0
2: 1
3: 33
4: 386
Right 953349795 3:42206916-42206938 GTTGAACAGTTGGAGGAGAAAGG 0: 1
1: 2
2: 1
3: 32
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953349795 Original CRISPR GTTGAACAGTTGGAGGAGAA AGG Intronic
900850034 1:5135601-5135623 GTTGAGCTGATGGAGGAAAAGGG - Intergenic
902100697 1:13985677-13985699 GTTTGACAGTTGAAGGAAAATGG - Intergenic
904753913 1:32757657-32757679 GTGGGACTGTTGGAGGACAAAGG - Intronic
904890514 1:33776209-33776231 GCTGAAGATGTGGAGGAGAAAGG + Intronic
905043259 1:34977204-34977226 GTTGAACAGGTAGAGAAGCAGGG + Intergenic
906147241 1:43567346-43567368 GTTCAACAGTGGCAAGAGAAGGG - Intronic
906581200 1:46936397-46936419 GTTCCAAAGTGGGAGGAGAAGGG + Intronic
906602525 1:47142480-47142502 GTTCCAAAGTGGGAGGAGAAGGG - Intronic
908579865 1:65503162-65503184 GTTGAACAGGTGAAGCACAAAGG + Intronic
909204463 1:72737777-72737799 GTTGTAGAGTTGGTGGGGAAAGG + Intergenic
909965473 1:81904545-81904567 GTTGAAAAGTGGAAGGACAAGGG + Intronic
912306278 1:108570840-108570862 ATGGAACAGTTGGAGGATGAAGG + Intronic
913277249 1:117150766-117150788 GTGGAAGAGTTGAAGGAGAAAGG - Intronic
915309120 1:154998515-154998537 AAGGAACAGTTGGAGGAGAGGGG + Intergenic
915501386 1:156320882-156320904 ATGGTACAGTTTGAGGAGAATGG - Exonic
915605174 1:156945838-156945860 GTTTAATAGTGGGAGGAGTAGGG - Intronic
915630912 1:157153808-157153830 GTAGAACTGTTGGCAGAGAATGG + Intergenic
916376560 1:164160561-164160583 GTGTAACTGTTGGAGGAGAGGGG - Intergenic
917162171 1:172069974-172069996 GAGGAGCAGGTGGAGGAGAAAGG + Intronic
918229486 1:182515055-182515077 GATGAAAAGATGGAAGAGAAAGG - Intronic
923402797 1:233631316-233631338 GTTTAACTGTTGGGGAAGAATGG + Intronic
923519374 1:234724225-234724247 TTGGAACAGTTGGAGGAGAGAGG + Intergenic
1065357606 10:24857541-24857563 GCTGCACAATTAGAGGAGAATGG + Intronic
1065866437 10:29919133-29919155 GGTGAAGAGGTGGAGGAGAGAGG - Intergenic
1066162814 10:32752379-32752401 GTTGAAGACTTGGGGGAAAAAGG - Intronic
1068579259 10:58720670-58720692 GTTGGACAGGTAGAGGAGATCGG + Intronic
1068588471 10:58827885-58827907 GTTGAGAAGGAGGAGGAGAAGGG - Intronic
1068651324 10:59526077-59526099 GCTGAACAGCAGGAGGTGAAAGG - Intergenic
1069962046 10:72085075-72085097 GATGGACACTTGGAGGAGACAGG - Intronic
1071740851 10:88356219-88356241 GTTGGACAGTGGGTGCAGAATGG - Intronic
1072563150 10:96595591-96595613 GTGGAACAGGTGGAGGAGGATGG + Exonic
1073927467 10:108533546-108533568 TGTGAACGTTTGGAGGAGAAAGG - Intergenic
1074016634 10:109541641-109541663 TTTGATCATTTGAAGGAGAAGGG + Intergenic
1074125678 10:110527305-110527327 GATGAAGTGTTGGAGGAGGAAGG + Intergenic
1075056489 10:119222675-119222697 TGTTAACAATTGGAGGAGAATGG + Intronic
1077753449 11:4999935-4999957 GTGGAAAAGTTGGAGGACAGAGG - Intergenic
1080171435 11:29307800-29307822 GCTGAACACATGGAGGAGATAGG - Intergenic
1080612989 11:33921120-33921142 GTGGTATAGTTGGAAGAGAATGG + Intergenic
1080651337 11:34225151-34225173 GCTGAGCAATTGGAGGAGACGGG - Intronic
1080803381 11:35629981-35630003 TATAAACAGGTGGAGGAGAAGGG - Intergenic
1081825147 11:46043039-46043061 GTAGGACAGTAGGATGAGAAAGG - Intronic
1081830536 11:46108615-46108637 GTTTAAAAGTAGGATGAGAACGG + Intronic
1082203115 11:49397910-49397932 GTTGAGGAGTGGGAGGAGGATGG - Intergenic
1083839721 11:65297348-65297370 GGTGAACAGTTGGGTGGGAAAGG + Exonic
1084231238 11:67754910-67754932 GGTGAACAGTTGAGGGAGAAAGG - Intergenic
1088848758 11:113688902-113688924 ATTGAACAGATGAAGGAGAGTGG + Intronic
1090493864 11:127190965-127190987 GTTGAACATTTGGAGGTGCTGGG - Intergenic
1090649564 11:128794225-128794247 GTTGGCCATTTAGAGGAGAAGGG + Intronic
1090856171 11:130610885-130610907 GTTCAAAGGTTGGAGGAGAAGGG - Intergenic
1092981935 12:13804440-13804462 ATTGAACAGATGGAAGAGACAGG - Intronic
1093658295 12:21723317-21723339 GTTGAACAGATGGAGGAGAATGG + Intronic
1094085573 12:26587732-26587754 GTGGAGGAGATGGAGGAGAAAGG - Intronic
1094371073 12:29738002-29738024 CTTCTACAGTTGGAGAAGAAAGG - Intronic
1095671005 12:44860026-44860048 GATTAACATTTTGAGGAGAAAGG + Intronic
1097483143 12:60157379-60157401 GGTGAAGATTTGGAGTAGAATGG - Intergenic
1099518470 12:83628826-83628848 GTGGAACATTTGGATGAGAGAGG - Intergenic
1099993515 12:89752467-89752489 GTTGAGCAGGGGGAGGAGAGTGG - Intergenic
1102405198 12:112667389-112667411 GATGAACACTTGGAGAAAAAAGG - Intronic
1106343169 13:28850610-28850632 GTTAAACAGTAGAGGGAGAAGGG + Intronic
1107083702 13:36403299-36403321 GTTAAACAGCAGGAGGACAAAGG - Intergenic
1107578426 13:41753025-41753047 CTTGAAGGGTTGGGGGAGAAAGG + Intronic
1108197659 13:48010931-48010953 GATGAAGAGATGGAGGAAAAAGG + Intergenic
1109648880 13:65298141-65298163 GATGAACAGGTGGAGCATAAGGG + Intergenic
1112041826 13:95554378-95554400 GTAGGACAGTTGGGGGACAAGGG + Intronic
1112289746 13:98135037-98135059 GCTGGGGAGTTGGAGGAGAATGG - Intergenic
1114947280 14:27699473-27699495 GATTAACACTTGGAAGAGAAGGG + Intergenic
1115994387 14:39180655-39180677 GAGGAAGAGTTGGAGGAGACAGG + Exonic
1117398072 14:55331212-55331234 GTTGCATATTTGGAGGAGACTGG + Intronic
1117590203 14:57259576-57259598 TTTGAATTGTTGGAGGAGAAAGG - Intronic
1118689075 14:68320947-68320969 TGTTAAGAGTTGGAGGAGAAAGG - Intronic
1119004726 14:70913276-70913298 GTAGAATAGTTGGAGGTGGAGGG + Intronic
1120782553 14:88498594-88498616 TTCGCACAGTTGGAGGGGAAAGG + Intronic
1121603463 14:95223423-95223445 GTGGAAAAATTGGAAGAGAAAGG - Intronic
1124599833 15:31124785-31124807 GATGAACAGTTGGAGTACAGGGG + Intronic
1125608596 15:40956269-40956291 GGGGAACTGGTGGAGGAGAAGGG - Exonic
1125970421 15:43906952-43906974 TCTGAATAGCTGGAGGAGAAAGG - Intronic
1127740785 15:61902324-61902346 TTTGAAGAGTTGGAGTAGAATGG - Intronic
1127863841 15:63015465-63015487 GCTGAACTGATGAAGGAGAAGGG + Intergenic
1128179692 15:65590898-65590920 GAGGAATAGTTTGAGGAGAAAGG + Intronic
1129912658 15:79241179-79241201 GTCTAACAGTTGGAGATGAAAGG - Intergenic
1131202568 15:90412385-90412407 TCTGAGCAGTTGTAGGAGAAAGG - Intronic
1131293839 15:91130099-91130121 CCTGAACAGTGGTAGGAGAAAGG + Intronic
1132414724 15:101612189-101612211 GATGCACAGTGGGAGGAGGATGG - Intergenic
1133346772 16:5076335-5076357 GTTGAGCAAATGGAGCAGAATGG + Intronic
1134531410 16:14987074-14987096 GTTTAAGAGTTGGTGGAAAAAGG + Intronic
1139864929 16:70053933-70053955 GTTTAAGAGTTGGTGGAAAAAGG - Intergenic
1140071556 16:71654936-71654958 GTTGTACATTTTGAGGAGGAAGG - Intronic
1143212742 17:5201109-5201131 GTTTTACAGTTGAAGGGGAAGGG + Intergenic
1145300230 17:21629377-21629399 GGGTAACAGCTGGAGGAGAAGGG + Intergenic
1145918078 17:28588446-28588468 ATTGAACAGCTGGAGGAACATGG + Intronic
1148126798 17:45241487-45241509 GTGGAGGAGCTGGAGGAGAAGGG + Exonic
1150075950 17:62192211-62192233 GATGAATATTTGGAGGAGACTGG - Intergenic
1203166644 17_GL000205v2_random:103259-103281 GGTGCACAGCTGGAGAAGAATGG + Intergenic
1153120198 18:1714884-1714906 GTTGACCAGAAGGAGGAGATAGG - Intergenic
1153166889 18:2271960-2271982 GCTGAACAGTTGGTGAAGCAGGG + Intergenic
1154230344 18:12550907-12550929 ATTAAACAGTTGCAGGAGGAAGG - Intronic
1155855992 18:30835258-30835280 GATGAATAGTTGGAGGATATAGG + Intergenic
1156457927 18:37305048-37305070 GGGGAACAGGAGGAGGAGAAGGG + Intronic
1156941834 18:42776997-42777019 GTAGAAAAGATGGAGGAAAATGG + Intronic
1156950414 18:42889981-42890003 GCTGAACATTTGGAGGAGATGGG - Intronic
1157714180 18:49871801-49871823 GTAGAACAGTGGGAGGTGAGTGG - Intronic
1157777597 18:50407991-50408013 GCCTAACAGTAGGAGGAGAAGGG - Intergenic
1158351163 18:56566115-56566137 GCTGAACTGATGGTGGAGAAAGG + Intergenic
1159215236 18:65383895-65383917 GTGGGACAGTGGGAGGAGAAGGG + Intergenic
1162090136 19:8274189-8274211 GTGGAGGAGTTGGTGGAGAAGGG - Intronic
1162092370 19:8289052-8289074 GTGGAGGAGTTGGTGGAGAAGGG - Intronic
1163781408 19:19251038-19251060 GTTGCACATTTGGGGGAGGAAGG - Exonic
1163976032 19:20853138-20853160 TTTGATCCTTTGGAGGAGAAGGG - Intronic
925038848 2:714598-714620 GTTTAATGGTTGGAGGAGCATGG + Intergenic
925075281 2:1011368-1011390 TTTTAACAGTTAAAGGAGAATGG - Intronic
925450628 2:3966492-3966514 GTTGAAAAGTTACAGGAGATTGG - Intergenic
926044447 2:9699381-9699403 GTTCACCAACTGGAGGAGAAAGG + Intergenic
926207512 2:10844615-10844637 TTTGGACAGTAGGAGGAGAATGG + Intergenic
926381721 2:12297198-12297220 GTGGAACAGTTACAGGAGGAGGG + Intergenic
930735685 2:54776208-54776230 GTGGAAAAGGAGGAGGAGAAAGG + Intronic
931527906 2:63178262-63178284 TTGGAAGAGTTTGAGGAGAATGG + Intronic
933346086 2:81087486-81087508 GTTGTTCAGTTTGTGGAGAAGGG + Intergenic
934925299 2:98377897-98377919 GTTGAAGATTTGGAAAAGAAAGG + Intronic
935642551 2:105304945-105304967 GATGAACAGGTGGAGCACAAAGG + Intronic
937695332 2:124802578-124802600 TCTGGACGGTTGGAGGAGAAAGG + Intronic
939352075 2:141051638-141051660 CTTTCTCAGTTGGAGGAGAATGG - Intronic
940190670 2:151037154-151037176 GCTGAACACATGGAGGAGCAAGG + Intronic
940901682 2:159131547-159131569 GTGGAGCAGGTGGAGCAGAAAGG - Intronic
941246507 2:163104801-163104823 GTTGAAGGGTTGGAGGAAAAGGG - Intergenic
943013998 2:182489294-182489316 GTTAAAAAGATGGAAGAGAAGGG + Intronic
943839937 2:192566786-192566808 GTTGAATAGGTGAAGCAGAAGGG + Intergenic
943944294 2:194039230-194039252 GATGAACAGGTAGAGCAGAAAGG + Intergenic
945317825 2:208390111-208390133 GTTCAAAAATTTGAGGAGAAGGG - Intronic
946756029 2:222948642-222948664 ATTTAACAGGAGGAGGAGAAAGG - Intergenic
947043618 2:225952006-225952028 GTTGAACAGTTTGAGGAGAATGG - Intergenic
947487237 2:230562793-230562815 GTAGATCATTTTGAGGAGAATGG - Intergenic
948029058 2:234801427-234801449 GTTTAACAGTTTGAGGAGAAGGG - Intergenic
1171956100 20:31464920-31464942 TTTGAACACTGGGAGGAAAATGG + Intergenic
1173145141 20:40518395-40518417 TTGGAAGAGTTGGAGGAGAAAGG + Intergenic
1174013806 20:47471891-47471913 TTTGCATAGTTGGAGGAAAATGG - Intergenic
1174126673 20:48311654-48311676 GCTGGGCAGTTGGAGGAGAGAGG - Intergenic
1175906967 20:62385513-62385535 GTAGAACAGTGGGAGGAGGGGGG + Intergenic
1175978832 20:62727025-62727047 GGTGCACAGCTGGAGGAGAAGGG + Intronic
1176249480 20:64113474-64113496 GTGGGAAGGTTGGAGGAGAAAGG + Intergenic
1176334898 21:5587307-5587329 GGTGCACAGCTGGAGAAGAATGG - Intergenic
1176392859 21:6233641-6233663 GGTGCACAGCTGGAGAAGAATGG + Intergenic
1176405108 21:6355838-6355860 GGTGCACAGCTGGAGAAGAATGG - Intergenic
1176432049 21:6633266-6633288 GGTGCACAGCTGGAGAAGAATGG + Intergenic
1176468560 21:7082533-7082555 GGTGCACAGCTGGAGAAGAATGG - Intronic
1176492121 21:7464311-7464333 GGTGCACAGCTGGAGAAGAATGG - Intergenic
1176508521 21:7674072-7674094 GGTGCACAGCTGGAGAAGAATGG + Intergenic
1177028139 21:15948010-15948032 TTTGAACACTTGGAGTGGAAGGG - Intergenic
1178428469 21:32498481-32498503 GGTGAGCAGTTGAGGGAGAAAGG + Intronic
1181595261 22:23910312-23910334 GGTGAAGAGTTGGAGGAGGGTGG - Intergenic
1181755671 22:25022760-25022782 GGTGAACAGATGGAGAACAAAGG - Intronic
1182649213 22:31837011-31837033 GTTGCACAGTTGGAGTGGACTGG + Exonic
1182722568 22:32415241-32415263 GTTGCACAGCTGGAGGTGAGCGG - Intronic
1183254289 22:36752148-36752170 TTTGTACATGTGGAGGAGAAAGG + Intergenic
1184933202 22:47697234-47697256 GTTGAACAGGTGGAGCAAAAGGG - Intergenic
949361468 3:3236673-3236695 GTAAAACAATTGGAGAAGAAGGG - Intergenic
950066598 3:10116596-10116618 GTTAAACACTTGGAGAAGAAGGG - Intronic
951743406 3:25949301-25949323 GTTGAAGACTTTGAGGAGAAAGG + Intergenic
952412267 3:33060089-33060111 GTTGGAGAGTGGGAGAAGAATGG + Intronic
953339951 3:42125089-42125111 GTAGAACGCTTGAAGGAGAATGG + Intronic
953349795 3:42206916-42206938 GTTGAACAGTTGGAGGAGAAAGG + Intronic
954021006 3:47741568-47741590 GTTGAGTAGTTGGAGGAGTAAGG - Intronic
955500952 3:59582320-59582342 GAGGAGCAGATGGAGGAGAAGGG - Intergenic
956214131 3:66830912-66830934 TTTGATCAGTGAGAGGAGAAAGG + Intergenic
956817302 3:72919795-72919817 GTTGAAAAGTTGGAGCAGAGAGG + Intronic
957047780 3:75389795-75389817 GGTGAACAGTTGAGGGAGAAAGG - Intergenic
958801558 3:98762113-98762135 GTTGAAAAGCTGAAAGAGAAGGG + Intronic
959651690 3:108756854-108756876 GAGGAAGAGGTGGAGGAGAATGG - Intronic
960606943 3:119515889-119515911 GGTGAACAGGTGGAGGACGAAGG - Intronic
960970854 3:123139234-123139256 GTGGGACAGTTGGAGGAGGAGGG - Intronic
961210812 3:125124078-125124100 GCTGCTCAGTGGGAGGAGAAAGG + Intronic
961423583 3:126827687-126827709 GTTACAAAGTTAGAGGAGAATGG + Intronic
961879857 3:130053921-130053943 GGTGAACAGTGGAGGGAGAAAGG - Intergenic
962109625 3:132430657-132430679 GTGGAACAATGGGAAGAGAAAGG - Intronic
962371177 3:134822006-134822028 GTTGAAAAGGAGGAGGAGGAAGG + Intronic
962823712 3:139079688-139079710 GATGAACAGTTGGAGCACAGTGG - Intronic
963015959 3:140824014-140824036 GCTGAGTAGATGGAGGAGAAAGG - Intergenic
963735970 3:149018360-149018382 GTTGTACAGTTAGAGCATAATGG + Intronic
964861634 3:161208977-161208999 TATGAGCAGTTGAAGGAGAATGG - Intronic
965009440 3:163067053-163067075 GTTGATGAGGTTGAGGAGAAAGG + Intergenic
965362792 3:167762289-167762311 GTTGATTATTTGGAGGAGAAGGG - Intronic
967154416 3:186679444-186679466 CTTGAACAGGGAGAGGAGAAAGG + Intergenic
968992072 4:3921030-3921052 GGTGAACAGTTGAGGGAGAAAGG - Intergenic
969510548 4:7615108-7615130 GATGAACAGATGGAGGACAATGG - Intronic
969823271 4:9736649-9736671 GGTGAACAGTTGAGGGAGAAAGG + Intergenic
971020512 4:22530554-22530576 GTAGAAAAATTAGAGGAGAAAGG + Intergenic
971466126 4:26963575-26963597 GTTAAACTCCTGGAGGAGAAAGG - Intronic
972789978 4:42362148-42362170 GTAGAAGAGGTGGAAGAGAATGG + Intergenic
973530897 4:51835961-51835983 GTGGAGCAGTGGGAGGAGGAAGG - Intergenic
973720042 4:53714024-53714046 GCTGGAGAGTTGGAGGGGAATGG + Intronic
974840073 4:67289163-67289185 GTGGAAGAATTGGGGGAGAAGGG + Intergenic
977298340 4:95236429-95236451 GTTGAGCAGTTGGGGGAGGGGGG + Intronic
977579737 4:98712197-98712219 GTTTTACAGTGAGAGGAGAAGGG + Intergenic
979742518 4:124168589-124168611 TGTGATCATTTGGAGGAGAAGGG - Intergenic
980079383 4:128327917-128327939 ATTGAGCAGTAGGAGGATAAGGG - Intergenic
981162341 4:141513672-141513694 TATGAACAGTTGGGGAAGAATGG - Intergenic
982537571 4:156625872-156625894 GTACAACAGTTGGAGTTGAAAGG - Intergenic
982796175 4:159647793-159647815 ATAAAACAGTAGGAGGAGAAAGG - Intergenic
983971730 4:173883520-173883542 ATTGAACATTTGGAGGAAAGTGG + Intergenic
985039232 4:185872379-185872401 CTTGTACAGATGGAGGAAAATGG - Intronic
986003900 5:3651564-3651586 GATGAGCAGATGGAGGAGAATGG + Intergenic
986276657 5:6281223-6281245 GTTAAATAGAAGGAGGAGAAAGG - Intergenic
987644724 5:20653862-20653884 GGTGGACAGTGGGAGGAGAGAGG + Intergenic
988434628 5:31159477-31159499 GATGAACAGGTGAAGCAGAAGGG - Intergenic
989403298 5:41032678-41032700 GTTGATCAGGAGGAGGATAAGGG + Intronic
990400465 5:55432473-55432495 TTGGAATAGTTAGAGGAGAATGG - Intronic
990490456 5:56298234-56298256 GCTAATGAGTTGGAGGAGAAAGG + Intergenic
992451207 5:76877803-76877825 GTAGAACAATTGAAGAAGAAAGG + Exonic
993166427 5:84360157-84360179 GTTGAAGATTTGAAGGAGAGTGG + Intronic
993523702 5:88937959-88937981 GGAGAATAATTGGAGGAGAATGG - Intergenic
994556496 5:101313255-101313277 GTTTAGCACTTGGAGGATAAAGG - Intergenic
996110647 5:119562562-119562584 GATGAACAGCTGGAACAGAAAGG - Intronic
996125305 5:119719408-119719430 GTTGAAGAGGAGGAAGAGAAGGG - Intergenic
999030458 5:148284652-148284674 TTTGAACAATAGGAGGAGAAGGG + Intronic
999081704 5:148850416-148850438 GTTGACCAGTAAGATGAGAATGG + Intergenic
999109151 5:149102263-149102285 TTGGAATAGTTTGAGGAGAATGG - Intergenic
1000980684 5:167813469-167813491 GTTGCAGTGTTGGAGGAGCAGGG + Intronic
1001172706 5:169435914-169435936 GTTGAGTAGTTGGAAAAGAAAGG - Intergenic
1003479414 6:6517458-6517480 TTTCAACAGTTGTACGAGAATGG + Intergenic
1008188904 6:48430158-48430180 TTTGTACAACTGGAGGAGAAAGG - Intergenic
1010625221 6:78130737-78130759 GCTGTCCTGTTGGAGGAGAAAGG + Intergenic
1011698383 6:89933387-89933409 GTTGAACAGGTGGAGCACAGAGG + Intronic
1012267371 6:97162084-97162106 CTTGAAGAGTTGGAGGATGAAGG + Exonic
1012423253 6:99087681-99087703 GATGAAAAGATGGAGGAAAAAGG - Intergenic
1013259440 6:108426559-108426581 GGTAAACAGTGGGAGAAGAATGG + Intronic
1013405750 6:109841330-109841352 GGGCATCAGTTGGAGGAGAATGG - Intergenic
1013501006 6:110751221-110751243 GCTGAACAGCTGGAGGTGAGTGG + Intronic
1013611599 6:111801074-111801096 GATGCACAGTGGGAGAAGAATGG + Intronic
1014925968 6:127270514-127270536 TTTTTAAAGTTGGAGGAGAAGGG - Intronic
1015512239 6:134049325-134049347 TTTGGACAGTTGGGGGTGAAGGG + Intronic
1016370494 6:143368861-143368883 GTGAAATATTTGGAGGAGAATGG + Intergenic
1019326957 7:443223-443245 GATGGACAGATGGATGAGAATGG + Intergenic
1019551704 7:1606592-1606614 GGGGAAGAGTGGGAGGAGAAGGG - Intergenic
1020314890 7:6898601-6898623 GGTGAACAGTTGAGGGAGAAAGG - Intergenic
1020724908 7:11800165-11800187 TTTGAACTGTTGTAGGACAAGGG - Intronic
1021061466 7:16117843-16117865 GTTGCATATTTGGAGGAGCAAGG - Intronic
1022010155 7:26301770-26301792 CTTGAACAAATGGAGGAGACAGG + Intronic
1022873002 7:34498971-34498993 GTTGGCCATTTGGAGGAGGAGGG + Intergenic
1022990710 7:35704522-35704544 ATGGAACAGTGGAAGGAGAAGGG - Intergenic
1023178225 7:37454343-37454365 GTGGAACAGCTGGAGCAGAGGGG - Intergenic
1023420542 7:39974923-39974945 GTTGAACAGAGGAATGAGAAGGG + Intronic
1023685329 7:42728260-42728282 CTTCTAAAGTTGGAGGAGAAAGG + Intergenic
1024034262 7:45494510-45494532 TGTGATCATTTGGAGGAGAAGGG + Intergenic
1024678921 7:51662929-51662951 GTTGACTAGTTGGAGTAGGATGG + Intergenic
1026380604 7:69795648-69795670 GATGAGCAGTTGGATGCGAAAGG + Intronic
1028069238 7:86430484-86430506 GTTAATTAGTTGGAGAAGAAGGG - Intergenic
1028140774 7:87272854-87272876 TTTGAATAGTTTGAGGAGAATGG + Intergenic
1028441458 7:90867234-90867256 GTTTAAGACTTGGAAGAGAAAGG + Intronic
1030392919 7:108949408-108949430 GTTGAACATTTAGAAAAGAAAGG + Intergenic
1031250170 7:119370078-119370100 GTTTAACAGTTGATGGAAAATGG - Intergenic
1033891984 7:146024807-146024829 GCAGAACTCTTGGAGGAGAAAGG - Intergenic
1034856349 7:154551818-154551840 GAGGAGCAGTTGGAGGTGAAAGG + Intronic
1035636880 8:1154404-1154426 TTTGATCAGTTGGAAGAGAGGGG - Intergenic
1036668110 8:10761244-10761266 AGTGAACAGGTGGAGGAGGAGGG + Intronic
1036938366 8:13027029-13027051 GTTGAAGAGTTGGAGAAAAGTGG - Exonic
1037497348 8:19452498-19452520 TCTGAAGAGTTAGAGGAGAAGGG + Intronic
1038063477 8:23937696-23937718 TTTGAAAAGCTGGAGGTGAAAGG + Intergenic
1038366661 8:26942638-26942660 GTTGAACAGGTGGAGGTAATTGG + Intergenic
1038510578 8:28130665-28130687 GTTGTGCAGATGGAGGGGAAGGG + Intronic
1040939971 8:52822510-52822532 GGTGGACAGCTGGATGAGAAAGG - Intergenic
1041276107 8:56158959-56158981 GGTGAACAACTGGAGGTGAAGGG + Intergenic
1041455605 8:58055899-58055921 GTTGTACAGTTGGAGACAAAGGG + Intronic
1042376129 8:68055163-68055185 TTTAACCAGTGGGAGGAGAAAGG - Intronic
1043220502 8:77656137-77656159 GTTGAGCAGGTGGAGGAGCTGGG - Intergenic
1044186314 8:89255768-89255790 GGTGAACAGCAGGAGGAGAGCGG - Intergenic
1044445435 8:92269918-92269940 GTGGAACCCTTGGAGGATAATGG + Intergenic
1044757191 8:95476390-95476412 GTTGGACAGTTGGAGTGGATTGG + Intergenic
1044864713 8:96559271-96559293 TTTTAACAGTGAGAGGAGAAAGG + Intronic
1044904863 8:96990110-96990132 GCAGAGGAGTTGGAGGAGAAGGG - Intronic
1046281037 8:112032247-112032269 GTAGATCATTTGGGGGAGAATGG - Intergenic
1047118439 8:121871985-121872007 GATGAACAGTTGGAGGCTTAGGG - Intergenic
1047229819 8:122987123-122987145 GTTGGACATTTGGAGGTCAATGG + Intergenic
1047338025 8:123954879-123954901 AGTGAACATTTGGAGGCGAAGGG - Intronic
1047821452 8:128525724-128525746 GTTGAACAGTTGTAAGAGACTGG - Intergenic
1050975890 9:11937391-11937413 GTTGGAGAGTTGGAGGTGATTGG + Intergenic
1051368452 9:16338006-16338028 GTTGGCCAGATGGTGGAGAAGGG + Intergenic
1051996040 9:23219504-23219526 GTTGAGCAGGCGGAGTAGAAGGG - Intergenic
1052346135 9:27411687-27411709 GATGAACAGGTGGAGCAGAGGGG + Intronic
1052689979 9:31805035-31805057 TTTGAAAAGTTTGAGTAGAATGG - Intergenic
1053283493 9:36836380-36836402 GTTGCAGATTTGGAGGAGATGGG - Exonic
1055037396 9:71832524-71832546 CATGAACAGGGGGAGGAGAAGGG - Intergenic
1055746541 9:79452464-79452486 GTTGAACAGGAGTAGTAGAAAGG + Intergenic
1055889513 9:81107901-81107923 GGTGAAGAGTTGGGGCAGAAAGG + Intergenic
1057543450 9:95998574-95998596 GCAGAACAGTTAGAGAAGAAGGG + Intronic
1059032271 9:110711497-110711519 TTTGAAAATTTGAAGGAGAAAGG + Intronic
1059465030 9:114463359-114463381 TTTGAATAGGTGGAGGAGACTGG - Intronic
1059763179 9:117358746-117358768 GTTGAACAGTTGGATGCAACTGG - Intronic
1060112573 9:120917205-120917227 CTTGAACAGTTGCTGGAGAAAGG + Intronic
1203426741 Un_GL000195v1:47612-47634 GGTGCACAGCTGGAGAAGAATGG + Intergenic
1203439490 Un_GL000195v1:175446-175468 GGTGCACAGCTGGAGAAGAATGG - Intergenic
1186677116 X:11829981-11830003 GAAAAAGAGTTGGAGGAGAAGGG + Intergenic
1187595114 X:20762769-20762791 CTTGAACATTTTGAGAAGAAGGG + Intergenic
1189407422 X:40737290-40737312 GTAGGACAGTGGGTGGAGAAAGG - Intergenic
1190039019 X:47054110-47054132 GTAGCAGAGTTGGAGGAAAAGGG - Intronic
1190213817 X:48467420-48467442 GAAGAACAGCTGGAGGAGAAAGG + Intronic
1192873233 X:75204807-75204829 GTTTAACAGTTGGAAGAAAGAGG + Intergenic
1194041406 X:88946013-88946035 GGTGAACATTTGAAGGAAAAGGG - Intergenic
1194698560 X:97085896-97085918 GTTGATCAGAAGTAGGAGAATGG + Intronic
1194774095 X:97941996-97942018 AGTGAACAGTTGGAGTAGAATGG - Intergenic
1195811520 X:108837254-108837276 GTTGAGTAGATGGAGGAAAATGG - Intergenic
1198019592 X:132644942-132644964 GGGGTACATTTGGAGGAGAAGGG - Intronic
1198285425 X:135185614-135185636 ATTAAACAGATGGAGGAGGAGGG + Intergenic
1198287846 X:135210129-135210151 ATTAAACAGATGGAGGAGGAGGG - Intergenic
1198460918 X:136862278-136862300 GGTGCAATGTTGGAGGAGAAAGG - Intronic
1199017228 X:142832573-142832595 CTTGACCAGTTAGAGGACAATGG + Intergenic
1199214415 X:145249211-145249233 GTTTAACAGTTGGAAGTAAAAGG + Intronic
1200759914 Y:7028208-7028230 GATGAACAGTTGGACAGGAATGG - Intronic