ID: 953352014

View in Genome Browser
Species Human (GRCh38)
Location 3:42222873-42222895
Sequence CTGGCCACTGACCCTTTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 193}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953352003_953352014 8 Left 953352003 3:42222842-42222864 CCTGGGTCGTCCCTACCCCCCCT 0: 1
1: 0
2: 0
3: 6
4: 155
Right 953352014 3:42222873-42222895 CTGGCCACTGACCCTTTCTCTGG 0: 1
1: 0
2: 3
3: 20
4: 193
953352001_953352014 22 Left 953352001 3:42222828-42222850 CCCTCTCATCGTGTCCTGGGTCG 0: 1
1: 0
2: 0
3: 2
4: 62
Right 953352014 3:42222873-42222895 CTGGCCACTGACCCTTTCTCTGG 0: 1
1: 0
2: 3
3: 20
4: 193
953352009_953352014 -8 Left 953352009 3:42222858-42222880 CCCCCCTGCAGGAAACTGGCCAC 0: 1
1: 0
2: 1
3: 16
4: 222
Right 953352014 3:42222873-42222895 CTGGCCACTGACCCTTTCTCTGG 0: 1
1: 0
2: 3
3: 20
4: 193
953352010_953352014 -9 Left 953352010 3:42222859-42222881 CCCCCTGCAGGAAACTGGCCACT 0: 1
1: 0
2: 2
3: 11
4: 244
Right 953352014 3:42222873-42222895 CTGGCCACTGACCCTTTCTCTGG 0: 1
1: 0
2: 3
3: 20
4: 193
953352002_953352014 21 Left 953352002 3:42222829-42222851 CCTCTCATCGTGTCCTGGGTCGT 0: 1
1: 0
2: 0
3: 3
4: 42
Right 953352014 3:42222873-42222895 CTGGCCACTGACCCTTTCTCTGG 0: 1
1: 0
2: 3
3: 20
4: 193
953352006_953352014 -3 Left 953352006 3:42222853-42222875 CCTACCCCCCCTGCAGGAAACTG 0: 1
1: 0
2: 1
3: 23
4: 230
Right 953352014 3:42222873-42222895 CTGGCCACTGACCCTTTCTCTGG 0: 1
1: 0
2: 3
3: 20
4: 193
953352008_953352014 -7 Left 953352008 3:42222857-42222879 CCCCCCCTGCAGGAAACTGGCCA 0: 1
1: 0
2: 3
3: 26
4: 222
Right 953352014 3:42222873-42222895 CTGGCCACTGACCCTTTCTCTGG 0: 1
1: 0
2: 3
3: 20
4: 193
953352005_953352014 -2 Left 953352005 3:42222852-42222874 CCCTACCCCCCCTGCAGGAAACT 0: 1
1: 0
2: 2
3: 11
4: 171
Right 953352014 3:42222873-42222895 CTGGCCACTGACCCTTTCTCTGG 0: 1
1: 0
2: 3
3: 20
4: 193
953352011_953352014 -10 Left 953352011 3:42222860-42222882 CCCCTGCAGGAAACTGGCCACTG 0: 1
1: 0
2: 3
3: 22
4: 213
Right 953352014 3:42222873-42222895 CTGGCCACTGACCCTTTCTCTGG 0: 1
1: 0
2: 3
3: 20
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953352014 Original CRISPR CTGGCCACTGACCCTTTCTC TGG Intronic
900417572 1:2542164-2542186 CTGGCCACAGGCACTTCCTCAGG + Intergenic
900754925 1:4426778-4426800 CCAGGCACTGAACCTTTCTCAGG + Intergenic
901492251 1:9602527-9602549 CTGGCCAATGGCCCTTTCACTGG + Intronic
902435661 1:16396801-16396823 CTGGCAGCTGGCCCTTCCTCCGG - Exonic
902436179 1:16399313-16399335 CTGGGCTGGGACCCTTTCTCTGG + Intronic
908001744 1:59687280-59687302 CTGGCCACTCAGCTTTTCTTTGG + Intronic
908447411 1:64213284-64213306 CTGGAGACTGACCATTTCTAAGG - Intronic
910437749 1:87222283-87222305 CTGGCCACTGACCCAGACTGTGG - Intergenic
910705853 1:90128918-90128940 CTGGACATTCACCCTTTCTCAGG + Intergenic
911561386 1:99410330-99410352 TTGGCAATTGATCCTTTCTCTGG + Intergenic
912493858 1:110078722-110078744 CTGGCCCTTCACCTTTTCTCAGG - Intergenic
912954900 1:114148459-114148481 CTGAGCACTGACCGTTTCTGAGG - Intronic
913078339 1:115360098-115360120 CTGCCCAGTGGCCCTTTGTCTGG - Intergenic
914844475 1:151274305-151274327 CTCTCCACTGCCCTTTTCTCTGG - Intergenic
914998550 1:152565978-152566000 CTGACCACTGCCCCTGTCACAGG + Exonic
914999902 1:152579706-152579728 CTGACCACTGCCCCTGTCACAGG + Exonic
915001815 1:152600946-152600968 CTGACCACTGCCCCTGTCACAGG - Exonic
916056011 1:161069409-161069431 CAGGCCACTGCCCCTTCCCCAGG + Intronic
916292131 1:163178388-163178410 CTGTCCTCTGACATTTTCTCAGG - Intronic
917970179 1:180201229-180201251 CTGGCCAAGAATCCTTTCTCTGG - Exonic
919919727 1:202160771-202160793 CTGGCCCCTCACCCATTCCCAGG - Exonic
920146465 1:203865624-203865646 CTGGGAACTGACGCTATCTCAGG - Intronic
920376836 1:205513320-205513342 CTGGCCCTTGCCCCTTGCTCTGG + Intronic
921945082 1:220880479-220880501 CTGACCACTGACCCACTCCCCGG + Intronic
1063434355 10:6018369-6018391 CTGGCCTCTGAGCCTTTCTGAGG - Intronic
1066266193 10:33777782-33777804 CCTGCCACTGTCCTTTTCTCTGG + Intergenic
1071603572 10:86970529-86970551 CAGGCCTCTGACACCTTCTCTGG + Exonic
1073469163 10:103712266-103712288 CTGACCACTGAGCCATGCTCCGG + Intronic
1073570917 10:104580475-104580497 CTTGCCGCTGACATTTTCTCTGG + Intergenic
1074508598 10:114093396-114093418 CTGGCCTATGACAGTTTCTCAGG - Intergenic
1075427219 10:122351233-122351255 CTTTCCACTGACCCTCCCTCAGG - Intergenic
1077825532 11:5804895-5804917 CTAGTCACTGACCCTATTTCAGG - Intronic
1082808942 11:57467114-57467136 CTGGCCACTTCCACTTTCTGAGG - Intronic
1082864023 11:57882128-57882150 CTGTCCATAGCCCCTTTCTCTGG + Intergenic
1082911169 11:58376022-58376044 ATGGCCACTGGCTCTTTCTTTGG - Intergenic
1083656496 11:64232301-64232323 CTGGTCAGTGACCCTCACTCAGG - Intronic
1083666143 11:64275788-64275810 CTGGGCACTGCCCCTTGCCCAGG + Intronic
1083959508 11:66006800-66006822 CAGGCCACAAACCCTTTATCAGG + Intergenic
1084149830 11:67282915-67282937 TGGGCCACTGACCCCTACTCTGG + Intronic
1084270292 11:68025887-68025909 GTGGCCTCAGACCCTTTCTGAGG + Intronic
1086608319 11:88724307-88724329 CTCTGCACTGACCTTTTCTCAGG + Intronic
1092165620 12:6340874-6340896 CTGGAAAATGTCCCTTTCTCTGG - Intronic
1092526684 12:9313951-9313973 CTGACCACGGCCCCTTTCTCTGG - Intergenic
1092540589 12:9417828-9417850 CTGACCACGGCCCCTTTCTCTGG + Intergenic
1094512460 12:31104655-31104677 CTGACCACAGCCCCTTTCTCTGG - Exonic
1095893873 12:47260832-47260854 CTGAGCACTGACCCTGTGTCAGG + Intergenic
1097179210 12:57161577-57161599 ATGGCCCCTGACCCCCTCTCTGG + Intronic
1098450994 12:70617842-70617864 CTGCCCACCCACCCTTGCTCCGG - Intronic
1102628943 12:114259642-114259664 ATGGCCACTTAACCTTTCTGAGG - Intergenic
1103332601 12:120164565-120164587 CCTGCCACACACCCTTTCTCGGG + Intronic
1103512516 12:121484988-121485010 CTGGGCACAGACCCTTACACAGG + Intronic
1104589612 12:130073947-130073969 CTGGGCTCTGATGCTTTCTCAGG - Intergenic
1106413194 13:29525122-29525144 CTGGCCACTGTCCCCTGGTCAGG + Intronic
1107020748 13:35748261-35748283 CAGACCACTGACCCTTCCACTGG - Intergenic
1107337433 13:39370108-39370130 CTGGTCACTCAGCCTTTCTTAGG - Intronic
1109479726 13:62934052-62934074 CTGGCCACTCACCCTACCTTGGG + Intergenic
1113877178 13:113601690-113601712 CTGGCCACAGGCCCTTCCTCTGG - Intronic
1114308454 14:21444317-21444339 CTGGGTAGTGACCCTCTCTCAGG - Intronic
1115488698 14:33938260-33938282 CTGGCCTCTGAGCCTTTCAGTGG - Intronic
1115825790 14:37272448-37272470 TTGGTAACTGACCCTTTCTTTGG + Intronic
1117073421 14:52076593-52076615 CTGGCCACTGTCACCTCCTCTGG + Intergenic
1117197036 14:53350631-53350653 CTGGCCATTGAGCCTTACTGTGG + Intergenic
1118442002 14:65820912-65820934 CTGGCTACTGGACCTTTCCCAGG - Intergenic
1121395522 14:93619055-93619077 GTGTCCACTGACCCTTTATGAGG + Intronic
1124593037 15:31070107-31070129 TTGGCAACAGACCATTTCTCAGG + Exonic
1125472278 15:40015913-40015935 CTAGCCACTGACCTCTTCTGGGG + Intronic
1128998942 15:72317500-72317522 CCTGCCACTGACCCACTCTCTGG - Intronic
1129073338 15:72970564-72970586 CTGGCCCCAAACCCTTTCCCAGG - Intergenic
1129139557 15:73584920-73584942 CAGGCCACTGTCCCTCTGTCTGG + Intronic
1132578404 16:674407-674429 CCGGTGACTGACCCCTTCTCAGG + Intronic
1132698316 16:1211686-1211708 CTCGCCAGTGACCCTGGCTCTGG + Intronic
1134048895 16:11123196-11123218 CCAGCCCCTGTCCCTTTCTCAGG + Intronic
1134232434 16:12439158-12439180 CTGGCAAATGACACTTTCTCAGG - Intronic
1135136314 16:19887268-19887290 CAGTGCACTGACCATTTCTCAGG - Intergenic
1135464328 16:22672285-22672307 CTGGCCTCTGCCCACTTCTCCGG + Intergenic
1137325533 16:47431472-47431494 CTGGCCTCTGACCCTGTCCATGG + Intronic
1139375398 16:66493586-66493608 CTGGCCCCTGGCCCTTCATCGGG + Intronic
1140885371 16:79238115-79238137 CTTGACTCTGACCCTTTCTGAGG + Intergenic
1141729083 16:85809832-85809854 CTGGTCCCTGACCCTTTGCCTGG + Intergenic
1144233098 17:13228852-13228874 CTGGGCCCTGACACTTTCACAGG + Intergenic
1144814714 17:18025980-18026002 CTGCCCACCGACACTTTCTCAGG - Intronic
1146445544 17:32929817-32929839 CTGGGAACTGACACTTTCACAGG - Intronic
1148864226 17:50620202-50620224 CTGGCCACCTACACTGTCTCTGG - Intronic
1149570419 17:57668201-57668223 CTAGCCACAAAGCCTTTCTCAGG + Intronic
1155440006 18:25852197-25852219 CTCACCACTGCCCCCTTCTCAGG - Intergenic
1157796238 18:50578215-50578237 CTGGCCACTTCCCCTTTTCCAGG - Intronic
1158296982 18:56009028-56009050 TTGGCCACTGATTGTTTCTCAGG + Intergenic
1158875197 18:61727127-61727149 CTTTCCTCTGACCCATTCTCAGG + Intergenic
1164628109 19:29742843-29742865 CTGGCCATTGACCCTTCCTCAGG - Intergenic
1164827927 19:31297986-31298008 TGGCCCACTGACCCTTTCTCAGG - Intronic
1165280527 19:34793377-34793399 CTGACCACTGACCCTATGCCAGG - Intergenic
1165407070 19:35637545-35637567 CTGGCCACAGACCCTATCTCAGG - Exonic
1166258190 19:41620476-41620498 GGGGCCTCTGACCCTTTCTTTGG - Intronic
1166317669 19:41998131-41998153 CTCTCCACTGACCTTCTCTCAGG - Intergenic
1167146201 19:47681857-47681879 CTGCCCACTACCCCATTCTCTGG + Intronic
1167261712 19:48462572-48462594 CTGCCCAGTGACCCATTCGCAGG - Intronic
927459853 2:23289004-23289026 CTGACCACTGAATCTTTCTATGG - Intergenic
929154264 2:38775206-38775228 CTGGCCAGTTACCCTTTTTAAGG - Intronic
931706132 2:64947913-64947935 CGGGGCACTGACCCCTCCTCAGG + Intergenic
932022642 2:68103273-68103295 CTGGCTCCCAACCCTTTCTCAGG - Intronic
932277341 2:70461464-70461486 CTGGCCACAGACCCTTCCAGTGG - Intronic
932437202 2:71709346-71709368 CTGGTTACTGTCCCATTCTCTGG - Intergenic
932760780 2:74437966-74437988 CTGGCCTCAGAATCTTTCTCAGG - Intronic
934911631 2:98262167-98262189 CTGGACATTAACCCATTCTCAGG + Intronic
934990443 2:98916763-98916785 CTGGCCTCTCACCCCTTCTCTGG - Intronic
938117246 2:128610375-128610397 CTGTCCTCTGTCCCTTTCTGGGG + Intergenic
938728119 2:134124615-134124637 CTGGACCTTGACCCTTGCTCAGG + Intronic
940533896 2:154913910-154913932 CTCACCACTGATCATTTCTCTGG - Intergenic
946084589 2:217157854-217157876 ATACTCACTGACCCTTTCTCAGG + Intergenic
947069186 2:226267590-226267612 CTGGCCACGGAACTTTCCTCTGG + Intergenic
947810046 2:232998472-232998494 CTGGCCTCTGGCTCTGTCTCTGG - Intronic
948274459 2:236697413-236697435 CTGGTCACTGTCCATTCCTCTGG - Intergenic
948953195 2:241268476-241268498 CTGGCTACTGACCGTTTTGCTGG - Exonic
1169125090 20:3121713-3121735 GTGCCCAGTGACCCTTTCACGGG - Exonic
1169389570 20:5178727-5178749 CTGCCCTCTGTCCCTTCCTCTGG + Intronic
1171949881 20:31411968-31411990 CTGGCCATTGACTCTTGCTTTGG + Intronic
1171973153 20:31577131-31577153 CTGGCCACCCACCCCCTCTCAGG + Intronic
1172616183 20:36286282-36286304 GTGGCCACTGGCCCTGCCTCCGG - Intergenic
1173197862 20:40930881-40930903 ATGGCCTCTGTTCCTTTCTCAGG - Intergenic
1173298433 20:41779712-41779734 CTGGGCACTGCCCCTGTTTCAGG + Intergenic
1173916568 20:46712424-46712446 CTGCCCCCTGACCCTGTCCCGGG + Intronic
1174488027 20:50873367-50873389 CTGGTCACTGACCCTTGCCTGGG + Intronic
1175801224 20:61802056-61802078 CTGGTCTCTGCCCCTTTGTCCGG + Intronic
1175814637 20:61877126-61877148 CTGGGCACTGTCCCTATCACGGG - Intronic
1175903876 20:62370512-62370534 GAGGCCACAGTCCCTTTCTCAGG + Intergenic
1176219486 20:63963278-63963300 CTGGCCACTCACCCACCCTCTGG - Intronic
1177055319 21:16294351-16294373 CTGGCCAATCTCCCTTTCACAGG + Intergenic
1179095798 21:38313634-38313656 CTGGACACTTGCCCTTTATCTGG - Intergenic
1180059180 21:45375827-45375849 TTCCCCACTGCCCCTTTCTCTGG - Intergenic
1182002920 22:26935930-26935952 CTGGTCAGTGACCCTTTCGATGG - Intergenic
1183614639 22:38936464-38936486 CTGGCCACCTGCCCTTTCTCTGG - Intergenic
1184593147 22:45499241-45499263 CTGGCCTCAGACCCTGTCCCAGG + Intergenic
1185150278 22:49160349-49160371 TTGGCCCCTGGCCCATTCTCTGG - Intergenic
1185331419 22:50253660-50253682 CTGGCCACCTCCCCTTTCCCTGG - Intronic
950095633 3:10328646-10328668 CCACCCACAGACCCTTTCTCTGG - Exonic
950568231 3:13784119-13784141 CTGACCACAGACACTATCTCTGG - Intergenic
953352014 3:42222873-42222895 CTGGCCACTGACCCTTTCTCTGG + Intronic
954283457 3:49601095-49601117 CTGGCCACTGACCATATCGCAGG - Intronic
954679016 3:52331475-52331497 ATGGCCACTTGCCCTTTCTGGGG - Intronic
954798586 3:53174235-53174257 CTAGACACTGACCCTTAGTCTGG + Intronic
955014438 3:55056048-55056070 TTGGATACTGACCCTTTTTCTGG - Intronic
955134522 3:56203253-56203275 CAGGCCACTGTCCATCTCTCAGG - Intronic
955557690 3:60155587-60155609 CTTGCTTCTGACCCTCTCTCTGG - Intronic
961930496 3:130528246-130528268 CTGGCCACTGCCACCCTCTCTGG - Intergenic
965390755 3:168100386-168100408 CTGGCCACTGATCTTTTCTGTGG - Intergenic
966507364 3:180721551-180721573 CTGGGCACTCACACTTTCACAGG - Intronic
969493875 4:7514958-7514980 CTGGCCCCTGACCATTCCTGGGG - Intronic
969625444 4:8302635-8302657 CAGGCCTCTGACCGTTGCTCAGG + Intronic
969656650 4:8502670-8502692 CTGGCCACAGGCCCTCTCCCAGG + Intergenic
970395188 4:15658117-15658139 CTGGCCAATAACCCTTTCCAGGG - Intronic
971367773 4:25991399-25991421 CTGGGCTCTGACCCCATCTCAGG - Intergenic
972461880 4:39311825-39311847 GTGGCCATTGCCCCTTTCTAGGG - Intronic
973271563 4:48267966-48267988 CTGGCCTCTCTGCCTTTCTCCGG - Intronic
974258676 4:59496191-59496213 TTGGCCACTGATCCTTTTACAGG + Intergenic
974974560 4:68874190-68874212 CTGGCCATTGACCTTGCCTCTGG + Intergenic
976349399 4:84043667-84043689 CTGGCCTCTGGCCCTTTCCTGGG - Intergenic
977787174 4:101050058-101050080 CTGGCCAGTGACCCATGCACAGG + Intronic
983359675 4:166712268-166712290 TTTGCCACAGACCCTCTCTCTGG - Intergenic
984910994 4:184674055-184674077 CTGGCCACTGCCGCTCTCCCTGG - Intronic
987248663 5:16076876-16076898 CTGGCCACTGGCCATTTCGCAGG - Intronic
988053511 5:26060794-26060816 CTGGCCACTGGTTCTTTCTCTGG - Intergenic
990829821 5:59943736-59943758 CTGGACTCTGACCCTTTTTTAGG + Intronic
992189482 5:74277055-74277077 CTGGCCCCTGCCCATTTCCCTGG - Intergenic
998112220 5:139511112-139511134 CTACCCACTGGCCCTTTCACTGG + Intergenic
998182761 5:139956803-139956825 CTGGCCTCAGACCCTTTGTCGGG - Intronic
999301099 5:150490931-150490953 CTGGCCTCTTTCCCTCTCTCTGG + Intronic
1001411505 5:171515608-171515630 CTGGCCCCTTCCCCTCTCTCGGG - Intergenic
1001545592 5:172568742-172568764 CTGGCCCCTGATCCATCCTCTGG - Intergenic
1004820842 6:19366373-19366395 CTGGCCATTTATCCTTTCCCTGG + Intergenic
1005269432 6:24147591-24147613 CTGGCCAATGATCCTTGCTAAGG - Intronic
1006226243 6:32538985-32539007 TGAGCCACTGACCCTTTCACTGG + Intergenic
1006827217 6:36944410-36944432 CTGGAAACTGACCCCTTCTCGGG - Intergenic
1008506946 6:52240081-52240103 ATTGCCACTGACCCTTACTGGGG + Intronic
1010565849 6:77412527-77412549 CTGGCCTCTGAGACCTTCTCTGG - Intergenic
1011164360 6:84429832-84429854 TTGGCCACTGGCTCTTCCTCAGG + Intergenic
1013795900 6:113888541-113888563 CTGGACTGGGACCCTTTCTCTGG - Intergenic
1016004511 6:139075684-139075706 CTGGGCACTGACCCCAGCTCTGG - Intergenic
1017435210 6:154409171-154409193 TTGACCCCTGACCCTTTCTAGGG - Intronic
1017723279 6:157259095-157259117 CTTGCCAGTAACCCTTGCTCAGG + Intergenic
1018419122 6:163626803-163626825 CTGGATGCTGACCCTCTCTCAGG - Intergenic
1018606189 6:165600281-165600303 CTGGCCACTCTCCCTCTCCCGGG - Intronic
1019096914 6:169589271-169589293 CTGGACACTGACCTTTTGCCAGG + Intronic
1021301705 7:18981326-18981348 CTGGCCCCTAACACTTTATCTGG - Intronic
1022378344 7:29836013-29836035 TTGGACACTGACCCTATCTGAGG + Intronic
1023659641 7:42459020-42459042 CTGCCCAGTTACCTTTTCTCAGG - Intergenic
1024088211 7:45914711-45914733 GTGGCCACTGGCCCTTCCCCAGG - Intronic
1033120657 7:138664491-138664513 CAAGCCCCTGACCCTTTATCGGG + Intronic
1034385512 7:150737637-150737659 CTGGCCGCTGGTCCTCTCTCAGG - Exonic
1034939306 7:155220193-155220215 CTGGCCGCTGTCCCTTCCTGGGG - Intergenic
1038193632 8:25346441-25346463 TTGGACACTGATACTTTCTCTGG + Intronic
1038217810 8:25578626-25578648 CTGGCCTCAGACCCTTCCTTTGG - Intergenic
1038641108 8:29329301-29329323 ATGCCCACAGAGCCTTTCTCGGG + Intergenic
1043296285 8:78666692-78666714 CTGGCCAGTGACACTTCCTTAGG - Intronic
1044377158 8:91488979-91489001 CTGGCCCCTTTTCCTTTCTCTGG - Intergenic
1045701291 8:104869872-104869894 CTGGCTCCTGCTCCTTTCTCTGG - Intronic
1046539729 8:115564101-115564123 CTGGCCACTGACTCTTTCTGCGG - Intronic
1048936882 8:139364827-139364849 ATGGCTAGTGACCCTTGCTCTGG + Intergenic
1053010221 9:34628764-34628786 CTGTCCTCTGCCCCTCTCTCCGG - Intergenic
1055430580 9:76239335-76239357 CTGTTCACACACCCTTTCTCTGG + Intronic
1055443831 9:76363215-76363237 ATGGCCACTGGCTCTGTCTCTGG + Intergenic
1057500006 9:95589460-95589482 CTGGGCACAGACCCTTCCTGGGG + Intergenic
1058324870 9:103682625-103682647 CTGGTTACTCACCATTTCTCAGG - Intergenic
1059202827 9:112433991-112434013 CGGCCCTCTGATCCTTTCTCTGG - Intronic
1060240958 9:121902765-121902787 GTGGCCACTGACCATTCCTGTGG - Intronic
1061390478 9:130314934-130314956 CAGGCCAGTGTCCCTTTCGCTGG + Intronic
1061397016 9:130348882-130348904 CTGGCCACTGGCCACCTCTCGGG + Intronic
1062181735 9:135194588-135194610 CTGGCCACTGAGCCTCTCCCTGG - Intergenic
1062339698 9:136088516-136088538 GTGGCCAGGGACTCTTTCTCGGG + Intronic
1062523411 9:136968931-136968953 CTGGCCACAGCCCAATTCTCAGG - Intergenic
1189639324 X:43050876-43050898 CTGGGCTCAGACCCTTTCTTTGG + Intergenic
1190457706 X:50641910-50641932 CTGGCCCCTTACTCTTTCTAGGG + Intronic
1192247752 X:69387682-69387704 CTGCCCAGTCCCCCTTTCTCAGG - Intergenic
1192796242 X:74425913-74425935 CTGACCATTGTCCCTTTCTCTGG - Intronic
1194620431 X:96164324-96164346 CTGCCCACAGGCACTTTCTCAGG - Intergenic
1195280560 X:103328944-103328966 CTGACCACTGAACTTTTTTCTGG + Intergenic
1195915871 X:109934950-109934972 ATGGATACTGACCCTTTCCCAGG - Intergenic
1201567754 Y:15384474-15384496 CTGAGCACTGACCCCTTCTGTGG + Intergenic