ID: 953352686

View in Genome Browser
Species Human (GRCh38)
Location 3:42227771-42227793
Sequence CATTCCAAGCAGAGGAAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 488
Summary {0: 1, 1: 0, 2: 5, 3: 54, 4: 428}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953352676_953352686 17 Left 953352676 3:42227731-42227753 CCCTGTATCTGGGTTTCCAGGAT 0: 1
1: 0
2: 5
3: 16
4: 468
Right 953352686 3:42227771-42227793 CATTCCAAGCAGAGGAAGGATGG 0: 1
1: 0
2: 5
3: 54
4: 428
953352683_953352686 -9 Left 953352683 3:42227757-42227779 CCAAGTGGGGAAGGCATTCCAAG 0: 1
1: 0
2: 3
3: 19
4: 282
Right 953352686 3:42227771-42227793 CATTCCAAGCAGAGGAAGGATGG 0: 1
1: 0
2: 5
3: 54
4: 428
953352681_953352686 1 Left 953352681 3:42227747-42227769 CCAGGATTTGCCAAGTGGGGAAG 0: 1
1: 0
2: 2
3: 19
4: 158
Right 953352686 3:42227771-42227793 CATTCCAAGCAGAGGAAGGATGG 0: 1
1: 0
2: 5
3: 54
4: 428
953352677_953352686 16 Left 953352677 3:42227732-42227754 CCTGTATCTGGGTTTCCAGGATT 0: 1
1: 0
2: 2
3: 15
4: 273
Right 953352686 3:42227771-42227793 CATTCCAAGCAGAGGAAGGATGG 0: 1
1: 0
2: 5
3: 54
4: 428

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953352686 Original CRISPR CATTCCAAGCAGAGGAAGGA TGG Intergenic
900394232 1:2446567-2446589 CATTGGAGGCAGAGGGAGGAAGG + Intronic
900687100 1:3955571-3955593 CGTTCCAGGCAGAGTAAGGTGGG - Intergenic
901195681 1:7438618-7438640 CATTGCAGCCACAGGAAGGAGGG - Intronic
901610438 1:10493915-10493937 AACTCCAAGAAGAGGCAGGAAGG + Intronic
901788644 1:11641586-11641608 GATTCCTAGGAGAGGAAGGGAGG + Intergenic
901868015 1:12120250-12120272 CCATCCTAGCAGAGCAAGGAAGG + Intronic
901940301 1:12656764-12656786 CATACCAGGCAGTGGATGGATGG - Intronic
902607454 1:17576491-17576513 CATTCCACGCAGTAGCAGGAAGG + Intronic
903126885 1:21254465-21254487 TCTTCCAAGCAGAGGAAGAAAGG - Intronic
903798563 1:25949103-25949125 CATTCCAGGCAGAAGAAATAAGG - Intergenic
904617066 1:31755637-31755659 CATTCTAGGCAGAGCAAGAAGGG - Intronic
905324921 1:37145144-37145166 CATTTTACCCAGAGGAAGGAAGG + Intergenic
905366251 1:37453258-37453280 GATTCCTAGCAGAGTGAGGAGGG + Intergenic
905436193 1:37956878-37956900 CATCCCATGCAGAGGCAGGCTGG - Intergenic
906401973 1:45511148-45511170 CATTCCTACCAAAGGAAGAAAGG + Exonic
906696009 1:47823935-47823957 CCTTCCAAACAGAGGGAGCAAGG - Intronic
907106682 1:51889305-51889327 GAATCCAAGCAGAGTGAGGAGGG + Intergenic
907431456 1:54414482-54414504 CATTACAGCCAGAGGAAGGAAGG - Intergenic
907919482 1:58899238-58899260 CAGCCCACGCAGAGGAAGGGGGG + Intergenic
908194878 1:61738851-61738873 CATTCCAGGCAGGGGAAAGTGGG + Intergenic
909286369 1:73824935-73824957 TATTCTAAGGAGAGGAAGTATGG - Intergenic
909827175 1:80141514-80141536 CATTCCAAGAAGGGGCAAGATGG + Intergenic
910343253 1:86211706-86211728 CATTTCAGGAAGAGGAAGCAAGG - Intergenic
912469276 1:109895493-109895515 CATTCCAAGGAGGGGGATGATGG + Intergenic
912720176 1:112013375-112013397 CATCCCAAGCAGAAGAGGTATGG - Intergenic
913166651 1:116193387-116193409 CATTACAAGCTGAAGAAGCAAGG - Intergenic
913448015 1:118970519-118970541 CTTTCCAAGCAGCAGCAGGAAGG + Intronic
913971821 1:143422405-143422427 ACTTCCAGGCAGGGGAAGGACGG - Intergenic
914066200 1:144248018-144248040 ACTTCCAGGCAGGGGAAGGACGG - Intergenic
914112953 1:144718336-144718358 ACTTCCAGGCAGGGGAAGGACGG + Intergenic
915074571 1:153297828-153297850 CATTCAAACCTGAGAAAGGATGG + Intergenic
916001375 1:160619661-160619683 CATCCAGAGCAGAGGAAGGTAGG - Intronic
917166459 1:172118104-172118126 CAATCAAAGGTGAGGAAGGAAGG + Intronic
918525178 1:185456873-185456895 CCTTCCAGGCAGAGGGAGCAGGG - Intergenic
919846872 1:201648153-201648175 AGCTCCGAGCAGAGGAAGGAGGG - Intronic
920301584 1:204992269-204992291 CATGCCAGGCAGTGGAGGGAGGG + Intronic
920513231 1:206565954-206565976 CATGACAGGCAGGGGAAGGAAGG + Intronic
920630755 1:207649228-207649250 TATTCAGAGCAGAGGAAGCAAGG + Intronic
920641534 1:207756160-207756182 TATTCAGAGCAGAGGAAGCAAGG + Intronic
920957101 1:210629712-210629734 CTTTGAAAACAGAGGAAGGAAGG - Intronic
921055432 1:211539134-211539156 CATTGCAACCAGAGAATGGAGGG + Intergenic
921114602 1:212076715-212076737 CATCCCAAACAGAGGAGGAAAGG + Intronic
921670207 1:217916582-217916604 CATTCTAAGTAGAAGAGGGATGG + Intergenic
922022822 1:221721518-221721540 CATTCCAAGGCTGGGAAGGAGGG + Intronic
923000782 1:230004919-230004941 TACTCCCAGCTGAGGAAGGAAGG + Intergenic
923392167 1:233523262-233523284 CATTCCAGGGAGACAAAGGAGGG + Intergenic
923828049 1:237521949-237521971 CATTCCAAGAAGAGGACGTGTGG - Intronic
924199162 1:241641081-241641103 GCTTTCAAGCACAGGAAGGACGG - Intronic
924798241 1:247308548-247308570 CATTCCAGGTAGAAGAAAGAAGG - Exonic
1063366935 10:5496663-5496685 CAGCCCAGGCAGAGGAGGGAAGG + Intergenic
1065186923 10:23177514-23177536 CATCCCAACCAGTGGAAAGAGGG + Intergenic
1067459416 10:46446388-46446410 CATTCCATGGAGAGGTTGGAGGG + Intergenic
1067627778 10:47938242-47938264 CATTCCATGGAGAGGTTGGAGGG - Intergenic
1068787533 10:60992394-60992416 CATTACAAGGGGAGGAATGAAGG + Intronic
1069317923 10:67130866-67130888 CAATTCAAGCAGAGGAAGAAAGG - Intronic
1069529308 10:69204257-69204279 CATGCAAAGCAGAGGAAATAGGG - Intronic
1069674496 10:70238041-70238063 CATTTCATGAAGATGAAGGAAGG - Intergenic
1069832528 10:71289918-71289940 GACTCCAGGCAGAGGAAGCAGGG + Intronic
1071851821 10:89580555-89580577 CTTTCCAAGCAGAGGGAGCTGGG - Exonic
1072180755 10:92977245-92977267 CATTCCAAGCAGAGAGAGGATGG - Intronic
1072237858 10:93468726-93468748 CATGCACAGCATAGGAAGGAGGG - Intronic
1072599286 10:96909395-96909417 CAATAGAAGCAGAGGAACGATGG - Intronic
1072819715 10:98544320-98544342 CATTCAAAGCAGTGTAAAGAGGG + Intronic
1072855339 10:98940072-98940094 CATTCAAAGCAGTGTAAAGAGGG + Intronic
1073479132 10:103775127-103775149 CATGCCACGCTGAGGAAGCACGG + Intronic
1073544248 10:104335640-104335662 CAGTCCAGGTGGAGGAAGGAGGG - Intronic
1073755744 10:106578931-106578953 CATCCCAATCAGAGGAAGCAGGG + Intronic
1074424174 10:113336503-113336525 CATTCAAAGCAGAAAAATGAGGG - Intergenic
1076021569 10:127077889-127077911 CATTCCATGGAGGGGCAGGAGGG + Intronic
1076697118 10:132252199-132252221 CATTCCAGACCCAGGAAGGAGGG + Intronic
1076732938 10:132447285-132447307 GATTCAAAGCTGAGGCAGGAGGG - Intronic
1077522352 11:3043778-3043800 CAGGCCAAGGGGAGGAAGGAGGG + Intronic
1078267546 11:9766287-9766309 CACTCCAAGGAGAGGTGGGATGG - Intergenic
1079356420 11:19733708-19733730 GATTCCAAGTAGGGGAAGGCGGG + Intronic
1079419020 11:20268829-20268851 CATTCCAAGGGGCGGAATGAAGG + Intergenic
1079984028 11:27181109-27181131 GATTTCAAACAGAGGATGGAGGG + Intergenic
1080008865 11:27437564-27437586 CATTACAAGGATTGGAAGGACGG - Intronic
1080080231 11:28208261-28208283 CATTCAAAGCAGAGTATAGAGGG - Intronic
1080934346 11:36846553-36846575 TATTACAACCTGAGGAAGGAAGG + Intergenic
1081957608 11:47107064-47107086 AATTGCATGCAGGGGAAGGAGGG + Intronic
1083379133 11:62250499-62250521 GATGGCAAGCAGAGGAAGCAGGG + Intergenic
1084103590 11:66966090-66966112 CAGCCCAAGCACAGGCAGGAAGG - Intergenic
1084110557 11:67011666-67011688 CAGTCCAAGCAGAGGAAACTGGG - Intronic
1084551456 11:69845566-69845588 CAGTCCATGCAGAGGGAAGAAGG + Intergenic
1085691398 11:78667226-78667248 CATCCCAAGCATAGGGAAGAAGG - Intronic
1085691404 11:78667257-78667279 CATCCCAAGCATAGGAAAGAGGG - Intronic
1086453777 11:86942106-86942128 CATTGCAATCAGTGCAAGGAAGG + Intronic
1087324144 11:96700345-96700367 GTTTTCAAGCAAAGGAAGGAAGG + Intergenic
1088088579 11:106010605-106010627 CATCCAAATCAGAGGAGGGAAGG + Exonic
1089075439 11:115734750-115734772 CTTCCCCTGCAGAGGAAGGAAGG - Intergenic
1089634846 11:119805458-119805480 CATTCAAAGCAGAGGAGGACAGG - Intergenic
1090346027 11:126071512-126071534 CAACTGAAGCAGAGGAAGGAAGG + Intergenic
1091227519 11:133966414-133966436 CATTCCAACAAGAGGGAGGCTGG + Intergenic
1092910838 12:13143716-13143738 CATTCTAAGCAGGAGAAAGAAGG + Intergenic
1094143779 12:27207736-27207758 CATTCCAGGCAGAAGGAGGTAGG - Intergenic
1094558107 12:31523012-31523034 CATTCCCAGAATAGGAGGGAAGG + Intronic
1095797665 12:46237967-46237989 CATTATAACCAGAGGGAGGAGGG + Intronic
1096837256 12:54358860-54358882 GATTCCGAGCTGAGGAACGAAGG - Intergenic
1099167772 12:79327834-79327856 GCTTCCAAGAAGAGGAAGCAGGG + Intronic
1100342228 12:93690297-93690319 CAATCCAAAAAGAAGAAGGATGG - Intronic
1100691772 12:97046071-97046093 CATTGGGAGCAGAGAAAGGAGGG - Intergenic
1101763318 12:107676959-107676981 CATGAGAAGCAGAGGAAGGATGG - Intergenic
1102186823 12:110955313-110955335 CATTTCAAACAAATGAAGGAAGG + Intergenic
1102946878 12:116997624-116997646 CAGTCCAAGCAGAGGCAGCAGGG + Intronic
1103936377 12:124479746-124479768 GATGCCAGGCAGAGGGAGGAGGG + Intronic
1104280640 12:127373432-127373454 TATTCCAAGCAGTGGGATGATGG + Intergenic
1105620245 13:22059659-22059681 CATTCCAGGCAGAGGCCTGAGGG + Intergenic
1106093850 13:26624751-26624773 CATTACAAACAGAGGAACAAGGG + Intronic
1106921961 13:34573802-34573824 CCTTCCAAGCCCAGGAGGGAGGG + Intergenic
1107385504 13:39904395-39904417 CATTCCATGGAGATGAAGGGTGG + Intergenic
1107803785 13:44135042-44135064 CATTCCTAGCTGAGGAAGGGAGG - Intergenic
1108156344 13:47589198-47589220 TATTCCCAGCAGAGGAAAAATGG + Intergenic
1108482713 13:50890980-50891002 CATTCCAGGCAAGGGAAGGCTGG - Intergenic
1110180183 13:72607390-72607412 AATCCGAAGCAGAGAAAGGATGG + Intergenic
1110239182 13:73247691-73247713 CATGGCAAGAAGAGGAAAGATGG + Intergenic
1110326805 13:74225838-74225860 CAGTCTAAGAAGAGGAAAGAGGG + Intergenic
1111943720 13:94641266-94641288 CATTCCTGGCAGAGGAAGGTTGG + Intergenic
1113372088 13:109733558-109733580 CATTTCCAGGAGGGGAAGGAGGG + Intergenic
1113461202 13:110483550-110483572 CATTCAGTGCTGAGGAAGGATGG + Intronic
1114462801 14:22898745-22898767 GAAACCAAGCAGAGGAAGGCAGG + Intergenic
1115304242 14:31917560-31917582 CATTCCAGGCAAAGCCAGGAAGG - Intergenic
1116862038 14:50002819-50002841 CATCCCAACTAGAGGAAGCAAGG - Intronic
1118250154 14:64151900-64151922 CACTCTACTCAGAGGAAGGACGG - Intronic
1118600637 14:67469605-67469627 CCTTCCAGGAAGAGGATGGAGGG - Intronic
1119517126 14:75257199-75257221 AGTTCCAAGCAGAGGAAGAAGGG - Intronic
1122850017 14:104523026-104523048 CATCCCAAGCACAGGAAGCCAGG + Intronic
1124475051 15:30025914-30025936 CCTTTCAGGCAGAGGAAAGATGG + Intergenic
1125251528 15:37710668-37710690 CATTCCAAGAAGAGGAAAAGTGG + Intergenic
1125741374 15:41967094-41967116 GGATCCAAGAAGAGGAAGGATGG - Intronic
1125751973 15:42035454-42035476 CATTCCCAGCAGGAGAACGAGGG - Intronic
1125815416 15:42580162-42580184 CATTCCTCCCAGAGGAAAGAAGG + Intronic
1125931854 15:43605775-43605797 CTTCACAAGCAGAGGAAGGGTGG - Intronic
1125944953 15:43705253-43705275 CTTCACAAGCAGAGGAAGGGTGG - Intergenic
1125979720 15:43989374-43989396 GATTCCATGCCCAGGAAGGAAGG + Intronic
1126316189 15:47372528-47372550 CATTTGCAGCAGAGGCAGGAAGG - Intronic
1126790033 15:52212518-52212540 CACTCGCAGAAGAGGAAGGAAGG + Intronic
1126878681 15:53071332-53071354 AATTCCCAGCAGAGGCAGTATGG + Intergenic
1127469618 15:59278934-59278956 CACTCCAAGCAGAGGCAACATGG - Intronic
1128305802 15:66598248-66598270 CATTCCTACCACAGGAAGGCAGG - Intronic
1129227460 15:74178454-74178476 TGTTCCAAGAAGAGGAAGGAAGG - Intergenic
1129328648 15:74815578-74815600 CATTCCAAGGTGAGGAAAGCAGG - Intronic
1129675563 15:77631228-77631250 CAAACCAAGCAGAGGACTGAGGG + Intronic
1129703072 15:77779053-77779075 CATTCAAAGCAGAGGAAACAGGG - Intronic
1130307821 15:82726623-82726645 GATTCCATGCCCAGGAAGGAGGG + Intergenic
1130459965 15:84153605-84153627 CATTCCCAGCCGAGGGAGAAAGG + Intergenic
1130718731 15:86364526-86364548 CATTCCAATCAGTGGGAGGTGGG - Intronic
1131670650 15:94616135-94616157 TATTCTAAGCAGAGGAATGAAGG + Intergenic
1132388851 15:101423640-101423662 CATTCGAAGCAGAGAAAAAAGGG + Intronic
1133343645 16:5055470-5055492 CGTTCAATGCAGAGGAGGGAAGG + Intronic
1135633367 16:24053673-24053695 CTTTCAAAGGAGATGAAGGAGGG + Intronic
1137885215 16:52095661-52095683 TTTGCCAGGCAGAGGAAGGAAGG + Intergenic
1138645439 16:58421108-58421130 CATTCCAGGCTGGAGAAGGATGG + Intergenic
1138710671 16:58967104-58967126 CATTTCAACAAGAGGAAGCAAGG + Intergenic
1139690852 16:68641166-68641188 CATTCCAGGCAGAGAAAACAGGG - Intronic
1139810887 16:69616222-69616244 CAATCCAAGCAGGGTGAGGAGGG - Intronic
1139836809 16:69845596-69845618 TTTACCAAGCAGAGGAAAGAAGG - Intronic
1141409191 16:83821014-83821036 AATTTCAAGAAGAGGAGGGAAGG + Intergenic
1141645174 16:85363578-85363600 CACACACAGCAGAGGAAGGAGGG + Intergenic
1141774773 16:86115974-86115996 CCTGCAAAGCAGAGGGAGGATGG - Intergenic
1142973369 17:3628194-3628216 CATTTTAAGCAGAAGATGGACGG - Intronic
1143244326 17:5469837-5469859 TAATACAAGCAGAGAAAGGAGGG + Intergenic
1144688439 17:17242552-17242574 CATTCCATGCCCAGGAAGGAAGG - Intergenic
1146557950 17:33842781-33842803 CATTCAGAGGAGAAGAAGGATGG + Intronic
1147139782 17:38454399-38454421 GTTTCCAGGCAGTGGAAGGATGG + Intronic
1147447995 17:40486674-40486696 CATTCCCAGCAGAGAAAGCAGGG - Intronic
1148236661 17:45973746-45973768 CCTTCACAGCAGAGGCAGGAGGG - Intronic
1149018402 17:51934994-51935016 CTTTACATGCAGAGCAAGGATGG + Intronic
1150125208 17:62630637-62630659 GTTTCCGAGCAGAGGAATGAGGG + Intronic
1152044657 17:77928032-77928054 CATTCCAAGAAGAGGATCCATGG + Intergenic
1152203162 17:78958843-78958865 CATTCCAAGCAGTGGGAGTGGGG - Intergenic
1152260822 17:79266116-79266138 CATTGGAATCAAAGGAAGGAGGG - Intronic
1152318723 17:79596092-79596114 CATTCCAAGCCCAGGAAAGAGGG + Intergenic
1155332786 18:24734719-24734741 TATTTAAAGCAGAGGAGGGAGGG + Intergenic
1156038129 18:32789015-32789037 CATTCTAAGCAGAAGATTGAAGG - Intergenic
1156282685 18:35656546-35656568 CCTTCCAAGCAAAGGAAAGAAGG + Intronic
1157763965 18:50283805-50283827 CATTCCATGCAGAGCAACGAGGG - Exonic
1158197672 18:54906623-54906645 CATTCTAAGGGAAGGAAGGATGG - Intronic
1158493164 18:57928628-57928650 CATTGCATGATGAGGAAGGATGG + Intergenic
1158945358 18:62442794-62442816 GATTCCATGCCCAGGAAGGAAGG - Intergenic
1159599404 18:70414275-70414297 GATGCCAAGCAGAGGATGGGAGG - Intergenic
1160089193 18:75810009-75810031 CAGTCAAAGCAGAGGAAAGGCGG - Intergenic
1162474431 19:10891502-10891524 GATTCCAAGCTGAGGAAAGCAGG + Intronic
1162639543 19:11997269-11997291 CATTCCAGTCATAGGAAGCAGGG + Intergenic
1163305447 19:16475322-16475344 CATTCCAAACTGAGGAAGTTTGG - Intergenic
1164243400 19:23409757-23409779 GATTCAAAGCTTAGGAAGGAAGG - Intergenic
1164311226 19:24048228-24048250 GATTCAAAGCTTAGGAAGGAAGG + Intronic
1166690969 19:44821045-44821067 CCTTGCCGGCAGAGGAAGGAAGG - Exonic
1166881687 19:45934059-45934081 CATTCCAAGAAATGGAATGAAGG + Exonic
1167568381 19:50271529-50271551 AATTCCAAGCTGAGCAAGGTTGG + Exonic
1168271849 19:55254449-55254471 CTGTCCAAGCAGGGGAAGGAAGG - Intronic
925210084 2:2038050-2038072 CATTCCATGCAGACGTAGCATGG + Intronic
925574063 2:5341845-5341867 CAATGCAGCCAGAGGAAGGAGGG - Intergenic
925676631 2:6368786-6368808 CATTCCATGGAGAGCAAGGAAGG + Intergenic
925687003 2:6482911-6482933 CATGTCAAGCAGAGGAAAGAGGG + Intergenic
926147754 2:10406950-10406972 CCTCCCAAGCAGAGAAAGGGAGG - Intronic
926376648 2:12235548-12235570 CATTCCAACCAGCAGAAAGAAGG - Intergenic
926628604 2:15117125-15117147 CATACCTGGCAGAGGAAAGAGGG + Intergenic
926704210 2:15825392-15825414 CTGACCCAGCAGAGGAAGGAAGG - Intergenic
927626817 2:24730255-24730277 CTTTCCTAGGAGAGGAAGGATGG - Intronic
927853409 2:26513699-26513721 CCTTCCCAGGAGAGGATGGAGGG + Intronic
929201443 2:39241636-39241658 CATTCCAGGCAGGGGTATGAAGG - Intergenic
929554962 2:42920487-42920509 CATGCCAAGCAGAGGGAAGGAGG - Intergenic
929655737 2:43729973-43729995 CATTCCAAGCAGAGGAGCAGTGG - Intronic
929766483 2:44848093-44848115 CATTCCAGGCAGAGCAACAATGG - Intergenic
931285766 2:60830338-60830360 CATGCCAGGCAGAAGGAGGAAGG + Intergenic
931475547 2:62583976-62583998 CATTCAAAGCAGTGTGAGGAGGG - Intergenic
931574469 2:63705449-63705471 CATTCAAAGCAGTGTGAGGAGGG - Intronic
932284057 2:70518028-70518050 CACTCCAAACAAAGGAAGGATGG + Intronic
932556348 2:72828207-72828229 AATTCCAAACAGATGTAGGAGGG + Intergenic
933064011 2:77771788-77771810 CAGTCCAAGCTAAGCAAGGATGG + Intergenic
933336725 2:80967970-80967992 CAATCTAAGCCGAGGAAGGGTGG - Intergenic
933373287 2:81445273-81445295 CTTTCCAAACAGTGGAAGGCAGG - Intergenic
934176511 2:89583337-89583359 ACTTCCAGGCAGGGGAAGGACGG - Intergenic
934286821 2:91657698-91657720 ACTTCCAGGCAGGGGAAGGACGG - Intergenic
934885090 2:98017347-98017369 GTTTCAAAGCAGAGGAAGTAGGG + Intergenic
935726752 2:106030406-106030428 CATGCCATGTACAGGAAGGATGG + Intergenic
935928692 2:108099158-108099180 GATTCCATGCCCAGGAAGGAAGG - Intergenic
936025723 2:109029644-109029666 CATCCCAGGCCGAGGAAGGAGGG - Intergenic
936982324 2:118276249-118276271 CATGCCAGGCAAAGGAAGAATGG - Intergenic
937350405 2:121156739-121156761 CATGCCAAGCAGGGGATGGTGGG - Intergenic
937625504 2:124038927-124038949 CAATACAAGCAGAGGCAGGTGGG - Intronic
937729771 2:125214597-125214619 CATGACAAGCAGAGCCAGGAAGG - Intergenic
937910033 2:127071048-127071070 CATTCTCAGCCCAGGAAGGAAGG + Intronic
938078260 2:128353614-128353636 CTTTACAAGAAGAGGAAGGGAGG + Intergenic
938104411 2:128520348-128520370 CACGCCAAGCAGAGGCTGGAAGG + Intergenic
938263454 2:129910842-129910864 CCTTCCAACCAAAGGAAGGAGGG - Intergenic
938265094 2:129922887-129922909 CACACGAAGCTGAGGAAGGAAGG + Intergenic
938792887 2:134692453-134692475 CAGCCCAAGCAGACTAAGGAGGG - Intronic
938931879 2:136093838-136093860 CATTCCAATTAGAGAAAGGAGGG + Intergenic
940556516 2:155234982-155235004 CATTACAAAGAGAGGTAGGAGGG - Intergenic
940568848 2:155404773-155404795 CATCCCAAACAAAGGAGGGAAGG - Intergenic
940794254 2:158060445-158060467 CATTCAAAGCAGAGGCAGGATGG - Intronic
940840699 2:158577550-158577572 CATTTCAAGCACAGGACTGAGGG - Intronic
941159101 2:162015645-162015667 CATTCAAAGTACAGAAAGGAGGG - Intronic
942032453 2:171976573-171976595 CATAACAAGCAGAGGAAAGATGG + Intronic
942086185 2:172445836-172445858 CATTCCAGGCAGCTGAAGAAAGG + Intronic
942451355 2:176109519-176109541 CATTCACCGAAGAGGAAGGAAGG - Exonic
943960910 2:194262773-194262795 CATTGCAAGCAGAGGACATAGGG + Intergenic
944214780 2:197243897-197243919 CATTCAAACCATAGCAAGGAAGG + Intronic
944489319 2:200241848-200241870 CATTCCCTGCAGAGGAAACATGG - Intergenic
944869696 2:203897461-203897483 AAGTCCAATCAGAGGCAGGAAGG - Intergenic
944902001 2:204224746-204224768 CTTTCCAAGAAGAGAAAGCATGG + Intergenic
945137061 2:206640872-206640894 CAGTACAAGCAAAGGCAGGAAGG - Intergenic
946340915 2:219067926-219067948 CATTCCAAGCACAGGGTGAAAGG + Intergenic
947298166 2:228656277-228656299 CAATTCAAGGAGAGAAAGGAAGG + Intergenic
947483072 2:230521141-230521163 CATGACAAGCAGAGAAAGGATGG - Intronic
947643574 2:231721626-231721648 CTTTCCAAGCAGAGGAAAGACGG + Intergenic
948945262 2:241216127-241216149 CGCTCCAAGAAGAGGAAGGCGGG + Exonic
1169046996 20:2541033-2541055 GATTCCAGGCAGAGGAAACAGGG - Intronic
1170259952 20:14393480-14393502 GATTCCAGGCAGAGGAACTAAGG - Intronic
1170662727 20:18358691-18358713 CATCCCAAGGAGAGGAAGGAGGG - Intergenic
1170716362 20:18834672-18834694 CATTCTCAGGAAAGGAAGGATGG - Intergenic
1170749620 20:19133951-19133973 ATTCCCAAGCAGAGCAAGGAGGG + Intergenic
1171151251 20:22828122-22828144 CATTCCAAGGAGATGAGGGAGGG - Intergenic
1172514125 20:35521423-35521445 CATTCCAGGCAGAGGGAGCAAGG + Intergenic
1172935780 20:38619142-38619164 CATTCCAGGCAGAGGGAAGAAGG + Intronic
1174083409 20:47987154-47987176 CATTAGGAGTAGAGGAAGGAAGG - Intergenic
1175147333 20:56906888-56906910 CATTCCAGCCAGAGGAATGAAGG + Intergenic
1175806803 20:61834104-61834126 CAGTCCATGCAGAGCAAGGGTGG + Intronic
1176908371 21:14532391-14532413 CATCCCAAATAGAGGAAGAATGG + Intronic
1177459222 21:21388393-21388415 CATTCCAGGCAGAGGGAACAAGG + Intronic
1180226597 21:46396976-46396998 CAGTCCCAGCAGACGACGGACGG - Intronic
1181023472 22:20115153-20115175 CATTTCAGCCAGATGAAGGAAGG - Intronic
1182928484 22:34150471-34150493 CATTTCAACCAGGAGAAGGAAGG + Intergenic
1183261095 22:36796501-36796523 GACTCCACGGAGAGGAAGGATGG - Intergenic
1183910327 22:41074477-41074499 GATTCCATGCCCAGGAAGGAAGG + Intergenic
1183948683 22:41340716-41340738 CCTGCCAGGCAGAGGAAGCAGGG + Intronic
1184021944 22:41826808-41826830 CCTCCCAAGCAGAGGAGGGAAGG + Intergenic
1184810570 22:46828734-46828756 CAGTCCAAACAGAGACAGGAGGG - Intronic
1185222760 22:49637193-49637215 CTTTCCAATCTGAGGCAGGACGG + Intronic
949573155 3:5312598-5312620 CTTTCCATGCAGAAGGAGGAAGG - Intergenic
949842294 3:8332974-8332996 CATTCCACTCAGAGGAAAAATGG + Intergenic
949850176 3:8412871-8412893 TCTTCCAAGCAGAGGAACGGAGG - Intergenic
950120799 3:10481369-10481391 CACTCCATGCAGAGGAAACAGGG - Intronic
950439908 3:13004533-13004555 TAATCCAAGGAGAGGGAGGAGGG - Intronic
950857915 3:16122558-16122580 CATTCCAAGTAGAGGGACAATGG - Intergenic
950896862 3:16460568-16460590 CATTTCAAGCAGAGGCTGGGTGG + Intronic
951719438 3:25682324-25682346 AATTCAAAGTAGATGAAGGAAGG + Intergenic
951913751 3:27777887-27777909 CCATCCCAGCAGGGGAAGGAGGG + Intergenic
952030946 3:29142052-29142074 CATTCCAAGCTCAGCATGGATGG + Intergenic
952240457 3:31526984-31527006 CATTAGAAGCAGAGGAAGGCCGG - Intergenic
952470782 3:33649121-33649143 CATTCTAGGCAGAAGAAGCAAGG - Intronic
953254079 3:41272480-41272502 CATTACATGCAGAGGAACAAAGG - Intronic
953302140 3:41788286-41788308 CATTTAAAGCAGAAGAAGCATGG + Intronic
953352686 3:42227771-42227793 CATTCCAAGCAGAGGAAGGATGG + Intergenic
953629144 3:44597547-44597569 CATTCCAAGCAGGGTTTGGAAGG + Exonic
953797513 3:45996635-45996657 CATTCTAAACTGAGGAAGCAGGG + Intergenic
953972034 3:47355485-47355507 AATTCCAGGCAGAGGAAAGCAGG + Intergenic
954065292 3:48101059-48101081 CATTCCAAGCTAAGTGAGGAAGG - Intergenic
954626074 3:52022576-52022598 ACTGCCCAGCAGAGGAAGGACGG - Intergenic
954711541 3:52507461-52507483 CATTCCAGGCAGAGGAGAGCAGG - Intronic
954928292 3:54256968-54256990 CAGTCCAAGTGGATGAAGGAAGG - Intronic
955054930 3:55446650-55446672 GATTCAAAGAAGAGGAAGGTGGG - Intergenic
955119477 3:56042158-56042180 CATTCCCACGAGATGAAGGAGGG + Intronic
955154014 3:56397903-56397925 CATTCCAGGCAGCAGAAGAAGGG + Intronic
955557302 3:60151710-60151732 AATTGCAGGCAGAGGTAGGAAGG - Intronic
955872127 3:63450498-63450520 CATTTTAAACAGAGGAAGGCTGG + Intronic
958259649 3:91365738-91365760 CATTTAAAGCAAAAGAAGGAAGG + Intergenic
958539270 3:95449241-95449263 CAATACAAGTAGAGGAAAGAAGG - Intergenic
958860451 3:99438893-99438915 AATTTAAAGCAGAAGAAGGAAGG + Intergenic
959097288 3:101970172-101970194 AATTCCAACAAGAGGAAGAAAGG - Intergenic
960293694 3:115917025-115917047 AATACCAAGCAGAGGAACAAGGG + Intronic
960876695 3:122303063-122303085 CAGTTCAAGTAGAGAAAGGAAGG - Intergenic
961084238 3:124052893-124052915 CATTCCTAGCAGAGGAAGAAAGG + Intergenic
961101958 3:124207259-124207281 CTTTCCTGGCAGGGGAAGGAGGG - Intronic
961490272 3:127252475-127252497 GATGCCAAGAAGAGGAGGGAAGG + Intergenic
961633426 3:128317986-128318008 CACTCCAGGCAGAGGCAGGATGG + Intronic
963708827 3:148722535-148722557 CATTCTAAGAAGAGGCGGGAGGG + Intronic
963766700 3:149343578-149343600 TATCTCAAGCAGAGAAAGGAAGG + Intergenic
963827184 3:149969337-149969359 CATTCCATGAATAAGAAGGAAGG + Intronic
964055830 3:152456076-152456098 CATTCCAAGGAGAGAAGGGGAGG - Intronic
966406888 3:179607151-179607173 CTTTCCAATCAGAGCAGGGAAGG + Intronic
966568641 3:181413423-181413445 AAGGGCAAGCAGAGGAAGGAAGG + Intergenic
966984975 3:185171928-185171950 CATCCCAAGCTGGAGAAGGAGGG - Intergenic
969042767 4:4313730-4313752 CAGCCCAAGGACAGGAAGGAGGG - Intronic
969079940 4:4610547-4610569 TGTGCCAGGCAGAGGAAGGAAGG + Intergenic
970166231 4:13241270-13241292 CATTCTAAGGAGAAGAAGCAAGG - Intergenic
970600963 4:17640774-17640796 CTTTCCAACAAGAGGAAGAAAGG + Intronic
971252282 4:24983371-24983393 CTTTCCAAGCAGCAAAAGGAGGG - Intergenic
971293059 4:25361704-25361726 CAGTCCAAGCTGAGGACTGAGGG - Intronic
971400815 4:26273792-26273814 CATACCAAGCACTGGAAGGGTGG - Intronic
972766902 4:42159634-42159656 CATTCCAAAGAGAGGATGGAGGG - Intergenic
977798702 4:101199323-101199345 GACTCAAAGCAAAGGAAGGAAGG - Intronic
978921206 4:114184576-114184598 CATTCCAGGCAGAGGAAAGTAGG - Intergenic
979208369 4:118070332-118070354 CATACCATGTGGAGGAAGGATGG - Intronic
979435403 4:120682957-120682979 CATTCAAAGCCAAGGAATGAGGG + Intergenic
979987585 4:127333983-127334005 CAGTGCAAACAGAGGAAGGGAGG - Intergenic
983120176 4:163873719-163873741 CAGTCCAAGAACAGGAAGGAAGG - Intronic
986467568 5:8041488-8041510 CATTGCAAGTAGATGAAGGGTGG - Intergenic
986545548 5:8892667-8892689 GTTTCCATACAGAGGAAGGAGGG - Intergenic
986683952 5:10259620-10259642 CATTCCAGGCTGAGGACAGATGG + Intronic
988052431 5:26048319-26048341 GATTCCAAGAAAAGGGAGGAAGG + Intergenic
988455229 5:31381634-31381656 CCATCCAGGCAGAGGAGGGATGG - Intergenic
989539098 5:42598125-42598147 CATTCCTGGTAGAGGAAGCAAGG + Intronic
990217768 5:53552955-53552977 CACCCCAAGCAGGGGGAGGAAGG - Intergenic
990327719 5:54694609-54694631 CATTCCAGGCAGAAGGAGGAGGG + Intergenic
990681070 5:58245000-58245022 CATTACAATCAGAGGAAGAAGGG + Intergenic
990762334 5:59143224-59143246 CATTCCAAGATGAGAAGGGAGGG - Intronic
991006372 5:61832259-61832281 GATTCCACGCCCAGGAAGGAGGG + Intergenic
991396543 5:66209953-66209975 CATTCCAAGCTGAGAAGGCAAGG - Intergenic
992781460 5:80131935-80131957 CATTTCAAGCGGTGAAAGGAAGG - Intronic
994316528 5:98339526-98339548 GATTCCATGCCCAGGAAGGAAGG - Intergenic
994487881 5:100402025-100402047 CATTCCAAGTTCACGAAGGAGGG + Intergenic
995868379 5:116717375-116717397 AATTCTAAGAACAGGAAGGAAGG - Intergenic
996236164 5:121132826-121132848 CATTAAAAAGAGAGGAAGGAGGG + Intergenic
996880139 5:128287791-128287813 GATTCCATCCAGAGGAAGGAGGG + Intronic
997148963 5:131470875-131470897 CATTCCATACTCAGGAAGGAGGG + Intronic
997165777 5:131659306-131659328 GATTCCATGCTCAGGAAGGAAGG + Intronic
997338792 5:133126538-133126560 TATTCCAAGCAGAGAAGGGAAGG + Intergenic
998162346 5:139820738-139820760 GCTGCCCAGCAGAGGAAGGACGG + Intronic
998921300 5:147071184-147071206 CATTCCAAGGACAGCAAGGCAGG + Intronic
999734655 5:154503824-154503846 CAATGCAAGGAGAGGAAAGAAGG + Intergenic
999822073 5:155238396-155238418 CATTCAAAGCAGAAGTAGGGAGG - Intergenic
999894795 5:156020018-156020040 AATTCGAGGCAGAGGAAGCAAGG - Intronic
1000187592 5:158875211-158875233 AAATCCAAACAGAGGAATGAAGG + Intronic
1001377869 5:171280009-171280031 AATTCCATGCAGAGAAATGAAGG - Intronic
1001408695 5:171495263-171495285 CATGCCCCACAGAGGAAGGAAGG + Intergenic
1001566475 5:172702685-172702707 GATTTTAAGCAGAGGAATGATGG - Intergenic
1001586553 5:172836729-172836751 CATTCCAAGAGAAGGGAGGAGGG + Intronic
1002470580 5:179432890-179432912 CAGTCCCAGCAGAGGCTGGAGGG - Intergenic
1004039423 6:11961077-11961099 CATTCCAGGCAGAGGGTGCAGGG - Intergenic
1004767463 6:18746488-18746510 TATTTCAAGCAGAGGAAAGAAGG - Intergenic
1005153786 6:22780706-22780728 TCTTCCAAGCAGAAGGAGGAAGG - Intergenic
1005489816 6:26337238-26337260 TGTTCAAAGCAGAAGAAGGATGG + Intergenic
1006052089 6:31353013-31353035 CATTATAACCAGAGTAAGGAAGG - Intronic
1006719256 6:36139461-36139483 CCTTTCAAGCAGAGGACAGAAGG + Exonic
1007470025 6:42083793-42083815 CAAGACAAGCAAAGGAAGGAAGG + Intronic
1007723236 6:43898500-43898522 CATTCCAGCCAGAGGGAAGAGGG - Intergenic
1007985792 6:46205764-46205786 GATTCCATGCCCAGGAAGGAAGG - Intergenic
1008552197 6:52644064-52644086 CATTCCGAGCAGAGGCAGACAGG + Intergenic
1008995586 6:57654624-57654646 CATTTAAAGCAAAAGAAGGAAGG - Intergenic
1009184113 6:60553402-60553424 CATTTAAAGCAAAAGAAGGAAGG - Intergenic
1009294560 6:61929919-61929941 CATTCAGACCATAGGAAGGAGGG - Intronic
1011247682 6:85336788-85336810 CATTCCAGGCAGAGAAAGGTTGG + Intergenic
1011512952 6:88121520-88121542 GATTTCAAGCAGTGGAAAGAAGG + Intergenic
1012796549 6:103769571-103769593 AACTCAAACCAGAGGAAGGAAGG - Intergenic
1012841714 6:104336905-104336927 TATTCCAAGCAGAGAATAGATGG - Intergenic
1013145901 6:107391474-107391496 TATTCCAAGCAGGGGATGGGGGG + Intronic
1013890074 6:115016200-115016222 CCTTCAAAGCAGAGCAAGGCAGG - Intergenic
1015416789 6:132958161-132958183 TAATCCAAGGGGAGGAAGGATGG + Intergenic
1015447710 6:133326656-133326678 CACTCCCTGCAGAGGAAGAAAGG - Intronic
1015739259 6:136435711-136435733 GTTTCCAAGTAGAGGAAAGAAGG + Intronic
1016011252 6:139139534-139139556 CATTCCTAGTGGAGGAGGGAAGG + Intronic
1016121407 6:140346665-140346687 CATACCAAAAGGAGGAAGGAAGG - Intergenic
1018215154 6:161519172-161519194 CTTTCCAAGCTGGGGAAGTAGGG + Intronic
1019100821 6:169627824-169627846 CAGCCCATGCAGAGGGAGGAGGG + Intronic
1019168369 6:170114623-170114645 CATCGCAAGAAGAGGGAGGAAGG - Intergenic
1019803642 7:3106541-3106563 CATTCTAAGCAGAAAAGGGAGGG - Intergenic
1019803771 7:3107586-3107608 CATTCTAAGCAGAAAAGGGAGGG - Intergenic
1020444402 7:8254373-8254395 CAGTCCAGGCAGGGGAAGGGAGG + Intronic
1021601063 7:22363934-22363956 CATTCTCAGCAGAGGCAGCACGG - Intergenic
1023348212 7:39293209-39293231 CATGCCAAGGAGAGGGAGGGTGG - Intronic
1024215659 7:47246162-47246184 CCTACCAAGGAGAGGAGGGATGG + Intergenic
1026323486 7:69287674-69287696 CATTTCAAAAAAAGGAAGGAAGG - Intergenic
1026501840 7:70949200-70949222 CATTGCAAGCAGGGGGTGGAGGG - Intergenic
1027025505 7:74849111-74849133 CATTACAAGAAGAAGAAGAAGGG - Intronic
1027062259 7:75095008-75095030 CATTACAAGAAGAAGAAGAAGGG + Intronic
1029211900 7:98916102-98916124 CATTCAATGCTGAGGAGGGAGGG - Intronic
1030503029 7:110384077-110384099 CCTACGAAGCAGAGGAAGAAGGG - Intergenic
1030674211 7:112367708-112367730 CCTTCCAAGAAGAGGAAGAGAGG - Intergenic
1030844586 7:114393408-114393430 GAGCCCAAGCAGAGTAAGGAAGG + Intronic
1031432910 7:121694990-121695012 CATTCCAAGCAGAGGAAATGAGG - Intergenic
1031692368 7:124804791-124804813 CATTCCAAGCAGGGAAAAGGAGG + Intergenic
1031819628 7:126483788-126483810 CATGACCAGCAAAGGAAGGAAGG - Intronic
1032907785 7:136391537-136391559 AATTCCAGGCACAGGAAGGCAGG + Intergenic
1033724609 7:144101202-144101224 GAATCCATGCAGAGGAGGGAAGG - Intergenic
1034106889 7:148497807-148497829 CATTCCACGGAGAGGAATGGTGG - Intergenic
1034474863 7:151276295-151276317 GATGCCAGGCAGGGGAAGGAGGG + Intronic
1034889519 7:154827677-154827699 CAGCCCAAGCAGAGTGAGGAGGG + Intronic
1035107237 7:156452102-156452124 CATTCCAGGCAGAGGGAACAAGG - Intergenic
1035170430 7:157014395-157014417 CTTCCCAAGTAGTGGAAGGAAGG - Intergenic
1035224990 7:157428028-157428050 CGTCCCCAGCAGAGGGAGGAGGG + Intergenic
1035321482 7:158032351-158032373 CTTTCAAAGCCGGGGAAGGAGGG - Intronic
1035334946 7:158121801-158121823 CTTGCCAGGCTGAGGAAGGAAGG - Intronic
1035545268 8:476947-476969 CAGTCAAAGCAGTGGTAGGAGGG - Intergenic
1035568502 8:657896-657918 CACTCCCAGAAGAGGAAGAATGG + Intronic
1035587523 8:787380-787402 CGTTGCAAGCCGAGGAAGGGTGG + Intergenic
1035945111 8:3953975-3953997 CATCACCACCAGAGGAAGGAAGG - Intronic
1036696817 8:10980200-10980222 CCTTCCAGGCAGAGGCAGGAAGG + Intronic
1036943359 8:13071793-13071815 CATTCCAAGCAGGGGCAAGCTGG - Intergenic
1037082074 8:14799642-14799664 CCTACTAGGCAGAGGAAGGAGGG + Intronic
1037624698 8:20596573-20596595 AATTCCCAGCAGAGGCAGGTGGG + Intergenic
1037724501 8:21472315-21472337 GACCACAAGCAGAGGAAGGAAGG + Intergenic
1037752342 8:21690998-21691020 CCTTCCATGCAGAGGCTGGAAGG + Exonic
1039712263 8:40067625-40067647 CATCCCAAGAGGAGTAAGGAGGG + Intergenic
1039739110 8:40363746-40363768 CATTCTAAGCAGTGAAAGAAAGG + Intergenic
1040894285 8:52349842-52349864 TATCCCAGGCAGAGCAAGGAGGG + Intronic
1042626542 8:70764231-70764253 CAGTCCCAGCAGAGTAAAGAGGG - Intronic
1042934911 8:74048556-74048578 CATTCCAGCCAGTGGAAGGAAGG + Intergenic
1043165072 8:76893430-76893452 CCTTACAAGGAAAGGAAGGAAGG - Intergenic
1043204556 8:77420626-77420648 CATTCCTAGCAGCTGGAGGATGG + Intergenic
1044325404 8:90852586-90852608 CTTTACAGGCAGAGGATGGAGGG - Intronic
1045338659 8:101232307-101232329 AGTTCCAAGCAGAAGAAGCATGG + Intergenic
1045351611 8:101345811-101345833 CATTCCACACAGAGGAACCATGG - Intergenic
1045352958 8:101359364-101359386 CATTCCCATAACAGGAAGGAGGG - Intergenic
1046939848 8:119920546-119920568 CATTCTAAGCAGAGGCATGGAGG + Intronic
1047925866 8:129682127-129682149 CATTCCCAGCAGTGTCAGGATGG + Intergenic
1048164787 8:132053038-132053060 CAGTACAAGCAAAGGCAGGATGG - Intronic
1048494267 8:134922235-134922257 CATATCAAAGAGAGGAAGGAAGG + Intergenic
1048598716 8:135895549-135895571 CATTCCAAGTAGAAGGAGGAAGG - Intergenic
1049929395 9:441487-441509 CACTCCCTGGAGAGGAAGGATGG - Intronic
1050158753 9:2695279-2695301 CATTTCAAGCAGAAGAGGCAAGG - Intergenic
1050238028 9:3603571-3603593 CCTTCAAAGCAGAGTAAGCAAGG + Intergenic
1050768417 9:9165413-9165435 CATTCTATGCAGATGAAGGTAGG + Intronic
1051334229 9:16052205-16052227 CAGTCCAAGTACTGGAAGGAGGG + Intronic
1051540659 9:18213165-18213187 AATTCCAAGGAGGGGAAAGAGGG - Intergenic
1051693990 9:19748780-19748802 CATTCCTAGAAACGGAAGGAAGG + Intronic
1054912700 9:70468451-70468473 AATTTCAGGCAGAGGAAGGAGGG - Intergenic
1055768267 9:79688772-79688794 CATTCCAATTAGCTGAAGGAAGG + Intronic
1057298833 9:93864938-93864960 CATTTCACGCAGAGGAACCATGG + Intergenic
1057613416 9:96567095-96567117 CGTTCCCAGCTGGGGAAGGAAGG - Intronic
1057724945 9:97561819-97561841 CATTACAGGCAGAGGAATGCAGG - Intronic
1057797926 9:98171657-98171679 CAAGCCCAGCAGAGGAGGGAAGG + Intronic
1058084288 9:100732021-100732043 GATTCCATGCCCAGGAAGGAAGG - Intergenic
1058945546 9:109852257-109852279 CATTCCAAAAGGAGGGAGGAAGG - Intronic
1059015086 9:110506734-110506756 GTTTCCAAGCAGGGGAAGGAGGG + Intronic
1059111100 9:111559202-111559224 GATCCCTAGCAGAGGTAGGAGGG - Intronic
1059427490 9:114230333-114230355 CCTTCCTTGCAGAGGAAGGAAGG + Intronic
1059760701 9:117334643-117334665 CATTCCAAGAAGAGGGAGTGAGG - Intronic
1061599554 9:131658510-131658532 CATTCCTTCCAGAGGAAGGGTGG + Intronic
1062460502 9:136660790-136660812 CTCCCCAAGAAGAGGAAGGAAGG + Intronic
1062729922 9:138103114-138103136 CATTCCTAGGAAAGGAAGGGAGG - Intronic
1185872881 X:3679213-3679235 GATTCCAAAAAGAGGAAGGGAGG - Intronic
1186427805 X:9477996-9478018 CATCCCCAGGAGAGGAAGGTGGG + Intronic
1186788001 X:12971401-12971423 GATTCCAATCAGTGGAAGGAGGG + Intergenic
1187285332 X:17898762-17898784 CATCACACGCAGAGGCAGGAAGG - Intergenic
1187581306 X:20610267-20610289 CTTCCCAAGCAGCAGAAGGAAGG + Intergenic
1188146406 X:26619015-26619037 CATTCTAAGTAGGGGATGGAGGG + Intergenic
1188257116 X:27976683-27976705 GATGCAAAGCAGAGGAAGCAAGG + Intergenic
1188365955 X:29315302-29315324 AATTCCAACCAGAGGATGGAAGG + Intronic
1188612368 X:32116185-32116207 CATTCCAGGCAGAGGAAACAAGG - Intronic
1188983911 X:36752646-36752668 CATTGCAAGCAGAATAAGGGAGG + Intergenic
1189957242 X:46288327-46288349 GATTCCATGCCCAGGAAGGAAGG + Intergenic
1190054356 X:47173293-47173315 CATTCCCAGCTGTGGCAGGAAGG - Intronic
1190446127 X:50526211-50526233 CATTCCAGGCTGAGGGAGCAGGG + Intergenic
1190481193 X:50878502-50878524 CATACCTAGCAGAGGAAAGGGGG + Intergenic
1191849018 X:65571896-65571918 GATTCTGAGCAGAGGGAGGAAGG + Intergenic
1194681166 X:96855110-96855132 TATTCCAAGCAACGGAAAGATGG - Intronic
1194695257 X:97040308-97040330 CATCCCAAGCTGAGAAATGATGG - Intronic
1195919042 X:109964208-109964230 CATTCCAACCTGTGGAAGGGGGG + Intergenic
1196998011 X:121405538-121405560 CATTCAAACAAGAGGAAAGATGG + Intergenic
1198769717 X:140117041-140117063 CATTGCAAGCAGTGGAGTGAGGG + Intergenic
1199692340 X:150318144-150318166 GCTTCCAAGCAGAGGCATGATGG - Intergenic
1201622378 Y:15974253-15974275 CATTTAAATCAGAGGAAAGAGGG - Intergenic
1201784270 Y:17757317-17757339 GATTCCATGCACGGGAAGGAAGG + Intergenic
1201817283 Y:18148670-18148692 GATTCCATGCACGGGAAGGAAGG - Intergenic
1202379278 Y:24261568-24261590 CATTCCCAGCAGGGGGAGAAAGG - Intergenic
1202491504 Y:25408553-25408575 CATTCCCAGCAGGGGGAGAAAGG + Intergenic