ID: 953352894

View in Genome Browser
Species Human (GRCh38)
Location 3:42229526-42229548
Sequence TTGGAGCCCCAAACTCATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953352894_953352902 9 Left 953352894 3:42229526-42229548 CCCTGATGAGTTTGGGGCTCCAA No data
Right 953352902 3:42229558-42229580 AGCTCATTTGGCAGGGGTCCTGG No data
953352894_953352900 2 Left 953352894 3:42229526-42229548 CCCTGATGAGTTTGGGGCTCCAA No data
Right 953352900 3:42229551-42229573 ACAGATGAGCTCATTTGGCAGGG No data
953352894_953352904 11 Left 953352894 3:42229526-42229548 CCCTGATGAGTTTGGGGCTCCAA No data
Right 953352904 3:42229560-42229582 CTCATTTGGCAGGGGTCCTGGGG No data
953352894_953352905 19 Left 953352894 3:42229526-42229548 CCCTGATGAGTTTGGGGCTCCAA No data
Right 953352905 3:42229568-42229590 GCAGGGGTCCTGGGGAAGTAAGG No data
953352894_953352898 -3 Left 953352894 3:42229526-42229548 CCCTGATGAGTTTGGGGCTCCAA No data
Right 953352898 3:42229546-42229568 CAAGGACAGATGAGCTCATTTGG No data
953352894_953352903 10 Left 953352894 3:42229526-42229548 CCCTGATGAGTTTGGGGCTCCAA No data
Right 953352903 3:42229559-42229581 GCTCATTTGGCAGGGGTCCTGGG No data
953352894_953352901 3 Left 953352894 3:42229526-42229548 CCCTGATGAGTTTGGGGCTCCAA No data
Right 953352901 3:42229552-42229574 CAGATGAGCTCATTTGGCAGGGG No data
953352894_953352899 1 Left 953352894 3:42229526-42229548 CCCTGATGAGTTTGGGGCTCCAA No data
Right 953352899 3:42229550-42229572 GACAGATGAGCTCATTTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953352894 Original CRISPR TTGGAGCCCCAAACTCATCA GGG (reversed) Intergenic
No off target data available for this crispr