ID: 953356563

View in Genome Browser
Species Human (GRCh38)
Location 3:42261118-42261140
Sequence CAATTCTATTGGAGGGCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 97}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953356563 Original CRISPR CAATTCTATTGGAGGGCAGT GGG (reversed) Intronic
902476383 1:16690770-16690792 CATTTCTATTGGACAGCACTGGG + Intergenic
905698298 1:39992347-39992369 TAATTCTATTGGTGGTGAGTAGG + Intergenic
910893331 1:92040885-92040907 AAATACTTTTGGAGTGCAGTAGG - Intronic
912231972 1:107804926-107804948 CAATACTCTTGGATGGCAGCAGG + Intronic
912637710 1:111314014-111314036 CAATTCGGTTGGATTGCAGTAGG - Intronic
918090751 1:181292150-181292172 GAAATCTATTGGAGGGCACCTGG + Intergenic
922041024 1:221897622-221897644 CACTTGTATTGCAGGGCAGAAGG + Intergenic
924060502 1:240169361-240169383 CAATTCTTTTTGAGGTCAGTAGG + Intronic
1063393361 10:5664556-5664578 CAATTCTACTGGAGGACCCTGGG + Intronic
1068220567 10:54039958-54039980 AGATTCTATGTGAGGGCAGTGGG + Intronic
1069784225 10:70977658-70977680 CAATTCTTCTGGGGTGCAGTGGG + Intergenic
1070676702 10:78416769-78416791 CATGTCTAATGTAGGGCAGTGGG - Intergenic
1070907397 10:80085135-80085157 CAATTTTTTTGAAGGGCAGAGGG + Intronic
1077395708 11:2320090-2320112 CAGTGCTAGTGGAGGGGAGTGGG + Intergenic
1083395262 11:62386857-62386879 CCATTCTACTGGAGGGCAGGTGG + Intronic
1084933269 11:72573695-72573717 CAAGACTATTGTAGGGCATTGGG - Intergenic
1094175216 12:27534203-27534225 AAAATCAAGTGGAGGGCAGTGGG + Intronic
1100000386 12:89827617-89827639 CAATTCTATAGGTTGGCATTTGG + Intergenic
1110589158 13:77234401-77234423 AAATTTTATTAGAGGGCAGTAGG - Intronic
1112640377 13:101267418-101267440 GAATTCAATTGGAGGCCACTGGG - Intronic
1113293431 13:108931296-108931318 CATTGCTATTGGAGGGCAGAAGG - Intronic
1113598519 13:111551477-111551499 CAATTTAATTAGAGGGCAGTGGG + Intergenic
1115793376 14:36905007-36905029 CAATTATTTTGGAAGGGAGTAGG - Intronic
1121026892 14:90622731-90622753 TAATTCTTTTGGGGGGAAGTGGG - Intronic
1121576681 14:94994650-94994672 CATTTCCATTAGAGGGCAGTAGG + Intergenic
1122310224 14:100789563-100789585 CAATTCTCCTGGAGGGCTGCAGG - Intergenic
1129686439 15:77688685-77688707 CAATTCTTTTGGAGGGAGGTGGG - Intronic
1133799856 16:9076356-9076378 AAATTCGAATGGAGAGCAGTGGG + Intergenic
1135105266 16:19643994-19644016 CATTTGTATTGAAGGACAGTGGG + Intronic
1138322910 16:56133386-56133408 CACTTCTATTGGATAGCACTGGG - Intergenic
1140674972 16:77319341-77319363 CCATTCTCTTGGAGGCCATTTGG + Intronic
1147669926 17:42171049-42171071 GACTTCATTTGGAGGGCAGTGGG + Intronic
1156581757 18:38385279-38385301 TTATTCTATTCGAGTGCAGTAGG - Intergenic
1157874838 18:51262729-51262751 AAGTTCTATAGGAGGGCACTTGG - Intergenic
1160801831 19:973968-973990 CATTTCTCTTGGGGTGCAGTGGG + Exonic
1202710404 1_KI270714v1_random:16611-16633 CATTTCTATTGGACAGCACTGGG + Intergenic
934885077 2:98017243-98017265 CAATTCTATGAGAGGGAGGTGGG + Intergenic
938276790 2:130033374-130033396 AAGTTCTATTGCAGGGCAGCTGG - Intergenic
938727938 2:134123169-134123191 CAATGCTTTTGGAGGACAGCTGG - Intronic
938761171 2:134427489-134427511 CGATTTTATTTGAGGGGAGTAGG - Intronic
939106479 2:137954398-137954420 CAAGTTTATTGGAGGTCTGTGGG - Intergenic
940859888 2:158760804-158760826 CAATTCTATTTTAGGGGTGTAGG - Intergenic
945192168 2:207200197-207200219 GAATTCTATTAGAGGTCCGTGGG - Intergenic
1169603308 20:7287065-7287087 CAGCTCTTGTGGAGGGCAGTGGG - Intergenic
1170856238 20:20058191-20058213 CAATTTTACTAGAGGGCAGTAGG + Intronic
1171947450 20:31390908-31390930 CAATTCTATTGGGGTGTTGTTGG + Intergenic
1173129786 20:40380496-40380518 CAATTATTTTGGAGGGAGGTTGG + Intergenic
1173278482 20:41605334-41605356 CCATTCTAATGGAAGGGAGTTGG - Intronic
1174597824 20:51698589-51698611 CAATTCCAGTGGAGGGGAGGAGG + Intronic
1179106538 21:38405508-38405530 CAATTAGGCTGGAGGGCAGTTGG + Intronic
1181841658 22:25668550-25668572 CAATTCTATTGGAGTTCAAGAGG + Intronic
950967936 3:17159300-17159322 CCATTTTCTTGGAGGGCAGGTGG + Intronic
953356563 3:42261118-42261140 CAATTCTATTGGAGGGCAGTGGG - Intronic
955820512 3:62891328-62891350 AAATTCTTTTGGATAGCAGTGGG + Intergenic
959842311 3:110991781-110991803 CAATTCCACTGGAGGACAATTGG + Intergenic
962036281 3:131655010-131655032 TAATTGAATTGGAGTGCAGTGGG + Intronic
965579511 3:170252273-170252295 TAACTCTTTTGGAGGACAGTTGG + Intronic
965780881 3:172284803-172284825 CAAGTCTAGTGGAGGGAGGTGGG - Intronic
966215938 3:177502479-177502501 CAATTCCATTGTAGGACACTGGG + Intergenic
974648065 4:64719101-64719123 CAATTATATTGGGGGGCTGGAGG + Intergenic
978597332 4:110392390-110392412 CAAAACTATTGGAGGGGAGATGG - Intronic
980557804 4:134431476-134431498 CAGTTCTACTGCAGGCCAGTAGG - Intergenic
980606929 4:135104422-135104444 CAATTTTTTTAGATGGCAGTAGG - Intergenic
982511855 4:156292633-156292655 TAATTCTATTGGAGCGGAGCAGG - Intergenic
982569880 4:157035250-157035272 AGATTCTATTGGATGGCATTGGG + Intergenic
984305125 4:177979593-177979615 CAATGCTATTGTATGGCAGGGGG + Intronic
986354354 5:6909239-6909261 CCATTCAATTGGAGGGATGTGGG - Intergenic
988461735 5:31445002-31445024 CAATTTTTGTGGAGGCCAGTGGG + Intronic
990206071 5:53430829-53430851 GAATTCCACTAGAGGGCAGTTGG - Intergenic
991182410 5:63767814-63767836 CAATTCTATGGGAAAGTAGTAGG - Intergenic
991438353 5:66619021-66619043 CAAGTCTTGTGGAGGGTAGTAGG + Intronic
998396079 5:141818937-141818959 CAATGGGATTGGAGGCCAGTGGG + Intergenic
1000006977 5:157194833-157194855 CAATACTATTTGAGGGAACTAGG + Intronic
1001534080 5:172486410-172486432 CAACCCTCTTGGAGGGCAGAAGG + Intergenic
1001965575 5:175907682-175907704 CAATACCATTGGAAGGGAGTGGG - Intergenic
1004878491 6:19980942-19980964 CTATTCTATAGGAAAGCAGTTGG + Intergenic
1006547248 6:34790485-34790507 CAGTCCTACTGGAGGGGAGTGGG + Intergenic
1007957346 6:45929747-45929769 CAGTTCTTTTGGAGGACAGTTGG - Intronic
1010408270 6:75530991-75531013 CAATTCTGTAGGAGGGAAGATGG - Intergenic
1011134187 6:84081908-84081930 CAATTTTAGTGGAAGGCAGAGGG - Intronic
1014091747 6:117411679-117411701 CAGTTCATATGGAGGGCAGTGGG - Intronic
1016763839 6:147770220-147770242 CAATACTAATGGAAGGCAGCAGG - Intergenic
1017613586 6:156218082-156218104 CCATTCTATTGGAAGCCTGTGGG - Intergenic
1018034964 6:159874054-159874076 CAATTCTATTTGAGAGCCTTGGG + Intergenic
1018775469 6:167010736-167010758 AAATTCTATTGGAGTGTAATTGG + Intronic
1019440533 7:1044182-1044204 CATTTCCTTTGGAGGGCGGTGGG + Intronic
1024050841 7:45622322-45622344 CAGGTCTAGTGGAGGGCAGATGG + Intronic
1028607710 7:92673184-92673206 CAGTTATATGGGAGGTCAGTTGG - Intronic
1032682211 7:134196406-134196428 CAATTCTGTTGGATGACATTTGG + Intronic
1036682583 8:10886300-10886322 CAATTCTGTCCGAGGGCAGAAGG + Intergenic
1038417879 8:27410484-27410506 CAATCCTGGTGGAGGACAGTGGG + Intronic
1039829749 8:41203707-41203729 CAAGTCTAACGGAGAGCAGTTGG - Intergenic
1045246996 8:100451290-100451312 CAACACTTTTGGAGGCCAGTTGG + Intergenic
1045495104 8:102701472-102701494 CAGCTCTGTTGGAGGGAAGTGGG + Intergenic
1045729409 8:105217762-105217784 CAACTCTATTGGAGATAAGTTGG + Intronic
1048691671 8:136971943-136971965 CAATTGTGGTGGAAGGCAGTGGG - Intergenic
1051178353 9:14383951-14383973 CAATTGTATAGGAGGGCATGTGG + Intronic
1052067153 9:24036093-24036115 CAGTTCTACTGGAAGGCAGAAGG + Intergenic
1186791028 X:12998900-12998922 AAATTTTTTTAGAGGGCAGTAGG + Intergenic
1190105653 X:47559360-47559382 AAATTATATGGGAGGCCAGTAGG + Intergenic
1190895864 X:54617391-54617413 CAATTATAGTAGAGGGCAGAGGG - Intergenic
1192315803 X:70050374-70050396 CAATGGGATTGGAGGGCAGAGGG + Intergenic
1193692839 X:84668326-84668348 CAATTCCAAAGGAGGGCTGTTGG + Intergenic
1194412989 X:93578644-93578666 CAATCCTGTTGGGGGGCAGAGGG - Intergenic
1197467164 X:126819515-126819537 TAATTCTGATGCAGGGCAGTTGG - Intergenic
1199280355 X:145993492-145993514 CATGTACATTGGAGGGCAGTGGG - Intergenic
1200918176 Y:8589821-8589843 CACTTCTATCGGAGGGCTGCAGG + Intergenic