ID: 953357031

View in Genome Browser
Species Human (GRCh38)
Location 3:42264817-42264839
Sequence GCGTTGGGTAAATACATGAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 39
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 37}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953357031_953357035 10 Left 953357031 3:42264817-42264839 CCAGTCATGTATTTACCCAACGC 0: 1
1: 0
2: 0
3: 1
4: 37
Right 953357035 3:42264850-42264872 TGGCAGTAACACGTGCTCAGAGG 0: 1
1: 0
2: 1
3: 6
4: 92
953357031_953357032 -10 Left 953357031 3:42264817-42264839 CCAGTCATGTATTTACCCAACGC 0: 1
1: 0
2: 0
3: 1
4: 37
Right 953357032 3:42264830-42264852 TACCCAACGCTGACGCAGACTGG 0: 1
1: 0
2: 0
3: 2
4: 30
953357031_953357039 22 Left 953357031 3:42264817-42264839 CCAGTCATGTATTTACCCAACGC 0: 1
1: 0
2: 0
3: 1
4: 37
Right 953357039 3:42264862-42264884 GTGCTCAGAGGGCGGCCACTGGG 0: 1
1: 0
2: 1
3: 14
4: 135
953357031_953357036 11 Left 953357031 3:42264817-42264839 CCAGTCATGTATTTACCCAACGC 0: 1
1: 0
2: 0
3: 1
4: 37
Right 953357036 3:42264851-42264873 GGCAGTAACACGTGCTCAGAGGG 0: 1
1: 0
2: 1
3: 6
4: 106
953357031_953357037 14 Left 953357031 3:42264817-42264839 CCAGTCATGTATTTACCCAACGC 0: 1
1: 0
2: 0
3: 1
4: 37
Right 953357037 3:42264854-42264876 AGTAACACGTGCTCAGAGGGCGG 0: 1
1: 0
2: 0
3: 9
4: 112
953357031_953357040 23 Left 953357031 3:42264817-42264839 CCAGTCATGTATTTACCCAACGC 0: 1
1: 0
2: 0
3: 1
4: 37
Right 953357040 3:42264863-42264885 TGCTCAGAGGGCGGCCACTGGGG 0: 1
1: 0
2: 0
3: 10
4: 206
953357031_953357038 21 Left 953357031 3:42264817-42264839 CCAGTCATGTATTTACCCAACGC 0: 1
1: 0
2: 0
3: 1
4: 37
Right 953357038 3:42264861-42264883 CGTGCTCAGAGGGCGGCCACTGG 0: 1
1: 0
2: 1
3: 9
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953357031 Original CRISPR GCGTTGGGTAAATACATGAC TGG (reversed) Exonic
903214867 1:21838428-21838450 GGGCTGGGTAAATGCTTGACAGG - Intronic
911136567 1:94446683-94446705 GGGTTGGGTAGATACAGGAGCGG + Intronic
911170990 1:94770789-94770811 GCTCTGGGTGAATACATGAGTGG - Intergenic
916424349 1:164666408-164666430 GCATTAGCTAAATACATCACTGG - Intronic
1065056679 10:21851626-21851648 GCTTTGGGTATATACCTGATTGG - Intronic
1068608929 10:59037270-59037292 GCATTTTGTAAATACATAACAGG - Intergenic
1070095119 10:73329929-73329951 AAGTATGGTAAATACATGACAGG - Intronic
1075177970 10:120183614-120183636 GAGTTGGGAAAAAACATAACTGG - Intergenic
1102657508 12:114494869-114494891 TCTTTGGGTAAATACATCATGGG - Intergenic
1102734653 12:115148243-115148265 GCCTAGGCTAAATACATAACTGG + Intergenic
1104213822 12:126715969-126715991 GTGTTGGGTTCACACATGACAGG - Intergenic
1110001201 13:70203720-70203742 GCTTTGGGTCAAGAGATGACGGG + Intergenic
1148220200 17:45855785-45855807 GCGTGGGGAAAACAAATGACTGG - Intergenic
929744376 2:44640846-44640868 GCTTTGGGAAAATTCATGGCTGG - Intronic
931629707 2:64287757-64287779 TTGTTGGGTAAATACAAAACTGG + Intergenic
941388150 2:164878550-164878572 TGGGTGGGTAAATAAATGACTGG - Intergenic
1174669792 20:52296242-52296264 ACGTTGAATAAATACATGGCAGG + Intergenic
1177396293 21:20539523-20539545 ATGTTTGGTAAATACTTGACTGG - Intergenic
1184135475 22:42546859-42546881 GTTTTAGATAAATACATGACTGG + Intergenic
952629556 3:35449220-35449242 GCAGTAGGTAATTACATGACAGG + Intergenic
953357031 3:42264817-42264839 GCGTTGGGTAAATACATGACTGG - Exonic
961969610 3:130946599-130946621 ACGTTGGGTAAATCCATTACTGG + Intronic
969125777 4:4946777-4946799 GGGCTGGGTAAATACAAGAACGG - Intergenic
980065836 4:128187480-128187502 GCCTTGGGTAAATACACAAAAGG - Intronic
985718705 5:1477178-1477200 ACGTTGGGAAGATGCATGACTGG - Intronic
985925448 5:3012607-3012629 GCCTTGGGTAAATTCAGGGCAGG - Intergenic
998643407 5:144037316-144037338 GCCTTGGCTAATTACAGGACTGG + Intergenic
1000616776 5:163436505-163436527 GCCTTGGGTAAGTACACGGCAGG + Intergenic
1006895320 6:37464806-37464828 CCCTTGGGTAAATACCTGAGTGG + Intronic
1012377519 6:98580457-98580479 GCTTTGGGTAAATCCATCAGGGG - Intergenic
1027767370 7:82362617-82362639 GCTTTGGGAAAATACATGTAGGG - Intronic
1032945622 7:136848922-136848944 GCTTTGGGTAAATACACCATAGG - Intergenic
1041301049 8:56411783-56411805 ACGTTGGTTAAATAAATGAATGG - Intergenic
1045867085 8:106879831-106879853 GCTTTGGTTAAAAATATGACGGG + Intergenic
1049046870 8:140159314-140159336 GTGTGGGATAAATCCATGACTGG - Intronic
1055634190 9:78258642-78258664 GTATTAGGTAACTACATGACCGG - Intronic
1062344609 9:136109113-136109135 GCGTGGGGTAAATGCAGGGCGGG - Intergenic
1194915150 X:99697825-99697847 ACGCTGGGTAAATAAATGAGTGG - Intergenic
1196504570 X:116426227-116426249 GTGTTGTGTAATTACAAGACAGG + Intergenic