ID: 953357032

View in Genome Browser
Species Human (GRCh38)
Location 3:42264830-42264852
Sequence TACCCAACGCTGACGCAGAC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 33
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 30}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953357028_953357032 7 Left 953357028 3:42264800-42264822 CCACCCGGCGGCGTCGGCCAGTC 0: 1
1: 0
2: 0
3: 3
4: 52
Right 953357032 3:42264830-42264852 TACCCAACGCTGACGCAGACTGG 0: 1
1: 0
2: 0
3: 2
4: 30
953357027_953357032 8 Left 953357027 3:42264799-42264821 CCCACCCGGCGGCGTCGGCCAGT 0: 1
1: 0
2: 0
3: 1
4: 35
Right 953357032 3:42264830-42264852 TACCCAACGCTGACGCAGACTGG 0: 1
1: 0
2: 0
3: 2
4: 30
953357029_953357032 4 Left 953357029 3:42264803-42264825 CCCGGCGGCGTCGGCCAGTCATG 0: 1
1: 0
2: 0
3: 3
4: 31
Right 953357032 3:42264830-42264852 TACCCAACGCTGACGCAGACTGG 0: 1
1: 0
2: 0
3: 2
4: 30
953357030_953357032 3 Left 953357030 3:42264804-42264826 CCGGCGGCGTCGGCCAGTCATGT 0: 1
1: 0
2: 0
3: 1
4: 7
Right 953357032 3:42264830-42264852 TACCCAACGCTGACGCAGACTGG 0: 1
1: 0
2: 0
3: 2
4: 30
953357026_953357032 9 Left 953357026 3:42264798-42264820 CCCCACCCGGCGGCGTCGGCCAG 0: 1
1: 0
2: 0
3: 4
4: 99
Right 953357032 3:42264830-42264852 TACCCAACGCTGACGCAGACTGG 0: 1
1: 0
2: 0
3: 2
4: 30
953357031_953357032 -10 Left 953357031 3:42264817-42264839 CCAGTCATGTATTTACCCAACGC 0: 1
1: 0
2: 0
3: 1
4: 37
Right 953357032 3:42264830-42264852 TACCCAACGCTGACGCAGACTGG 0: 1
1: 0
2: 0
3: 2
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953357032 Original CRISPR TACCCAACGCTGACGCAGAC TGG Exonic
900108342 1:995665-995687 TACCCACCTCGGACGCAGCCGGG - Intergenic
902805912 1:18861259-18861281 TGCCCAGCGATGACGCAGACAGG - Intronic
908221519 1:62011621-62011643 TACCCAAATGTGACACAGACAGG + Intronic
916194389 1:162209933-162209955 TAGCCAAGGCTGATGCAGAGTGG + Intronic
921219396 1:212962442-212962464 TACCCAGCCCTGAGGCAGAAAGG + Intronic
1071241103 10:83706104-83706126 TCCCCAAAGCTGAAGCAGAAGGG + Intergenic
1085767380 11:79295014-79295036 TGCACAAGGATGACGCAGACAGG + Intronic
1090079854 11:123604922-123604944 TCCCAAACGGTGACGAAGACAGG - Intronic
1095134879 12:38588259-38588281 TAGCCCACGGTGACCCAGACAGG - Intergenic
1106952933 13:34905084-34905106 TACTCCACACTGACCCAGACTGG - Intergenic
1110296753 13:73876531-73876553 TACTCTAGGCTGAAGCAGACAGG + Intronic
1132610583 16:813896-813918 CACCCAACGCTGGCCCAGCCCGG + Intergenic
1156102587 18:33615493-33615515 TACCAAACTATGACACAGACAGG + Intronic
1168312738 19:55469223-55469245 TTCCCAACCCAGACGCAGAGGGG + Intergenic
927477122 2:23422621-23422643 TACACAACACAGACACAGACAGG - Intronic
932515119 2:72338788-72338810 TACCCAAGGCTGCTACAGACAGG + Intronic
937984266 2:127631546-127631568 AGCCCCACGCTGACACAGACTGG - Intronic
1172005847 20:31818872-31818894 TACCCAAAGGTGACGCAAGCAGG + Intergenic
1172794773 20:37529076-37529098 AAGCCAATGCTGACTCAGACAGG + Intergenic
953357032 3:42264830-42264852 TACCCAACGCTGACGCAGACTGG + Exonic
971061370 4:22975252-22975274 TACCCAACACTGGAGCACACAGG - Intergenic
979494206 4:121366182-121366204 AACCCAACACTGAAGCAGACTGG + Intronic
985264702 4:188146940-188146962 TACCCAGCACAGTCGCAGACTGG - Exonic
987075665 5:14379883-14379905 TACCCAGTGCTTTCGCAGACCGG + Intronic
988407303 5:30840314-30840336 TACCCATCGCTGTCTCAGAGAGG - Intergenic
989796912 5:45485544-45485566 TTCCCAACACTTACGCAGAAGGG + Intronic
1004179344 6:13367474-13367496 TACCCCACCCTGAAGCAGATGGG - Intronic
1015773041 6:136788347-136788369 TTCCCAAGGCTGATGCAGAATGG - Intronic
1019814867 7:3192248-3192270 TACCCAACACAGGCGCAGCCTGG - Intergenic
1035726553 8:1827965-1827987 TAGCCAATGCTGATGCAGCCAGG - Intronic
1043050857 8:75383809-75383831 TTCCCAACCCTGATGCAAACAGG - Intergenic
1191717882 X:64205556-64205578 TACGCAACGCTTACCCAGCCCGG + Exonic
1193506682 X:82352368-82352390 TACCCAACACTGAAGCACCCAGG + Intergenic