ID: 953362485

View in Genome Browser
Species Human (GRCh38)
Location 3:42310087-42310109
Sequence GAGTCGTAGGTGAATTTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953362485_953362488 5 Left 953362485 3:42310087-42310109 CCTTTCAAATTCACCTACGACTC No data
Right 953362488 3:42310115-42310137 CACTTTAGCCCACAGTAGTGAGG No data
953362485_953362489 10 Left 953362485 3:42310087-42310109 CCTTTCAAATTCACCTACGACTC No data
Right 953362489 3:42310120-42310142 TAGCCCACAGTAGTGAGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953362485 Original CRISPR GAGTCGTAGGTGAATTTGAA AGG (reversed) Intergenic
No off target data available for this crispr