ID: 953363700

View in Genome Browser
Species Human (GRCh38)
Location 3:42323597-42323619
Sequence TATGGTTCTAAAGTTGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953363700_953363706 17 Left 953363700 3:42323597-42323619 CCTGCTTCAACTTTAGAACCATA No data
Right 953363706 3:42323637-42323659 TGGACTTACAGTAGTCCTTAAGG No data
953363700_953363703 -3 Left 953363700 3:42323597-42323619 CCTGCTTCAACTTTAGAACCATA No data
Right 953363703 3:42323617-42323639 ATAAGTCGGATGCCCTCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953363700 Original CRISPR TATGGTTCTAAAGTTGAAGC AGG (reversed) Intergenic
No off target data available for this crispr