ID: 953364947

View in Genome Browser
Species Human (GRCh38)
Location 3:42336402-42336424
Sequence AGGACCTATATTTGTTCATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953364947_953364951 11 Left 953364947 3:42336402-42336424 CCAGATGAACAAATATAGGTCCT No data
Right 953364951 3:42336436-42336458 CTTCCTTTCTATATAGAAGGAGG No data
953364947_953364954 30 Left 953364947 3:42336402-42336424 CCAGATGAACAAATATAGGTCCT No data
Right 953364954 3:42336455-42336477 GAGGCTGGAATGAAGATAGATGG No data
953364947_953364953 15 Left 953364947 3:42336402-42336424 CCAGATGAACAAATATAGGTCCT No data
Right 953364953 3:42336440-42336462 CTTTCTATATAGAAGGAGGCTGG No data
953364947_953364950 8 Left 953364947 3:42336402-42336424 CCAGATGAACAAATATAGGTCCT No data
Right 953364950 3:42336433-42336455 GAACTTCCTTTCTATATAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953364947 Original CRISPR AGGACCTATATTTGTTCATC TGG (reversed) Intergenic
No off target data available for this crispr