ID: 953364949

View in Genome Browser
Species Human (GRCh38)
Location 3:42336422-42336444
Sequence GAAAGGAAGTTCCTGAGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953364949_953364953 -5 Left 953364949 3:42336422-42336444 CCTCAGCTCAGGAACTTCCTTTC No data
Right 953364953 3:42336440-42336462 CTTTCTATATAGAAGGAGGCTGG No data
953364949_953364951 -9 Left 953364949 3:42336422-42336444 CCTCAGCTCAGGAACTTCCTTTC No data
Right 953364951 3:42336436-42336458 CTTCCTTTCTATATAGAAGGAGG No data
953364949_953364954 10 Left 953364949 3:42336422-42336444 CCTCAGCTCAGGAACTTCCTTTC No data
Right 953364954 3:42336455-42336477 GAGGCTGGAATGAAGATAGATGG No data
953364949_953364955 29 Left 953364949 3:42336422-42336444 CCTCAGCTCAGGAACTTCCTTTC No data
Right 953364955 3:42336474-42336496 ATGGCCATCCCAGTAGAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953364949 Original CRISPR GAAAGGAAGTTCCTGAGCTG AGG (reversed) Intergenic
No off target data available for this crispr