ID: 953364953 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:42336440-42336462 |
| Sequence | CTTTCTATATAGAAGGAGGC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 953364947_953364953 | 15 | Left | 953364947 | 3:42336402-42336424 | CCAGATGAACAAATATAGGTCCT | No data | ||
| Right | 953364953 | 3:42336440-42336462 | CTTTCTATATAGAAGGAGGCTGG | No data | ||||
| 953364949_953364953 | -5 | Left | 953364949 | 3:42336422-42336444 | CCTCAGCTCAGGAACTTCCTTTC | No data | ||
| Right | 953364953 | 3:42336440-42336462 | CTTTCTATATAGAAGGAGGCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 953364953 | Original CRISPR | CTTTCTATATAGAAGGAGGC TGG | Intergenic | ||
| No off target data available for this crispr | |||||