ID: 953364953

View in Genome Browser
Species Human (GRCh38)
Location 3:42336440-42336462
Sequence CTTTCTATATAGAAGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953364947_953364953 15 Left 953364947 3:42336402-42336424 CCAGATGAACAAATATAGGTCCT No data
Right 953364953 3:42336440-42336462 CTTTCTATATAGAAGGAGGCTGG No data
953364949_953364953 -5 Left 953364949 3:42336422-42336444 CCTCAGCTCAGGAACTTCCTTTC No data
Right 953364953 3:42336440-42336462 CTTTCTATATAGAAGGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953364953 Original CRISPR CTTTCTATATAGAAGGAGGC TGG Intergenic
No off target data available for this crispr