ID: 953365364

View in Genome Browser
Species Human (GRCh38)
Location 3:42340176-42340198
Sequence ACATAGATGGAGATCATTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953365364_953365367 -1 Left 953365364 3:42340176-42340198 CCCTGAATGATCTCCATCTATGT No data
Right 953365367 3:42340198-42340220 TTTCCTGTCTCTCCCTTAACAGG No data
953365364_953365372 26 Left 953365364 3:42340176-42340198 CCCTGAATGATCTCCATCTATGT No data
Right 953365372 3:42340225-42340247 CCACTGTCTAGCCACATTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953365364 Original CRISPR ACATAGATGGAGATCATTCA GGG (reversed) Intergenic
No off target data available for this crispr