ID: 953365365

View in Genome Browser
Species Human (GRCh38)
Location 3:42340177-42340199
Sequence AACATAGATGGAGATCATTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953365365_953365367 -2 Left 953365365 3:42340177-42340199 CCTGAATGATCTCCATCTATGTT No data
Right 953365367 3:42340198-42340220 TTTCCTGTCTCTCCCTTAACAGG No data
953365365_953365372 25 Left 953365365 3:42340177-42340199 CCTGAATGATCTCCATCTATGTT No data
Right 953365372 3:42340225-42340247 CCACTGTCTAGCCACATTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953365365 Original CRISPR AACATAGATGGAGATCATTC AGG (reversed) Intergenic
No off target data available for this crispr