ID: 953365365 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:42340177-42340199 |
| Sequence | AACATAGATGGAGATCATTC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 953365365_953365367 | -2 | Left | 953365365 | 3:42340177-42340199 | CCTGAATGATCTCCATCTATGTT | No data | ||
| Right | 953365367 | 3:42340198-42340220 | TTTCCTGTCTCTCCCTTAACAGG | No data | ||||
| 953365365_953365372 | 25 | Left | 953365365 | 3:42340177-42340199 | CCTGAATGATCTCCATCTATGTT | No data | ||
| Right | 953365372 | 3:42340225-42340247 | CCACTGTCTAGCCACATTAAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 953365365 | Original CRISPR | AACATAGATGGAGATCATTC AGG (reversed) | Intergenic | ||