ID: 953365366

View in Genome Browser
Species Human (GRCh38)
Location 3:42340189-42340211
Sequence GGAGAGACAGGAAACATAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953365366_953365372 13 Left 953365366 3:42340189-42340211 CCATCTATGTTTCCTGTCTCTCC No data
Right 953365372 3:42340225-42340247 CCACTGTCTAGCCACATTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953365366 Original CRISPR GGAGAGACAGGAAACATAGA TGG (reversed) Intergenic
No off target data available for this crispr