ID: 953365367

View in Genome Browser
Species Human (GRCh38)
Location 3:42340198-42340220
Sequence TTTCCTGTCTCTCCCTTAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953365362_953365367 22 Left 953365362 3:42340153-42340175 CCTGTGGGGTCTTTGTAAGATGC No data
Right 953365367 3:42340198-42340220 TTTCCTGTCTCTCCCTTAACAGG No data
953365363_953365367 0 Left 953365363 3:42340175-42340197 CCCCTGAATGATCTCCATCTATG No data
Right 953365367 3:42340198-42340220 TTTCCTGTCTCTCCCTTAACAGG No data
953365364_953365367 -1 Left 953365364 3:42340176-42340198 CCCTGAATGATCTCCATCTATGT No data
Right 953365367 3:42340198-42340220 TTTCCTGTCTCTCCCTTAACAGG No data
953365365_953365367 -2 Left 953365365 3:42340177-42340199 CCTGAATGATCTCCATCTATGTT No data
Right 953365367 3:42340198-42340220 TTTCCTGTCTCTCCCTTAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953365367 Original CRISPR TTTCCTGTCTCTCCCTTAAC AGG Intergenic
No off target data available for this crispr