ID: 953365372

View in Genome Browser
Species Human (GRCh38)
Location 3:42340225-42340247
Sequence CCACTGTCTAGCCACATTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953365369_953365372 -8 Left 953365369 3:42340210-42340232 CCCTTAACAGGCAATCCACTGTC No data
Right 953365372 3:42340225-42340247 CCACTGTCTAGCCACATTAAAGG No data
953365363_953365372 27 Left 953365363 3:42340175-42340197 CCCCTGAATGATCTCCATCTATG No data
Right 953365372 3:42340225-42340247 CCACTGTCTAGCCACATTAAAGG No data
953365366_953365372 13 Left 953365366 3:42340189-42340211 CCATCTATGTTTCCTGTCTCTCC No data
Right 953365372 3:42340225-42340247 CCACTGTCTAGCCACATTAAAGG No data
953365368_953365372 1 Left 953365368 3:42340201-42340223 CCTGTCTCTCCCTTAACAGGCAA No data
Right 953365372 3:42340225-42340247 CCACTGTCTAGCCACATTAAAGG No data
953365365_953365372 25 Left 953365365 3:42340177-42340199 CCTGAATGATCTCCATCTATGTT No data
Right 953365372 3:42340225-42340247 CCACTGTCTAGCCACATTAAAGG No data
953365370_953365372 -9 Left 953365370 3:42340211-42340233 CCTTAACAGGCAATCCACTGTCT No data
Right 953365372 3:42340225-42340247 CCACTGTCTAGCCACATTAAAGG No data
953365364_953365372 26 Left 953365364 3:42340176-42340198 CCCTGAATGATCTCCATCTATGT No data
Right 953365372 3:42340225-42340247 CCACTGTCTAGCCACATTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953365372 Original CRISPR CCACTGTCTAGCCACATTAA AGG Intergenic
No off target data available for this crispr