ID: 953365400

View in Genome Browser
Species Human (GRCh38)
Location 3:42340417-42340439
Sequence GAGAAGGAGGAGAAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 11535
Summary {0: 7, 1: 77, 2: 663, 3: 2492, 4: 8296}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953365388_953365400 25 Left 953365388 3:42340369-42340391 CCCAACATGGTGGCCTCAGAAAA No data
Right 953365400 3:42340417-42340439 GAGAAGGAGGAGAAGGAGGAGGG 0: 7
1: 77
2: 663
3: 2492
4: 8296
953365392_953365400 12 Left 953365392 3:42340382-42340404 CCTCAGAAAAGGAGAAGGAGAAG No data
Right 953365400 3:42340417-42340439 GAGAAGGAGGAGAAGGAGGAGGG 0: 7
1: 77
2: 663
3: 2492
4: 8296
953365389_953365400 24 Left 953365389 3:42340370-42340392 CCAACATGGTGGCCTCAGAAAAG No data
Right 953365400 3:42340417-42340439 GAGAAGGAGGAGAAGGAGGAGGG 0: 7
1: 77
2: 663
3: 2492
4: 8296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953365400 Original CRISPR GAGAAGGAGGAGAAGGAGGA GGG Intergenic
Too many off-targets to display for this crispr