ID: 953367567

View in Genome Browser
Species Human (GRCh38)
Location 3:42359191-42359213
Sequence GGTACCTAGGCAGCACAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953367567_953367576 23 Left 953367567 3:42359191-42359213 CCCTCTTGTGCTGCCTAGGTACC No data
Right 953367576 3:42359237-42359259 AGGGCCCAAAAAGGAAGACCTGG No data
953367567_953367573 4 Left 953367567 3:42359191-42359213 CCCTCTTGTGCTGCCTAGGTACC No data
Right 953367573 3:42359218-42359240 CAATAGCACCAATAAGCAAAGGG No data
953367567_953367572 3 Left 953367567 3:42359191-42359213 CCCTCTTGTGCTGCCTAGGTACC No data
Right 953367572 3:42359217-42359239 CCAATAGCACCAATAAGCAAAGG No data
953367567_953367575 14 Left 953367567 3:42359191-42359213 CCCTCTTGTGCTGCCTAGGTACC No data
Right 953367575 3:42359228-42359250 AATAAGCAAAGGGCCCAAAAAGG No data
953367567_953367578 25 Left 953367567 3:42359191-42359213 CCCTCTTGTGCTGCCTAGGTACC No data
Right 953367578 3:42359239-42359261 GGCCCAAAAAGGAAGACCTGGGG No data
953367567_953367577 24 Left 953367567 3:42359191-42359213 CCCTCTTGTGCTGCCTAGGTACC No data
Right 953367577 3:42359238-42359260 GGGCCCAAAAAGGAAGACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953367567 Original CRISPR GGTACCTAGGCAGCACAAGA GGG (reversed) Intergenic
No off target data available for this crispr