ID: 953367950

View in Genome Browser
Species Human (GRCh38)
Location 3:42362841-42362863
Sequence ACCAGATTTCTCCATTATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953367950_953367951 24 Left 953367950 3:42362841-42362863 CCTTTATAATGGAGAAATCTGGT No data
Right 953367951 3:42362888-42362910 CAACCTAGCATCCTTTACCATGG No data
953367950_953367952 25 Left 953367950 3:42362841-42362863 CCTTTATAATGGAGAAATCTGGT No data
Right 953367952 3:42362889-42362911 AACCTAGCATCCTTTACCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953367950 Original CRISPR ACCAGATTTCTCCATTATAA AGG (reversed) Intergenic