ID: 953370251 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:42381496-42381518 |
Sequence | CTGACATATGATCCTGAACT CGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
953370248_953370251 | 27 | Left | 953370248 | 3:42381446-42381468 | CCATATTCTTTGCCGGCTGTGTA | No data | ||
Right | 953370251 | 3:42381496-42381518 | CTGACATATGATCCTGAACTCGG | No data | ||||
953370249_953370251 | 15 | Left | 953370249 | 3:42381458-42381480 | CCGGCTGTGTAAAGTGATCAAAG | No data | ||
Right | 953370251 | 3:42381496-42381518 | CTGACATATGATCCTGAACTCGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
953370251 | Original CRISPR | CTGACATATGATCCTGAACT CGG | Intergenic | ||