ID: 953370251

View in Genome Browser
Species Human (GRCh38)
Location 3:42381496-42381518
Sequence CTGACATATGATCCTGAACT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953370248_953370251 27 Left 953370248 3:42381446-42381468 CCATATTCTTTGCCGGCTGTGTA No data
Right 953370251 3:42381496-42381518 CTGACATATGATCCTGAACTCGG No data
953370249_953370251 15 Left 953370249 3:42381458-42381480 CCGGCTGTGTAAAGTGATCAAAG No data
Right 953370251 3:42381496-42381518 CTGACATATGATCCTGAACTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953370251 Original CRISPR CTGACATATGATCCTGAACT CGG Intergenic