ID: 953372182

View in Genome Browser
Species Human (GRCh38)
Location 3:42398026-42398048
Sequence CCGGTTTCCACGGGTCTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 69}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953372169_953372182 17 Left 953372169 3:42397986-42398008 CCATTAGAAATCCTGTTTCGTCA 0: 1
1: 0
2: 1
3: 4
4: 140
Right 953372182 3:42398026-42398048 CCGGTTTCCACGGGTCTTCCAGG 0: 1
1: 0
2: 0
3: 3
4: 69
953372170_953372182 6 Left 953372170 3:42397997-42398019 CCTGTTTCGTCATCCCACCCCTC 0: 1
1: 0
2: 0
3: 17
4: 155
Right 953372182 3:42398026-42398048 CCGGTTTCCACGGGTCTTCCAGG 0: 1
1: 0
2: 0
3: 3
4: 69
953372175_953372182 -8 Left 953372175 3:42398011-42398033 CCACCCCTCAGCGGGCCGGTTTC 0: 1
1: 0
2: 0
3: 12
4: 63
Right 953372182 3:42398026-42398048 CCGGTTTCCACGGGTCTTCCAGG 0: 1
1: 0
2: 0
3: 3
4: 69
953372174_953372182 -7 Left 953372174 3:42398010-42398032 CCCACCCCTCAGCGGGCCGGTTT 0: 1
1: 0
2: 0
3: 6
4: 53
Right 953372182 3:42398026-42398048 CCGGTTTCCACGGGTCTTCCAGG 0: 1
1: 0
2: 0
3: 3
4: 69
953372168_953372182 28 Left 953372168 3:42397975-42397997 CCAGCTGTACGCCATTAGAAATC 0: 1
1: 0
2: 0
3: 5
4: 44
Right 953372182 3:42398026-42398048 CCGGTTTCCACGGGTCTTCCAGG 0: 1
1: 0
2: 0
3: 3
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953372182 Original CRISPR CCGGTTTCCACGGGTCTTCC AGG Intronic
903186822 1:21633795-21633817 CCAGTTCCCTGGGGTCTTCCTGG + Intronic
905168789 1:36098374-36098396 CCGGGTTTCACGGGTCGCCCTGG - Exonic
905232149 1:36521276-36521298 CCGGTTCTCCCGAGTCTTCCAGG - Intergenic
906124626 1:43420131-43420153 CCCATCTCCACTGGTCTTCCAGG + Exonic
912818714 1:112850150-112850172 CCGGCTCCCAGGCGTCTTCCCGG - Intergenic
914833714 1:151190074-151190096 CCGGTTCCCAGCGGTCTTCCGGG + Exonic
922891110 1:229062518-229062540 CCGCTTTCCACGGGAGTTCTGGG - Intergenic
1063236439 10:4121581-4121603 CAGGGTTGCACTGGTCTTCCAGG + Intergenic
1067578720 10:47425744-47425766 CCTGGTTCCATGTGTCTTCCTGG - Intergenic
1072219424 10:93315252-93315274 CCTGTTTCCACGCTGCTTCCAGG - Intronic
1076638416 10:131898503-131898525 CAGGTTTTCAAGTGTCTTCCTGG + Intergenic
1080587571 11:33695488-33695510 CCAGTTTCCACCTGGCTTCCTGG + Intergenic
1084009347 11:66338940-66338962 CCTGGTTCCAGGGGTCGTCCTGG + Intronic
1096389287 12:51217108-51217130 CCGGGTCCCACCGGTCGTCCCGG + Intronic
1104245949 12:127041680-127041702 CCTGTTTCCACGGGCCCTACAGG + Intergenic
1112627654 13:101123887-101123909 CAGGTTTGCAGGGGGCTTCCTGG + Intronic
1120537822 14:85718805-85718827 CTGGTTTCCTCTGGCCTTCCTGG + Intergenic
1131066019 15:89435574-89435596 CCGGTTTCCTGGGGCCTCCCTGG + Intergenic
1131778009 15:95823272-95823294 CCAGAGGCCACGGGTCTTCCCGG - Intergenic
1132508387 16:324191-324213 CGGGTCTTTACGGGTCTTCCGGG + Intronic
1136892612 16:33979641-33979663 CCCGTTGCCACGGGTGTGCCTGG - Intergenic
1138201344 16:55091150-55091172 CAGGTATCCACGGGCCTTCTTGG - Intergenic
1138293279 16:55866237-55866259 CCGGTTTCCCCAGCTCCTCCAGG - Intronic
1138656102 16:58492337-58492359 CCTGTTCCCACGGGACTTCAGGG + Intronic
1141069224 16:80938259-80938281 CCGTTTGCCACGTGACTTCCAGG - Intergenic
1203080428 16_KI270728v1_random:1143982-1144004 CCCGTTGCCACGGGTGTGCCTGG + Intergenic
1142524874 17:533100-533122 CCGGTTTTCCCGGGCCTGCCAGG - Intronic
1144487938 17:15683111-15683133 CCGTTCTCCACGTATCTTCCTGG + Exonic
1148351702 17:46946017-46946039 CCGCCTTCCAAGGGTCTCCCAGG - Intronic
1154077615 18:11219434-11219456 ACGGTTTCCAAGGATGTTCCTGG - Intergenic
1156553332 18:38041375-38041397 CCGGTTTTAACGCGTCCTCCTGG - Intergenic
1158678513 18:59545149-59545171 CAGGTATCCACGGACCTTCCTGG + Intronic
1160497430 18:79383599-79383621 TCGGTTGCCTCGGCTCTTCCAGG + Intergenic
1161490739 19:4559825-4559847 CCGGATTCCACGTGTGTTCAGGG + Intergenic
927973875 2:27323174-27323196 CCGCTCTCCACGGGTATTCATGG - Intronic
928332709 2:30369887-30369909 CAGGTTTACATGGCTCTTCCAGG - Intergenic
929560134 2:42951367-42951389 CGGGTTTCCTGGTGTCTTCCTGG - Intergenic
931771811 2:65503876-65503898 GCTGTTTCCACGGGTGTTTCAGG + Intergenic
933968261 2:87448254-87448276 CAGTTTTCCACTGATCTTCCTGG - Intergenic
936325536 2:111502250-111502272 CAGTTTTCCACTGATCTTCCTGG + Intergenic
947201933 2:227621762-227621784 CTCGTTTCCACGTGCCTTCCTGG - Intronic
1168998490 20:2149645-2149667 CTGGGTTCCCCGGGTCTCCCTGG - Intronic
1175113243 20:56663836-56663858 CTGCTTTCCACGGGTGTTCAGGG + Intergenic
1175444912 20:59013311-59013333 CCGGTTGCCACTGGCTTTCCAGG + Intergenic
1177860460 21:26446739-26446761 GCAGTTTCCACAGGTCTACCAGG + Intergenic
1179213532 21:39348373-39348395 TCGTTTTCCGCGGGTCGTCCCGG - Intronic
1180099241 21:45576721-45576743 CTGGTTTCCATGGGTCTTCGGGG + Intergenic
1180987419 22:19913034-19913056 CCAGTCCCCACGGGTCTCCCAGG - Intronic
1181486860 22:23237046-23237068 CCGGTTGCCACGGTTCTCCCAGG + Intronic
950712311 3:14821122-14821144 CCAGCTACCACGGGCCTTCCAGG + Exonic
953372182 3:42398026-42398048 CCGGTTTCCACGGGTCTTCCAGG + Intronic
954029709 3:47810261-47810283 CAGGTTTCCTTGGGACTTCCAGG - Intronic
962535751 3:136327558-136327580 CTGGTTTCCTGGGGTCTTTCAGG + Intronic
969673235 4:8601265-8601287 CCGGGTTGCACTGGCCTTCCAGG - Exonic
971929611 4:33063355-33063377 CTGGTTTTCACTGGTTTTCCAGG + Intergenic
985111240 4:186547578-186547600 CTGGATTCCACGTGTCCTCCTGG + Intronic
997419036 5:133751218-133751240 CCTGTTTCCTGGGGTCTTCTTGG - Intergenic
1003625129 6:7734502-7734524 TGGGTTTCCTCGGCTCTTCCAGG - Intronic
1005064959 6:21808847-21808869 CCGGTTTGCACAGAACTTCCTGG - Intergenic
1013635453 6:112025104-112025126 GTGGGTTCCACGGGTCTTCTTGG - Intergenic
1022466515 7:30656090-30656112 TCGGTTTCCAGGGGTCTGCGGGG - Intronic
1022561953 7:31358671-31358693 CCCGTTCCCTCGGCTCTTCCTGG + Intergenic
1023185070 7:37524546-37524568 CCAGTTTCCAGGGGTCCTTCAGG - Intergenic
1024271855 7:47648655-47648677 CTGGTCTCCACGGATCTGCCTGG - Intergenic
1024842186 7:53600119-53600141 CCGCTTTCCTCTGGGCTTCCAGG - Intergenic
1025811186 7:64876686-64876708 CCTCTTGCCACGGATCTTCCTGG + Intronic
1026598543 7:71754221-71754243 ACGGTTTCCAGGGGTCTCCTAGG - Intergenic
1032490082 7:132318021-132318043 CCGGGTTACTCGGGTCTTCAGGG - Intronic
1038164100 8:25068000-25068022 TCTGTTTCCTCGGGTCTACCAGG - Intergenic
1052445719 9:28558440-28558462 CCTGTGTCCACGTGTCCTCCAGG + Intronic
1062270112 9:135704438-135704460 CCAGTTTGCAGGGGTCTTCACGG + Intronic
1187537467 X:20156065-20156087 CTGTTTTCCACAGGTCCTCCAGG - Intronic
1189328815 X:40130344-40130366 GAGGTTTCCCCTGGTCTTCCTGG + Intronic