ID: 953372182

View in Genome Browser
Species Human (GRCh38)
Location 3:42398026-42398048
Sequence CCGGTTTCCACGGGTCTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 69}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953372170_953372182 6 Left 953372170 3:42397997-42398019 CCTGTTTCGTCATCCCACCCCTC 0: 1
1: 0
2: 0
3: 17
4: 155
Right 953372182 3:42398026-42398048 CCGGTTTCCACGGGTCTTCCAGG 0: 1
1: 0
2: 0
3: 3
4: 69
953372168_953372182 28 Left 953372168 3:42397975-42397997 CCAGCTGTACGCCATTAGAAATC 0: 1
1: 0
2: 0
3: 5
4: 44
Right 953372182 3:42398026-42398048 CCGGTTTCCACGGGTCTTCCAGG 0: 1
1: 0
2: 0
3: 3
4: 69
953372169_953372182 17 Left 953372169 3:42397986-42398008 CCATTAGAAATCCTGTTTCGTCA 0: 1
1: 0
2: 1
3: 4
4: 140
Right 953372182 3:42398026-42398048 CCGGTTTCCACGGGTCTTCCAGG 0: 1
1: 0
2: 0
3: 3
4: 69
953372174_953372182 -7 Left 953372174 3:42398010-42398032 CCCACCCCTCAGCGGGCCGGTTT 0: 1
1: 0
2: 0
3: 6
4: 53
Right 953372182 3:42398026-42398048 CCGGTTTCCACGGGTCTTCCAGG 0: 1
1: 0
2: 0
3: 3
4: 69
953372175_953372182 -8 Left 953372175 3:42398011-42398033 CCACCCCTCAGCGGGCCGGTTTC 0: 1
1: 0
2: 0
3: 12
4: 63
Right 953372182 3:42398026-42398048 CCGGTTTCCACGGGTCTTCCAGG 0: 1
1: 0
2: 0
3: 3
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953372182 Original CRISPR CCGGTTTCCACGGGTCTTCC AGG Intronic