ID: 953375449

View in Genome Browser
Species Human (GRCh38)
Location 3:42424383-42424405
Sequence CTGAATATATAAATGGATAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953375449_953375452 -1 Left 953375449 3:42424383-42424405 CCATTATCCATTTATATATTCAG No data
Right 953375452 3:42424405-42424427 GTCCCTCACCATTAAATGATGGG No data
953375449_953375451 -2 Left 953375449 3:42424383-42424405 CCATTATCCATTTATATATTCAG No data
Right 953375451 3:42424404-42424426 AGTCCCTCACCATTAAATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953375449 Original CRISPR CTGAATATATAAATGGATAA TGG (reversed) Intergenic
No off target data available for this crispr