ID: 953377954

View in Genome Browser
Species Human (GRCh38)
Location 3:42444701-42444723
Sequence ACTGGGCAGTGCCCCAGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953377954_953377958 -6 Left 953377954 3:42444701-42444723 CCCTCACTGGGGCACTGCCCAGT No data
Right 953377958 3:42444718-42444740 CCCAGTGGAACTGTGAGAAGAGG No data
953377954_953377960 -5 Left 953377954 3:42444701-42444723 CCCTCACTGGGGCACTGCCCAGT No data
Right 953377960 3:42444719-42444741 CCAGTGGAACTGTGAGAAGAGGG No data
953377954_953377963 21 Left 953377954 3:42444701-42444723 CCCTCACTGGGGCACTGCCCAGT No data
Right 953377963 3:42444745-42444767 CCGTCCTCCAGACCCCAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953377954 Original CRISPR ACTGGGCAGTGCCCCAGTGA GGG (reversed) Intergenic