ID: 953380049

View in Genome Browser
Species Human (GRCh38)
Location 3:42463159-42463181
Sequence TTGGATCTGAATCTTGTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953380049_953380054 23 Left 953380049 3:42463159-42463181 CCAGACACAAGATTCAGATCCAA No data
Right 953380054 3:42463205-42463227 CTGGCATAAGACCAATGTCTAGG No data
953380049_953380052 4 Left 953380049 3:42463159-42463181 CCAGACACAAGATTCAGATCCAA No data
Right 953380052 3:42463186-42463208 CAGGTCCTGATTCAAGATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953380049 Original CRISPR TTGGATCTGAATCTTGTGTC TGG (reversed) Intergenic
No off target data available for this crispr